Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Vectors in gene therapy wikipedia , lookup
Paracrine signalling wikipedia , lookup
Monoclonal antibody wikipedia , lookup
Western blot wikipedia , lookup
Biochemical cascade wikipedia , lookup
Polyclonal B cell response wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Journal of Cell Science 109, 1727-1738 (1996) Printed in Great Britain © The Company of Biologists Limited 1996 JCS9465 1727 Formation of crystalloid endoplasmic reticulum in COS cells upon overexpression of microsomal aldehyde dehydrogenase by cDNA transfection Akitsugu Yamamoto*, Ryuichi Masaki and Yutaka Tashiro Department of Physiology, and Division of Cell Biology, Liver Research Center, Kansai Medical University, Moriguchi, Osaka 570, Japan *Author for correspondence (e-mail: [email protected]) SUMMARY When rat liver microsomal aldehyde dehydrogenase (msALDH) was overexpressed in COS-1 cells by cDNA transfection, large granular structures containing both msALDH and endogenous protein disulfide isomerase appeared (Masaki et al. (1994) J. Cell Biol. 126, 1407-1420). Confocal laser microscopy revealed that these granular structures are dispersed throughout the cytoplasm. Electron microscopy showed that the structures are composed of regularly arranged crystalloid smooth endoplasmic reticulum (ER). The formation of the crystalloid ER was accompanied by a remarkable proliferation of smooth ER, which appeared occasionally continuous to the rough ER. We suggest that the smooth ER, proliferated from the rough ER, is transformed and assembled into the crystalloid ER by head-to-head association of the msALDH molecules on the apposed smooth ER membranes. In order to understand the molecular mechanism of the crystalloid ER formation, we asked which portions of the msALDH molecules are needed for the crystalloid ER formation by expressing deletion mutants or chimera protein of msALDH in COS-1 cells. The overexpression of msALDH molecules lacking the stem region preceding the membrane spanning region, although they were exclusively localized in the ER, did not induce the formation of crystalloid ER. More detailed analysis showed that the amino acid sequence FFLL, located in the stem region, is necessary to form the crystalloid ER. The chimera protein containing the last 35 amino acids of msALDH at the carboxyl terminus of chloramphenicol acetyltransferase was localized to the ER, but did not induce the formation of the crystalloid ER. These results suggest that at least two regions, the bulky amino-terminal region and the FFLL sequence in the stem region of msALDH molecules are required for the formation of the crystalloid ER. INTRODUCTION inhibited yeast cells (Nishikawa et al., 1994), cisternal stacks of the smooth ER in cerebellar Purkinje cells (Otsu et al., 1990; Satoh et al., 1990; Yamamoto et al., 1991; Takei et al., 1992), and crystalloid ER in compactin resistant UT-1 cells (Chin et al., 1982; Anderson et al., 1983; Orci et al., 1984; Pathak et al., 1986; Kochevar and Anderson, 1987). In UT-1 cells crystalloid ER is an aggregate of smooth tubules packed in a hexagonal array (Chin et al., 1982; Anderson et al., 1983; Orci et al., 1984; Pathak et al., 1986; Kochevar and Anderson, 1987). Aggregation of smooth ER similar to the crystalloid ER has been reported as paracrystalline ER in luminous cells (photocytes) of marine annelid (Bassot, 1966) and in germ cells of hemiptera species (Wolf and Motzko, 1995). In these cells, the crystalloid (paracrystalline) ER appears as a square or hexagonal array of tubular smooth ER or as a regular array of undulating smooth ER (Bassot, 1966; Wolf and Motzko, 1995). When the compactin-withdrawn UT-1 cells, which do not exhibit any crystalloid ER, are incubated in the presence of Both rough and smooth endoplasmic reticulum (ER) change their structure and function dynamically according to the differentiation and functional state of cells, and occasionally one of the two subcompartments develops disproportionally (Sitia and Meldolesi, 1992). Rough ER increases markedly in size during B cell differentiation (Wiest et al., 1990). Moreover, when treated with dexamethasone, AR42J cells reorganize the rough ER structure from the tubulo-vesicular to the cisternal configuration concomitantly with the increase in the secretory activity (Rajasekaran et al., 1993). Administration of phenobarbital causes remarkable proliferation of smooth ER in hepatocytes accompanied by the induction of drug metabolizing enzymes such as cytochrome P-450 (Remmer and Merker, 1963; Orrenius et al., 1965; Stäubli et al., 1969). Unique ER subcompartments are present or develop in cells, such as the sarcoplasmic reticulum in muscle cells, annulate lamellae (Kessel, 1992), BiP bodies in secretion- Key words: Microsomal aldehyde dehydrogenase, Crystalloid endoplasmic reticulum, Endoplasmic reticulum, cDNA transfection 1728 A. Yamamoto, R. Masaki and Y. Tashiro Fig. 1. Immunofluorescence confocal laser micrographs of the msALDHtransfected COS-1 cells. COS-1 cells were transfected with cDNA for msALDH and fixed 48 hours after transfection, and doubly immuno-stained for msALDH (A,C,E,F) and PDI (B,D) using FITC- and TRITC-conjugated second antibody, respectively. MsALDH (A,C) and PDI (B,D) are well colocalized on the granular structures. An arrow in B shows a cell not expressing msALDH. When msALDH was weakly expressed, reticular or patchy staining (arrowheads in A) was observed. Vertical optical serial sections (E) and a reconstituted stereo view (F) are shown. N, nucleus. Bars, 10 µm. compactin, crystalloid ER arises in response to the overexpression of an ER membrane protein, 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase (Chin et al., 1982; Orci et al., 1984; Kochevar and Anderson, 1987). Pathak et al. (1986) traced the biogenesis of the crystalloid ER in UT-1 cells and showed that folds of the smooth ER membrane emerge from the nuclear envelope and transform into the crystalloid ER. Transfection of cDNA encoding HMG-CoA reductase also results in