Download Formation of crystalloid endoplasmic reticulum in

Journal of Cell Science 109, 1727-1738 (1996)
Printed in Great Britain © The Company of Biologists Limited 1996
JCS9465
1727
Formation of crystalloid endoplasmic reticulum in COS cells upon
overexpression of microsomal aldehyde dehydrogenase by cDNA
transfection
Akitsugu Yamamoto*, Ryuichi Masaki and Yutaka Tashiro
Department of Physiology, and Division of Cell Biology, Liver Research Center, Kansai Medical University, Moriguchi, Osaka 570,
Japan
*Author for correspondence (e-mail: [email protected])
SUMMARY
When rat liver microsomal aldehyde dehydrogenase
(msALDH) was overexpressed in COS-1 cells by cDNA
transfection, large granular structures containing both
msALDH and endogenous protein disulfide isomerase
appeared (Masaki et al. (1994) J. Cell Biol. 126, 1407-1420).
Confocal laser microscopy revealed that these granular
structures are dispersed throughout the cytoplasm.
Electron microscopy showed that the structures are
composed of regularly arranged crystalloid smooth endoplasmic reticulum (ER). The formation of the crystalloid
ER was accompanied by a remarkable proliferation of
smooth ER, which appeared occasionally continuous to the
rough ER. We suggest that the smooth ER, proliferated
from the rough ER, is transformed and assembled into the
crystalloid ER by head-to-head association of the msALDH
molecules on the apposed smooth ER membranes.
In order to understand the molecular mechanism of the
crystalloid ER formation, we asked which portions of the
msALDH molecules are needed for the crystalloid ER
formation by expressing deletion mutants or chimera
protein of msALDH in COS-1 cells. The overexpression of
msALDH molecules lacking the stem region preceding the
membrane spanning region, although they were exclusively
localized in the ER, did not induce the formation of crystalloid ER. More detailed analysis showed that the amino
acid sequence FFLL, located in the stem region, is
necessary to form the crystalloid ER. The chimera protein
containing the last 35 amino acids of msALDH at the
carboxyl terminus of chloramphenicol acetyltransferase
was localized to the ER, but did not induce the formation
of the crystalloid ER. These results suggest that at least two
regions, the bulky amino-terminal region and the FFLL
sequence in the stem region of msALDH molecules are
required for the formation of the crystalloid ER.
INTRODUCTION
inhibited yeast cells (Nishikawa et al., 1994), cisternal stacks
of the smooth ER in cerebellar Purkinje cells (Otsu et al., 1990;
Satoh et al., 1990; Yamamoto et al., 1991; Takei et al., 1992),
and crystalloid ER in compactin resistant UT-1 cells (Chin et
al., 1982; Anderson et al., 1983; Orci et al., 1984; Pathak et
al., 1986; Kochevar and Anderson, 1987).
In UT-1 cells crystalloid ER is an aggregate of smooth
tubules packed in a hexagonal array (Chin et al., 1982;
Anderson et al., 1983; Orci et al., 1984; Pathak et al., 1986;
Kochevar and Anderson, 1987). Aggregation of smooth ER
similar to the crystalloid ER has been reported as paracrystalline ER in luminous cells (photocytes) of marine annelid
(Bassot, 1966) and in germ cells of hemiptera species (Wolf
and Motzko, 1995). In these cells, the crystalloid (paracrystalline) ER appears as a square or hexagonal array of tubular
smooth ER or as a regular array of undulating smooth ER
(Bassot, 1966; Wolf and Motzko, 1995).
When the compactin-withdrawn UT-1 cells, which do not
exhibit any crystalloid ER, are incubated in the presence of
Both rough and smooth endoplasmic reticulum (ER) change
their structure and function dynamically according to the
differentiation and functional state of cells, and occasionally
one of the two subcompartments develops disproportionally
(Sitia and Meldolesi, 1992). Rough ER increases markedly in
size during B cell differentiation (Wiest et al., 1990).
Moreover, when treated with dexamethasone, AR42J cells
reorganize the rough ER structure from the tubulo-vesicular to
the cisternal configuration concomitantly with the increase in
the secretory activity (Rajasekaran et al., 1993). Administration of phenobarbital causes remarkable proliferation of
smooth ER in hepatocytes accompanied by the induction of
drug metabolizing enzymes such as cytochrome P-450
(Remmer and Merker, 1963; Orrenius et al., 1965; Stäubli et
al., 1969). Unique ER subcompartments are present or develop
in cells, such as the sarcoplasmic reticulum in muscle cells,
annulate lamellae (Kessel, 1992), BiP bodies in secretion-
Key words: Microsomal aldehyde dehydrogenase, Crystalloid
endoplasmic reticulum, Endoplasmic reticulum, cDNA transfection
1728 A. Yamamoto, R. Masaki and Y. Tashiro
Fig. 1. Immunofluorescence confocal
laser micrographs of the msALDHtransfected COS-1 cells. COS-1 cells
were transfected with cDNA for
msALDH and fixed 48 hours after
transfection, and doubly immuno-stained
for msALDH (A,C,E,F) and PDI (B,D)
using FITC- and TRITC-conjugated
second antibody, respectively. MsALDH
(A,C) and PDI (B,D) are well colocalized on the granular structures. An
arrow in B shows a cell not expressing
msALDH. When msALDH was weakly
expressed, reticular or patchy staining
(arrowheads in A) was observed. Vertical
optical serial sections (E) and a
reconstituted stereo view (F) are shown.