the formation of crystalloid ER in CHO cells (Jingami et al., 1987; Roitelman et al., 1992), whereas transfection of cDNA encoding either a truncated protein lacking the membrane spanning region or a mutant protein deleted two contiguous membrane spanning regions (numbers 4 and 5) did not cause the formation of crystalloid ER (Jingami et al., 1987). These results suggest the importance of the membrane spanning region for the formation of the crystalloid ER. The precise mechanism of the formation of the structure, however, remains to be clarified. Rat liver microsomal aldehyde dehydrogenase (msALDH) is a typical tail-anchored protein, which has no amino-terminal signal sequence, but instead has a hydrophobic membrane spanning region at its carboxyl terminus, and leaves most of the molecule in the cytoplasmic compartment (Miyauchi et al., 1991; Masaki et al., 1994). The insertion of msALDH into the ER membrane occurs post-translationally (Takagi et al., 1985). Recently we have studied the mechanism of insertion and localization of msALDH to the ER membrane using transfection of wild type and various mutant cDNAs into COS-1 cells and showed that the C-terminal 35 amino acids containing a membrane spanning region are sufficient for targeting to and retention of this protein in the ER compartment (Masaki et al., Crystalloid ER formation by msALDH 1729 against α-tubulin was purchased from Sigma Chemical Company (St Louis, MO). 1994). During this study, we have also found that the large granular structures resembling the crystalloid ER of UT-1 cells appeared in COS-1 cells when transfected with the cDNA of wild-type msALDH, and that msALDH colocalized in the granular structures with an intrinsic ER protein, protein disulfide isomerase (PDI) (Masaki et al., 1994). In this report, we show by electron microscopy and immunofluorescence microscopy that the granular structures are typical crystalloid ER, and analyze how the crystalloid ER is formed by investigating which portions of the msALDH molecule are needed for the crystalloid ER formation. These studies suggest that the smooth ER proliferates from the rough ER and is transformed and assembled into the crystalloid ER. In addition to the membrane spanning region, at least two regions of msALDH molecule located on the cytoplasmic side of ER, the bulky amino terminal region and the FFLL sequence in the stem region, are required for the formation of the crystalloid ER. MATERIALS AND METHODS Materials Brefeldin A was purchased from Epicentre Technologies (Madison, WI). Colchicine, cytochalasin B and thapsigargin were from Wako Chemical (Tokyo, Japan). Rabbit polyclonal antibody against msALDH has been prepared and characterized as described (Akagi et al., 1988; Masaki et al., 1994). Rabbit anti-chloramphenicol acetyltransferase (CAT) antibody was obtained from 5 Prime, Inc. (Boulder, CO). Mouse monoclonal antibody against PDI (β-subunit of human prolyl 4-hydroxylase) was purchased from Fuji Yakuhin Kogyo Co., Ltd (Toyama, Japan). Mouse monoclonal antibody against human CD63 (Metzelaar et al., 1991) was from Immunotech S. A. (Marseille, France). Monoclonal antibody (8G5) against vesicular stomatitis virus (VSV)-G protein was a kind gift from Dr Mituo Tagaya (Tokyo University of Pharmacy and Life Science). Mouse monoclonal antibody Plasmid construction Construction of expression plasmids pCDALDH and pMIWCAT/ALDH1 has been described previously (Masaki et al., 1994). The gapped duplex method of oligonucleotide-directed mutagenesis (Kramer and Frits, 1987) was used for deletion of msALDH cDNA. The full-length msALDH cDNA was cloned into the EcoRI site of M13tv18 prepared from an umber mutant phage, and singlestranded phage DNA was purified for use as the template for mutagenesis. Synthetic oligonucleotides (1) 5′ GAGTCCAAGGTCAGCAGGCTGCAGCTGCTG 3′; (2) 5′ GAGTCCAAGGTCAGCTTCTTCCTGCTGAAAC 3′; (3) 5′ GTCAGCTGGTCGGAAAAAACAGTTCAACAAAG 3′; (4) 5′ AAATTCTTCCTGCTGAACAAAGGAAGGCTG 3′; (5) 5′ CTGCTGAAACAGTTCCTGCAGCTGCTGCTTC 3′; (6) 5′ AAATTCTTCCTGCTGAACAAAGGAAGGCTG 3′; and (7) 5′ TCGAAATTCTTCCTGAAACAGTTCAACAAAG 3′, were used for construction of cDNAs for ALDH∆450-462, ALDH∆450-452, ALDH∆453-456, ALDH∆457-459, ALDH∆460-463, ALDH∆453, and ALDH∆456, respectively. After hybridization of the oligonucleotide and a PvuII fragment derived from M13mp18 with the template DNA, second strand synthesis was carried out with T4 DNA polymerase and Escherichia coli DNA ligase, and the resultant double-stranded DNA was transfected into E. coli BMH71-18 mutS for amplification. Phage recovered from E. coli BMH71-18 mutS were then transfected into E. coli MV1184 to select non-umber ones, and single-stranded DNA from two to six plaques was sequenced to confirm the desired mutations. The mutated cDNAs were excised from the double-stranded replicative form DNAs and cloned into the EcoRI site of the pCD vector. The right orientation was verified by restriction enzyme digestion. For construction of pMIWVSV-G, plasmid pSV2TKneo (a kind gift from Dr Takashi Morimoto) was digested with HindIII. The isolated fragment was then ligated to the pMIW vector cut with HindIII. Cell culture and transfection COS-1 cells were maintained in DME with 10% FBS, 50 U/ml penicillin, and 50 µg/ml streptomycin at 37°C in a 5% CO2 incubator, and were replated by trypsinization the day before transfection. Transfection was performed using the calcium phosphate precipitation method (Wigler et al., 1978) as described previously (Masaki et al., 1994). For immunofluorescence experiments, cells were grown on coverslips in a 35 mm dish and were transfected with 4 µg plasmid DNA per dish. For immunogold localization, cells were plated in a 60 mm dish, and were transfected with 10 µg plasmid DNA per dish. Indirect immunofluorescence microscopy and confocal laser microscopy Cells grown on coverslips were used for immunofluorescence microscopy as described previously (Masaki et al., 1994). Cells were washed with phosphate buffered saline (PBS), fixed in 4% paraformaldehyde in PBS containing 1 mM CaCl2 and 0.5 mM MgCl2 (PBS+) for 20 minutes, and permeabilized with 0.1 % Triton X-100 in PBS(+) for 1 hour. They were then rinsed twice with PBS(+), and incubated with 2% FBS in PBS(+) for 1 hour followed by 45 minutes incubation with primary antibody in 2% FBS/PBS(+). After washing four times (5 minutes each) with PBS(+), cells were incubated with secondary antibody in 2% FBS/PBS(+) for 45 minutes. After washing with PBS(+), they were then mounted on glass slides with 90% glycerol in PBS containing 1 mg/ml paraphenylenediamine, and observed under an Olympus BH-2 microscope (Olympus Corp., Tokyo, Japan) or an Olympus LSM-GB200 confocal laser microscope (Olympus Corp., Tokyo, Japan). Conventional electron microscopy Transfected cells were harvested by centrifugation at 1,000 g for 3 1730 A. Yamamoto, R. Masaki and Y. Tashiro minutes, then the pellet was fixed with 2.5% glutaraldehyde dissolved in 0.1 M cacodylate buffer, pH 7.4, for 1 hour, postfixed in 1% OsO4, dehydrated in a series of ethanols, then embedded in Epon. Immunoelectron microscopy on frozen ultrathin sections Frozen ultramicrotomy was performed as described by Tokuyasu (1986). A pellet of transfected cells was fixed with 4% paraformaldehyde and 0.1% glutaraldehyde dissolved in 0.1 M sodium cacodylate buffer, pH 7.4, for 15 minutes. Small pieces of the fixed pellets of COS-1 cells were incubated overnight in 0.1 M sodium phosphate buffer, pH 7.4, containing 2.3 M sucrose and 20% polyvinyl pyrrolidone, and rapidly frozen in liquid propane at −180°C. Frozen ultrathin sections were cut with a Reichert Ultracut-N ultramicrotome (Reichert, Wien, Australia) with a cryoattachment (FC-4D). The sections were picked up on Formvar-carbon-coated nickel grids, incubated with 2% gelatin in PBS containing 10 mM glycine, then reacted with rabbit polyclonal anti-msALDH antibody (10 µg/ml) and with mouse monoclonal anti-PDI antibody (10 µg/ml) diluted in the gelatin solution for 30 minutes. The sections were washed six times with gelatin solution, and reacted with goat anti-rabbit IgG gold conjugate (10 nm in diameter) and anti-mouse IgG gold conjugate (5 nm in diameter) (British BioCell, Cardiff, UK) for 15 minutes. After washing with sodium cacodylate buffer, pH 7.4, the sections were postfixed in 2% glutaraldehyde, then in 1% OsO4, stained with uranyl acetate, embedded in LR white resin, and observed with an Hitachi H-7000 electron microscope (Hitachi, Tokyo, Japan). RESULTS Confocal laser microscopic observation of the msALDH-transfected COS-1 cells Expression of wild-type msALDH caused marked morphological alteration of the ER in COS-1 cells, as reported previously (Masaki et al., 1994). The changes in the ER structure were analyzed in detail by a confocal laser microscope. For this purpose, COS-1 cells were immuno-labeled for both msALDH and an endogenous ER protein, PDI, at 48 hours after transfection of msALDH. As shown in Fig. 1A-D, expressed msALDH and endogenous PDI were exactly colocalized. In the COS-1 cells not expressing msALDH, the immunofluorescence staining of PDI showed a typical reticular pattern (arrow in Fig. 1B). When msALDH was strongly expressed in COS1 cells, large granular structures containing both msALDH and PDI appeared in addition to the reticular staining (Fig. 1A-D). These granular structures were dispersed throughout the cytoplasm (Fig. 1C), though in some cells they were preferentially located around the nucleus (Fig. 1A). In the COS-1 cells in which msALDH was weakly expressed, both msALDH and PDI showed reticular as well as patchy localization (arrowheads in Fig. 1A). The latter may correspond to small aggregates of the ER. Fig. 1E shows confocal optical serial sections of a COS-1 cell strongly expressing msALDH. The msALDH positive granular structures appeared throughout the cytoplasm near and apart from the nucleus. A three dimensional view of the cell is reconstituted in Fig. 1F. Time course of appearance of granular structures We examined the time course of appearance of the granular structures by immunofluorescence microscopy (Fig. 2). MsALDH positive cells were first detected at 4 hours after transfection (Fig. 2A). At 8-12 hours, a reticular staining pattern became more apparent, but no granular structures were detected (Fig. 2C and E). MsALDH and PDI positive granular structures first appeared at 24 hours and further increased during the next 24 hours (Fig. 2G and I). Among the msALDH positive cells at 24 and 48 hours after the transfection, the percentage of the cells showing the granular staining was ~9% and ~54%, respectively. MsALDH and PDI were always colocalized during the appearance of the granular structures (Fig. 2). Electron microscopic observation COS-1 cells transfected with the cDNA for msALDH investigated electron microscopically, exhibited crystalloid ER in the cytoplasm (Fig. 3A-C). The crystalloid ER is composed either of tubular smooth ER packed together in a regular square (Fig. 3A and upper inset in C), or hexagonal pattern (lower inset in Fig. 3C) like UT-1 cells (Chin et al., 1982), or of undulating smooth ER in a regular array (Fig. 3B). Similar square and undulating patterns have been reported in luminous cells of marine annelid (Bassot, 1966) and in germ cells of hemiptera species (Wolf and Motzko, 1995). In some cases, the direction of the arrangement changed (Fig. 3C). Direct connection of the crystalloid ER to the nucleus was never detected. Sometimes vacuoles containing membrane wheels were associated with the crystalloid ER (Fig. 3A and B). Marked proliferation of the smooth ER was also observed in the COS-1 cells transfected with msALDH (Fig. 3D and E), and the proliferated smooth ER was occasionally continuous to rough ER cisternae (arrows in Fig. 3D and E), indicating that the smooth ER originates from the rough ER. Neither crystalloid ER nor proliferation of the smooth ER was observed in the COS-1 cells without transfection (Fig. 3F). Immunogold-electron microscopic observation To confirm the localization of msALDH on the crystalloid ER, ultra-thin cryosections of the COS-1 cells were doubly stained by the immuno-gold technique. MsALDH and PDI were densely colocalized on the crystalloid ER (Fig. 4). Formation of crystalloid ER does not interfere with intracellular transport of proteins According to Nishikawa et al. (1994), protein transport from the ER to the Golgi apparatus is inhibited when the BiP bodies are formed. We examined therefore whether the formation of the crystalloid ER disturbs intracellular protein export from the ER to the final destinations. For this purpose, we used an exogenously expressed protein, VSV-G protein (a plasma membrane protein), and an endogenous protein, CD63 (a lysosomal membrane protein; Metzelaar et al., 1991). Fig. 5A and B show immunofluorescence micrographs of a COS-1 cell transfected with cDNA for VSV-G protein 48 hours after transfection of msALDH cDNA, and fixed 24 hours after the second transfection. Expressed VSV-G protein was mainly localized on the plasma membrane and never detected in the crystalloid ER. No difference in the localization of VSV-G protein was detected between the msALDH-expressed and unexpressed cells. CD63 was localized in the lysosome-like punctate structures around the nucleus both in the msALDH-expressed and in the unexpressed cells. CD63 was not detected in the crystalloid ER (Fig. 5C and D). These results suggest that the formation of the crystalloid ER does not disturb intracellular transport from the ER either to the plasma membranes, or to lysosomes. Crystalloid ER formation by msALDH 1731 Fig. 2. Time course of the appearance of granular structures. COS-1 cells were transfected with cDNA for msALDH and fixed at 4 hours (A and B), 8 hours (C and D), 12 hours (E and F) 24 hours (G and H), 48 hours (I and J) after transfection, and doubly immuno-stained for msALDH (A,C,E,G,H) and PDI (B,D,F,H,I), respectively. Bar, 20 µm. Formation of crystalloid ER in deletion mutants of msALDH In order to determine which part of msALDH molecules is responsible for the formation of crystalloid ER, we expressed several deletion mutants of msALDH in COS-1 cells. As shown in Fig. 6, msALDH has a hydrophobic membrane spanning region (amino acids 464-480) near the carboxyl terminus. In the previous study (Masaki et al., 1994), we found that the protein can be localized to the ER membrane, if it contains the hydrophobic region and one of the two hydrophilic sequences KQF (amino acids 457-459) or KDQL (amino acids 481-484) on both sides of the hydrophobic region. The mutant protein lacking membrane spanning region could not locate to the ER membrane and form crystalloid ER in COS-1 cells, whereas the mutant protein lacking only the carboxyl terminal KDQL was localized to the ER and formed the granular structures (Masaki et al., 1994). The effects of deletions of the stem region on the crystalloid ER formation were now investigated (Fig. 6). Fig. 7A-G shows intracellular localization of the deletion mutants of msALDH lacking the stem region (amino acids 450463). The level of expression of the mutant proteins was presumed to be similar as there were no marked differences in 1732 A. Yamamoto, R. Masaki and Y. Tashiro Fig. 3. Electron micrographs of the COS-1 cells. COS-1 cells transfected with cDNA for msALDH (A-E) and untreated COS-1 cells (F) were processed for conventional electron microscopy. Crystalloid ER (C) forms in the COS-1 cells transfected with cDNA for msALDH (A-C). Upper and lower insets in C show higher magnification views of the parts indicated by an arrow and an arrowhead, respectively. The crystalloid ER shows square (A and upper inset in C) or hexagonal (lower inset in C) arrays of undulating smooth ER (B). Asterisks in A and B show vacuoles containing membrane wheels. Marked proliferation of the smooth ER (S) was observed in the COS-1 cells transfected with cDNA for msALDH (D and E). Arrows in D and E show the continuity between the smooth ER and rough ER (R). G, Golgi apparatus. A, ×7,200; B, ×20,000; C, ×40,000; inset ×80,000; D, ×40,000; E, ×24,000; F, ×12,000. Bars, 0.5 µm. the strength of the immunofluorescence staining among them. Deletion of the whole stem region abolished the formation of crystalloid ER (Fig. 7A), although the deletion mutant normally located to the ER. When the FFLL sequence (amino acids 453456) only in the stem region was deleted, formation of the crystalloid ER was also inhibited (Fig. 7C). In contrast deletion of a single amino acid F (amino acid 453) or L (amino acid 456) did not affect the formation of the crystalloid ER. These results suggest that the FFLL sequence in the stem region is important for the formation of the crystalloid ER in the COS-1 cells. Fig. 7H shows the distribution of a chloramphenicol acetyltransferase (CAT) fusion protein containing the last 35 amino acids (stem, hydrophobic, and KDQL regions) of msALDH at the carboxyl terminus. In agreement with our previous report (Masaki et al., 1994), this chimera protein located on the ER but did not induce crystalloid ER formation. This result suggests that the carboxyl terminal 35 amino acids is insufficient to induce the formation of the crystalloid ER and that the bulky amino terminal domain (amino acid 1-449) is essential for the formation of the crystalloid ER. Crystalloid ER formation by msALDH 1733 Effect of various drugs on formation of crystalloid ER We examined the effect of brefeldin A, an inhibitor of ER-Golgi transport (Misumi et al., 1986; Lippincott-Schwartz et al., 1989); colchicine, an anti-microtubule drug; cytochalasin B, an anti-microfilament drug; and thapsigargin, an inhibitor of ER Ca-ATPase (Thastrup et al., 1990), on the formation of the crystalloid ER (Fig. 8). COS-1 cells were incubated for 1 hour in the presence of either 10 µg/ml brefeldin A (Fig. 8B), 1 µM colchicine (Fig. 8C), 5 µM cytochalasin B (Fig. 8E) or 100 nM thapsigargin (Fig. 8F) 48 hours after transfection of cDNA for msALDH, and the formation of the crystalloid ER was examined by immunofluorescence microscopy to detect msALDH. None of these drugs did affect the formation of the granular immunofluorescence corresponding to the crystalloid ER. Depolymerization of microtubules by colchicine treatment was confirmed by immunofluorescence staining of α-tubulin (Fig. 8D). DISCUSSION In this report, we have shown that overexpression of wild-type msALDH by cDNA transfection induces formation of the crys- 1734 A. Yamamoto, R. Masaki and Y. Tashiro talloid ER in COS-1 cells. Crystalloid ER is an aggregate of the smooth ER in a regular array. Similar structures have been Fig. 4. Double immuno-gold localization of msALDH and PDI in the msALDH transfected COS-1 cells. COS-1 cells were transfected with cDNA for msALDH and fixed 48 hours after transfection, and doubly immuno-stained for msALDH (10 nm gold particles) and PDI (5 nm gold particles), successively. N, nucleus; C, crystalloid ER. Bar, 0.2 µm. reported in some animal cells (Bassot, 1966; Chin et al., 1982; Wolf and Motzko, 1995). In UT-1 cells, formation of the crystalloid ER was accompanied by a marked increase in the content of HMG-CoA reductase (Chin et al., 1982). Overexpression of a single ER membrane protein, HMG-CoA reductase, by cDNA transfection caused formation of crystalloid ER in CHO cells (Jingami et al., 1987; Roitelman et al., 1992). The insertion of msALDH into the ER membrane in vivo appears to be quite different from that of HMG-CoA reductase. The latter spans the ER membrane several times at the aminoterminal one-third, and the carboxyl two-thirds of the polypeptide chain (catalytic site) faces the cytosolic side (Liscum et al., 1985, Roitelman et al., 1992). The enzyme is co-translationally inserted into the ER membrane in a signal recognition particle (SRP) dependent manner (Brown and Simoni, 1984), although it lacks a cleavable signal sequence (Brown and Simoni, 1984). On the other hand, msALDH is a typical tail-anchored protein. It also lacks a cleavable signal sequence at the amino terminus but has a hydrophobic membrane spanning region at the carboxyl terminus (Miyauchi et al., 1991). It is synthesized in the free polysomes (Takagi et al., 1985), and the hydrophobic domain is post-translationally inserted into the ER membranes, leaving the amino-terminal domain in the cytoplasmic side (Miyauchi et al., 1991; Masaki et al., 1994). Kutay et al. (1995) suggested that synaptobrevin, a tail-anchored protein is inserted into the ER membrane through a pathway independent of SRP and sec61p. Despite the difference in the mode of insertion into the ER membrane, HMG-CoA reductase and msALDH have a common feature: that they expose a large portion of the molecules to the cytoplasmic side of the ER membrane. This overall structure of the two kinds of molecules may be needed for the formation of crystalloid ER. As the membrane topology of msALDH is much simpler than that of HMG-CoA reductase, msALDH may be more suitable for Fig. 5. Indirect immunofluorescence microscopic localization of VSV-G protein and CD63 in the COS-1 cells forming crystalloid ER. For the localization of VSV-G protein, COS1 cells were transfected with cDNA for VSV-G protein 48 hours after cDNA transfection of msALDH, and the cells were fixed 24 hours after the second transfection. For the localization of CD63, COS-1 cells were fixed 48 hours after transfection of cDNA for msALDH. Then the COS-1 cells were doubly immunostained for msALDH (A,C), and VSV-G protein (B) or CD63 (D). Arrows indicate a granular structure corresponding to crystalloid ER. Bars, 20 µm. Crystalloid ER formation by msALDH 1735 investigating the mechanism of crystalloid ER formation and also of the coordinated biogenesis of the ER membranes. In a previous paper, we showed that the truncated msALDH lacking the membrane spanning region cannot be localized to the ER membrane and do not induce the formation of the granular structures (Masaki et al., 1994). In the present investigation, we showed that the granular structures correspond to the crystalloid ER. This fact indicates that the existence of the membrane domain is a prerequisite for the targeting of these proteins to the ER membrane and the formation of the crystalloid ER. In this study, we have shown that the FFLL sequence (amino acids 453-456) in the stem region of msALDH and the bulky amino-terminal cytoplasmic domain (amino acids 1-449) are necessary for the formation of crystalloid ER, although precise analysis of the residues important in the amino-terminal area has not yet been done. We suggested previously that msALDH has two independent ER targeting signals; KQF sequence (amino acids 457-459) in the stem region and KDQL sequence (amino acids 481-484) at the carboxyl terminus (Masaki et al., 1994). Thus, the sequences necessary for crystalloid ER Fig. 6. Schematic diagrams of wild-type msALDH and mutants having a deletion in the stem region. The single amino acid code is used to represent the carboxyl-terminal sequences of msALDH. Deleted sequences are indicated by broken lines. The amino acid numbers of wild-type msALDH are shown at the top. Underline shows the membrane spanning region. Bold and white characters show basic and acidic amino acids, respectively. formation (amino acids 1-449, and FFLL in the stem) and those for ER targeting appear to be clearly separable. Crystalloid ER can conserve its structure independently of the cytoskeletal elements such as microtubules and microfilaments. It is very probable that the crystalloid ER is formed by the head to head association of the msALDH molecules on the apposing ER membranes. It remains to be examined whether the FFLL sequence is involved in the formation of the crystalloid ER directly or indirectly by affecting conformation of the bulky cytoplasmic domain of the molecules. It is to be noted here that human and hamster HMG-CoA reductases have the FFLL sequence in the 4th transmembrane region (Chin et al., 1984; Luskey and Stevens, 1985). Jingami et al. (1987) reported that partial deletion of the transmembrane domain (number 4-5) of HMG-CoA reductase prevents formation of crystalloid ER. Though the location of the FFLL sequence is different between msALDH (cytoplasmic side) and HMG-CoA reductase (transmembrane region), it would be interesting to know whether the FFLL sequence in the HMGCoA reductase molecule has some roles in the formation of the crystalloid ER. It has been reported that overexpression of various ER membrane proteins induce marked aggregation, with cisternal stack or crystalloid formation of the smooth ER (Table 1). Takei et al. (1994) reported that ER cisternal stacks, which are reminiscent of those observed in cerebellar Purkinje cells (Otsu et al., 1990; Satoh et al., 1990; Yamamoto et al., 1991; Takei et al., 1992), can be induced by overexpression of InsP3 receptor. In yeast cells, overproduction of HMG-CoA reductase (Wright et al., 1988) or cytochrome b5 (Vergères et al., 1993) induces karmellae, i.e. nuclear-associated, paired membranes in place of the crystalloid ER. Recently, Ishihara et al. (1995) showed that overexpression of malfolded cytochrome P-450 causes vesicular aggregation of ER membrane in the perinuclear cytoplasm of COS-7 cells. All these proteins have a large cytoplasmic domain, and it is very likely that the ER membranes aggregate themselves by the head to head association of the cytoplasmic domain of these proteins, similar to the crystalloid ER. It remains, however, to be solved why regular crystalloid arrays of smooth ER are Table 1. Formation of crystalloid ER and aggregation of the smooth ER in vivo and in transfected cells Cells Structure Condition References UT-1 cells CHO cells COS-1 cells Photocyte of marine annelid Germ cells of hemiptera species Purkinje cells COS cells Yeast Yeast COS-7 cells CHO cells Crystalloid ER Crystalloid ER Crystalloid ER Crystalloid ER Crystalloid ER Cisternal stacks Cisternal stacks Karmellae Karmellae Vesicular aggregate Tubular network* 1-5 6, 7 This study 8 9 10-13 14 15 16 17 18 Thymic epithelial cells of TAP1-deficient mice Tubular network* In the presence of compactin Overexpression of HMG-CoA reductase Overexpression of msALDH In vivo In vivo In vivo Overexpression of InsP3 receptor Overexpression of HMG-CoA reductase Overexpression of cytochrome b5 Overexpression of malfolded cytochrome P-450 Overexpression of unassembled rubella virus E1 glycoprotein subunits Overexpression of misfolded major Histocompatibility complex class-1 molecules 19 *This structure belongs to the ER-Golgi intermediate compartment. References: (1) Chin et al., 1982. (2) Anderson et al., 1983. (3) Orci et al., 1984. (4) Pathak et al., 1986. (5) Kochevar and Anderson, 1987. (6) Jingami et al., 1987. (7) Roitelman et al., 1992. (8) Bassot, 1966. (9) Wolf and Motzko, 1995. (10) Otsu et al., 1990. (11) Satoh et al., 1990. (12) Yamamoto et al., 1991. (13) Takei et al., 1992. (14) Takei et al., 1994. (15) Wright et al., 1988. (16) Vergères et al., 1993. (17) Ishihara et al., 1995. (18) Hobman et al., 1992. (19) Raposo et al., 1995. 1736 A. Yamamoto, R. Masaki and Y. Tashiro Fig. 7. Localization of deletion mutants of msALDH and CAT/ALDH chimera in transfected cells by indirect immunofluorescence microscopy. COS-1 cells were transfected with cDNA for ∆450-462 (A), ∆450-452 (B), ∆453-456 (C), ∆457-459 (D), ∆460-463 (E), ∆453 (F), ∆456 (G), or CAT-ALDH (carboxyl 35 amino acids) (H), respectively, and fixed 48 hours after transfection. Bar, 20 µm. formed only when msALDH and HMG-CoA reductase are overexpressed, and simply the membrane aggregates of smooth ER are formed when other ER membrane proteins are overexpressed (Table 1). Recently, Parrish et al. (1995) reported that the ER lumenal loop between transmembrane domains 6 and 7 of HMG-Co A reductase is required for the karmellae formation in yeast. We could not find distinct similarity between the stem region of msALDH and the ER lumenal loop of yeast HMG-CoA reductase. Formation of aggregates of smooth membranes has been also reported in the ER-Golgi intermediate compartment (Table 1). An extensive tubular network was formed by the overexpression of unassembled rubella virus E1 glycoprotein subunits in CHO cells (Hobman et al., 1992) or overexpression of misfolded major histocompatibility complex class-1 molecules in thymic epithelial cells of the TAP1-deficient mice (Raposo et al., 1995). Both the membrane proteins possess only a small cytoplasmic domain, and the mechanisms of the formation of tubular networks in the ER-Golgi intermediate compartment may be different from those of crystalloid ER formation. Extensive proliferation of smooth ER occurs simultaneously with the formation of the crystalloid ER. Similar extensive proliferation of the smooth ER was reported in UT-1 cells forming the crystalloid ER (Pathak et al., 1986). In UT-1 cells, however, lamellar stacks of smooth ER are the first to emerge from the nuclear envelope, then crystalloid ER is formed (Pathak et al., 1986). In the case of msALDH, proliferating smooth ER shows direct continuity with the rough ER, not the nuclear envelope, and some of the crystalloid ER of msALDH is dispersed throughout the cytoplasm in the expressing COS1 cells. No direct membrane continuity of the crystalloid ER with the nuclear envelope is observed. Thus our observation indicates that the crystalloid ER is formed from rough ER. Nishikawa et al. (1994) reported that overexpression of Crystalloid ER formation by msALDH 1737 Fig. 8. Effect of various drugs on formation of crystalloid ER. (A) An immuno-fluorescence confocal laser micrograph of the msALDH-transfected COS-1 cells without drug treatment. COS-1 cells were transfected with cDNA for msALDH and fixed 48 hours after transfection, and doubly immuno-stained for msALDH (red) and for α-tubulin (green). Crystalloid ER containing msALDH is dispersed in the networks of the microtubules. (B-E) COS-1 cells were incubated for 1 hour in the presence of either 10 µg/ml brefeldin A (B), 1 µM colchicine (C,D), 5 µM cytochalasin B (E) or 100 nM thapsigargin (F) 48 hours after transfection of cDNA for msALDH, immuno-stained for msALDH (B,C,E,F) or for αtubulin (D), and observed under an immunofluorescence microscope. None of these drugs affected the formation of the granular immunofluorescence. Microtubules are destroyed in the colchicine-treated cells (D). Bars, 20 µm. Sec12 protein in yeast cells causes inhibition of ER-Golgi transport and formation of BiP bodies. We examined whether intracellular protein transport is disturbed by the formation of crystalloid ER. Intracellular distribution of VSV-G protein and CD63 did not change by the formation of crystalloid ER. These results suggest that the ER-Golgi, Golgi-plasma membrane, and Golgi-lysosome transports occur normally in the crystalloid ER forming cells, consistent with the observations by Bergmann and Fusco (1990) that VSV-G protein rapidly transported from crystalloid ER to the Golgi apparatus in UT-1 cells. What is the function of crystalloid ER? Similar structures appear naturally in luminous cells of marine annelids (Bassot, 1966) and in the germ cells of Hemiptera species (Wolf and Motzko, 1995). In the first cell type, the crystalloid ER is thought to be a luminous organelle. The physiological meaning of ER aggregation, including crystalloid ER, has not been clarified yet. Further detailed analysis of the formation of the crystalloid ER by overexpression of msALDH will be useful for elucidating not only the molecular mechanisms of the process, but also the biogenesis and differentiation of ER membranes. We thank Dr Takashi Morimoto, New York University, for generously providing us with the cDNA for VSV-G protein and for helpful discussions. We also thank Ms Kimie Masaki for valuable technical assistance, Mr Iwao Nishimura, Laboratory Research Center, Kansai Medical University, for help with cryoultramicrotomy, Mr Kazumi Kobayashi, Laboratory Research Center, Kansai Medical University, for help with confocal microscopy and image processing, Dr Mituo Tagaya, Tokyo University of Pharmacy and Life Science, Tokyo, Japan, for the generous gift of the monoclonal antibody against vesicular stomatitis virus (VSV)-G protein. This work was supported in part by a Grant-in Aid for Scientific Research from the Ministry of Education, Science, and Culture of Japan. REFERENCES Akagi, S., Yamamoto, A., Yoshimori, T., Masaki, R., Ogawa, R. and Tashiro, Y. (1988). Distribution of protein disulfide isomerase in rat hepatocytes. J. Histochem. Cytochem. 36, 1533-1542. Anderson, R. G. W., Orci, L., Brown, M. S., Garcia-Segura, L. M. and Goldstein, J. L. (1983). Ultrastructural analysis of crystalloid endoplasmic reticulum in UT-1 cells and its disappearance in response to cholesterol. J. Cell Sci. 63, 1-20. Bassot, J. M. (1966). Une forme microtubulaire et paracristalline de reticulum endoplasmique dans les photocytes des Annelides polynoinæ. J. Cell Biol. 31,135-158. Bergmann, J. E. and Fusco, P. J. (1990). The G protein of vesicular stomatitis virus has free access into and egress from the smooth endoplasmic reticulum of UT-1 cells. J. Cell Biol. 110, 625-635. 1738 A. Yamamoto, R. Masaki and Y. Tashiro Brown, D. A. and Simoni, R. D. (1984). Biogenesis of 3-hydroxy-3methylglutaryl-coenzyme A reductase, an integral glycoprotein of the endoplasmic reticulum. Proc. Nat. Acad. Sci. USA 81, 1674-1678. Chin, D. J., Luskey, K. L., Anderson, R. G. W., Faust, J. R., Goldstein, J. L. and Brown, M. S. (1982). Appearance of crystalloid endoplasmic reticulum in compactin-resistant chinese hamster cells with a 500-fold increase in 3hydroxy-3-methylglutaryl-coenzyme A reductase. Proc. Nat. Acad. Sci. USA 79, 1185-1189. Chin, D. J., Gil, G., Russell, D. W., Liscum, L., Luskey, K. L., Basu, S. K., Okayama, H., Berg, P., Goldstein, J. L. and Brown, M. S. (1984). Nucleotide sequence of 3-hydroxy-3-methylglutaryl CoA reductase, a glycoprotein of the endoplasmic reticulum. Nature 308, 613-617. Hobman, T. C., Woodward, L. and Farquar, M. G. (1992). The rubella virus E1 glycoprotein is arrested in a novel post-ER, pre-Golgi compartment. J. Cell Biol. 118, 795-811. Ishihara, N., Yamashina, S., Sakaguchi, M., Mihara, K. and Omura, T. (1995). Malfolded cytochrome P-450(M1) localized in unusual membrane structures of the endoplasmic reticulum in cultured animal cells. J. Biochem. 118, 397-404. Jingami, H., Brown, M. S., Goldstein, J. L., Anderson, R. G. W. and Luskey, K. L. (1987). Partial deletion of membrane-bound domain of 3hydroxy-3-methylglutaryl-coenzyme A reductase eliminates sterolenhanced degradation and prevents formation of crystalloid endoplasmic reticulum. J. Cell Biol. 104, 1693-1704. Kessel, R. G. (1992). Annulate lamellae: A last frontier in cellular organelles. Int. Rev. Cytol. 133, 43-120. Kochevar, D. T. and Anderson, R. G. W. (1987). Purified crystalloid endoplasmic reticulum from UT-1 cells contains multiple proteins in addition to 3-hydroxy-3-methylglutaryl coenzyme A reductase. J. Biol. Chem. 262, 10321-10326. Kramer, W. and Frits, H.-J. (1987). Oligonucleotide-directed construction of mutations via gapped duplex DNA. Meth. Enzymol. 154, 350-367. Kutay, U., Ahnert-Hilger, G., Hartmann, E., Wiedenmann, B. and Rapoport, T. A. (1995). Transport route for synaptobrevin via a novel pathway of insertion into the endoplasmic reticulum membrane. EMBO J. 14, 217-223. Lippincott-Schwartz J., Yuan, L. C., Bonifacno, J. S. and Klausner, R. D. (1989). Rapid redistribution of Golgi proteins into the ER in cells treated with brefeldin A: evidence for membrane cycling from the Golgi to ER. Cell 56, 801-813. Liscum, L., Finner-Moore, J., Stroud, R. M., Luskey, K. L., Brown, M. S. and Goldstein, J. L. (1985). Domain structure of 3-hydroxy-3methylglutaryl-coenzyme A reductase, a glycoprotein of the endoplasmic reticulum. J. Biol. Chem. 260, 522-530. Luskey, K. L. and Stevens, B. (1985). Human 3-hydroxy-3-methylglutaryl coenzyme A reductase. Conserved domains responsible for catalytic activity and sterol-regulated degradation. J. Biol. Chem. 260, 10271-10277. Masaki, R., Yamamoto, A. and Tashiro, Y. (1994). Microsomal aldehyde dehydrogenase is localized to the endoplasmic reticulum via its carboxylterminal 35 amino acids. J. Cell Biol. 126,1407-1420. Metzelaar, M. J., Wijngaard, P. L. J., Peters, P. J., Sixma, J. J., Nieuwenhuis, H. K. and Clevers, H. C. (1991). CD63 antigen. A novel lysosomal membrane glycoprotein, cloned by a screening procedure for intercellular antigens in eukaryotic cells. J. Biol. Chem. 266, 3239-3245. Misumi, Y., Miki, A., Takatsuki, A., Tamura, G. and Ikehara, Y. (1986). Novel blockage by brefeldin A of intracellular transport of secretory proteins in cultured rat hepatocytes. J. Biol. Chem. 261, 11398-11403. Miyauchi, K., Masaki, R., Taketani, S., Yamamoto, A., Akayama, M. and Tashiro, Y. (1991). Molecular cloning, sequencing and expression of cDNA for rat liver microsomal aldehyde dehydrogenase. J. Biol. Chem. 266, 1953619542. Nishikawa, S., Hirata, A. and Nakano, A. (1994). Inhibition of endoplasmic reticulum (ER)-to-Golgi transport induces relocalization of binding protein (BiP) within the ER to form the BiP bodies. Mol. Biol. Cell 5, 1129-1143. Orci, L., Brown, M. S., Goldstein, J. L., Garcia-Segura, L. M. and Anderson, R. G. W. (1984). Increase in membrane cholesterol: A possible trigger for degradation of HMG CoA reductase and crystalloid endoplasmic reticulum in UT-1 cells. Cell 36, 835-845. Orrenius, S., Ericsson, J. L. E. and Ernster, L. (1965). Phenobarbitalinduced synthesis of the microsomal drug-metabolizing enzyme system and its relationship to the proliferation of endoplasmic reticulum. A morphological and biochemical study. J. Cell Biol. 25, 627-639. Otsu, H., Yamamoto, A., Maeda, N., Mikoshiba, K. and Tashiro, Y. (1990). Immunogold localization of inositol 1,4,5-trisphosphate (InsP3) receptor in mouse cerebellar Purkinje cells using three monoclonal antibodies. Cell Struct. Funct. 15, 163-173. Parrish, M. L., Sengstag, C., Rine, J. D. and Wright, R. L. (1995). Identification of the sequence in HMG-CoA reductase required for karmellae assembly. Mol. Biol. Cell 6, 1535-1547. Pathak, R. K., Luskey, K. L. and Anderson, R G. W. (1986). Biogenesis of the crystalloid endoplasmic reticulum in UT-1 cells: Evidence that newly formed endoplasmic reticulum emerges from the nuclear envelope. J. Cell Biol. 102, 2158-2168. Rajasekaran, A., Morimoto, T., Hanzel, D. K., Rodriguez-Boulan, E. and Kreibich, G. (1993). Structural reorganization of the rough endoplasmic reticulum without size expansion accounts for dexamethasone-induced secretory activity in AR42J cells. J. Cell Sci. 105, 333-345. Raposo, G., Van Santen, H. M., Leijendekker, R., Geuse, H. J. and Ploegh, H. L. (1995). Misfolded major histocompatibility complex class I molecules accumulate in an expanded ER-Golgi intermediate compartment. J. Cell Biol. 131, 1403-1419. Remmer, H. and Merker, H. J. (1963). Drug-induced changes in the liver endoplasmic reticulum: Association with drug metabolizing enzymes. Science 142, 1657-1658. Roitelman, J., Olender, E. H., Bar-Nun, S., Dunn, W. A. and Simoni, R. D. (1992). Immunological evidence for eight spans in membrane domain of 3hydroxy-3-methylglutaryl-coenzyme A reductase: Implications for enzyme degradation in the endoplasmic reticulum. J. Cell Biol. 117, 959-973. Satoh, T., Ross, C. A., Villa, A., Supattapone, S., Pozzan, T., Snyder, S. H. and Meldolesi, J. (1990). The inositol 1,4,5-trisphosphate receptor in cerebellar Purkinje cells: Quantitative immunogold labeling reveals concentration in an endoplasmic reticulum subcompartment. J. Cell Biol. 111, 615-624. Sitia, R. and Meldolesi, J. (1992). Endoplasmic reticulum: A dynamic patchwork of specialized subregions. Mol. Biol. Cell 3, 1067-1072. Stäubli, W., Hess, R. and Weibel, E. R. (1969). Correlated morphometric and biochemical studies on the liver cell. II. Effect of phenobarbital on rat hepatocytes. J. Cell Biol. 42, 92-112. Takagi, Y., Ito, A. and Omura, T. (1985). Biogenesis of microsomal aldehyde dehydrogenase in rat liver. J. Biochem. 98, 1647-1652. Takei, K., Stukenbrok, H., Metcalf, A., Mignery, G. A., Südhof, T. C., Volpe, P. and De Camilli, P. (1992). Ca2+ stores in Purkinje neuron: Endoplasmic reticulum subcompartment demonstrated by the heterogenous distribution of InsP3 receptor, Ca2+-ATPase and calsequestrin. J. Neurosci. 12, 489-505. Takei, K., Mignery, G. A., Mugnaini, E., Südhof, T. C. and De Camilli, P. (1994). Inositol 1,4,5-trisphosphate receptor causes formation of ER cisternal stacks in transfected fibroblasts and in cerebellar Purkinje cells. Neuron 12, 327-342. Thastrup, O., Cullen, P. J., Drøbak, B. K., Hanley, M. R. and Dawson, A. P. (1990). Thapsigargin, a tumor promoter, discharges intracellular Ca2+ stores by specific inhibition of the endoplasmic reticulum Ca2+-ATPase. Proc. Nat. Acad. Sci. USA 87, 2466-2470. Tokuyasu, K. T. (1986). Application of cryoultramicrotomy to immunocytochemistry. J. Microsc. 143, 139-149. Vergères, G., Yen, T. S. B., Aggeler, J., Lausier, J. and Waskell, L. (1993). A model system for studying membrane biogenesis. Overexpression of cytochrome b5 in yeast results in marked proliferation of the intracellular membrane. J. Cell Sci. 106, 249-259. Wiest, D. L., Burkhardt, J. K., Hester, S., Hortsch, M., Meyer, D. I. and Argon, Y. (1990). Membrane biogenesis during B cell differentiation: Most endoplasmic reticulum proteins are expressed coordinately. J. Cell Biol. 110, 1501-1511. Wigler, M., Pellicer, A., Silverstein, S. and Axel, R. (1978). Biochemical transfer of single-copy eukaryotic genes using total cellular DNA as donor. Cell 14, 725-731. Wolf, K. W. and Motzko, D. (1995). Paracrystalline endoplasmic reticulum is typical of gametogenesis in hemiptera species. J. Struct. Biol. 114, 105-114. Wright, R., Basson, M., D’Ari, L. and Rine, J. (1988). Increased amounts of HMG-CoA reductase induce ‘Karmellae’: A proliferation of stacked membrane pairs surrounding the yeast nucleus. J. Cell Biol. 107, 101-114. Yamamoto, A., Otsu, H., Yoshimori, T., Maeda, N., Mikoshiba, K. and Tashiro, Y. (1991). Stacks of flattened smooth endoplasmic reticulum highly enriched in inositol 1,4,5-trisphosphate (InsP3) receptor in mouse cerebellar Purkinje cells. Cell Struct. Funct. 16, 419-432. (Received 11 January 1996 - Accepted 1 April 1996)