N, nucleus. Bars, 10 µm.
compactin, crystalloid ER arises in response to the overexpression of an ER membrane protein, 3-hydroxy-3-methylglutaryl
coenzyme A (HMG-CoA) reductase (Chin et al., 1982; Orci et
al., 1984; Kochevar and Anderson, 1987). Pathak et al. (1986)
traced the biogenesis of the crystalloid ER in UT-1 cells and
showed that folds of the smooth ER membrane emerge from the
nuclear envelope and transform into the crystalloid ER. Transfection of cDNA encoding HMG-CoA reductase also results in
the formation of crystalloid ER in CHO cells (Jingami et al.,
1987; Roitelman et al., 1992), whereas transfection of cDNA
encoding either a truncated protein lacking the membrane
spanning region or a mutant protein deleted two contiguous
membrane spanning regions (numbers 4 and 5) did not cause the
formation of crystalloid ER (Jingami et al., 1987). These results
suggest the importance of the membrane spanning region for the
formation of the crystalloid ER. The precise mechanism of the
formation of the structure, however, remains to be clarified.
Rat liver microsomal aldehyde dehydrogenase (msALDH) is
a typical tail-anchored protein, which has no amino-terminal
signal sequence, but instead has a hydrophobic membrane
spanning region at its carboxyl terminus, and leaves most of the
molecule in the cytoplasmic compartment (Miyauchi et al.,
1991; Masaki et al., 1994). The insertion of msALDH into the
ER membrane occurs post-translationally (Takagi et al., 1985).
Recently we have studied the mechanism of insertion and localization of msALDH to the ER membrane using transfection of
wild type and various mutant cDNAs into COS-1 cells and
showed that the C-terminal 35 amino acids containing a
membrane spanning region are sufficient for targeting to and
retention of this protein in the ER compartment (Masaki et al.,
Crystalloid ER formation by msALDH 1729
against α-tubulin was purchased from Sigma Chemical Company (St
Louis, MO).
1994). During this study, we have also found that the large
granular structures resembling the crystalloid ER of UT-1 cells
appeared in COS-1 cells when transfected with the cDNA of
wild-type msALDH, and that msALDH colocalized in the
granular structures with an intrinsic ER protein, protein
disulfide isomerase (PDI) (Masaki et al., 1994).
In this report, we show by electron microscopy and immunofluorescence microscopy that the granular structures are typical
crystalloid ER, and analyze how the crystalloid ER is formed
by investigating which portions of the msALDH molecule are
needed for the crystalloid ER formation. These studies suggest
that the smooth ER proliferates from the rough ER and is transformed and assembled into the crystalloid ER. In addition to the
membrane spanning region, at least two regions of msALDH
molecule located on the cytoplasmic side of ER, the bulky
amino terminal region and the FFLL sequence in the stem
region, are required for the formation of the crystalloid ER.
MATERIALS AND METHODS
Materials
Brefeldin A was purchased from Epicentre Technologies (Madison,
WI). Colchicine, cytochalasin B and thapsigargin were from Wako
Chemical (Tokyo, Japan). Rabbit polyclonal antibody against
msALDH has been prepared and characterized as described (Akagi et
al., 1988; Masaki et al., 1994). Rabbit anti-chloramphenicol acetyltransferase (CAT) antibody was obtained from 5 Prime, Inc. (Boulder,
CO). Mouse monoclonal antibody against PDI (β-subunit of human
prolyl 4-hydroxylase) was purchased from Fuji Yakuhin Kogyo Co.,
Ltd (Toyama, Japan). Mouse monoclonal antibody against human
CD63 (Metzelaar et al., 1991) was from Immunotech S. A. (Marseille,
France). Monoclonal antibody (8G5) against vesicular stomatitis virus
(VSV)-G protein was a kind gift from Dr Mituo Tagaya (Tokyo University of Pharmacy and Life Science). Mouse monoclonal antibody
Plasmid construction
Construction
of
expression
plasmids
pCDALDH
and
pMIWCAT/ALDH1 has been described previously (Masaki et al.,
1994). The gapped duplex method of oligonucleotide-directed mutagenesis (Kramer and Frits, 1987) was used for deletion of msALDH
cDNA. The full-length msALDH cDNA was cloned into the EcoRI
site of M13tv18 prepared from an umber mutant phage, and singlestranded phage DNA was purified for use as the template for mutagenesis. Synthetic oligonucleotides
(1) 5′ GAGTCCAAGGTCAGCAGGCTGCAGCTGCTG 3′;
(2) 5′ GAGTCCAAGGTCAGCTTCTTCCTGCTGAAAC 3′;
(3) 5′ GTCAGCTGGTCGGAAAAAACAGTTCAACAAAG 3′;
(4) 5′ AAATTCTTCCTGCTGAACAAAGGAAGGCTG 3′;
(5) 5′ CTGCTGAAACAGTTCCTGCAGCTGCTGCTTC 3′;
(6) 5′ AAATTCTTCCTGCTGAACAAAGGAAGGCTG 3′; and
(7) 5′ TCGAAATTCTTCCTGAAACAGTTCAACAAAG 3′, were
used for construction of cDNAs for ALDH∆450-462, ALDH∆450-452,
ALDH∆453-456, ALDH∆457-459, ALDH∆460-463, ALDH∆453, and
ALDH∆456, respectively. After hybridization of the oligonucleotide
and a PvuII fragment derived from M13mp18 with the template DNA,
second strand synthesis was carried out with T4 DNA polymerase and
Escherichia coli DNA ligase, and the resultant double-stranded DNA
was transfected into E. coli BMH71-18 mutS for amplification. Phage
recovered from E. coli BMH71-18 mutS were then transfected into E.
coli MV1184 to select non-umber ones, and single-stranded DNA from
two to six plaques was sequenced to confirm the desired mutations. The
mutated cDNAs were excised from the double-stranded replicative
form DNAs and cloned into the EcoRI site of the pCD vector. The right
orientation was verified by restriction enzyme digestion. For construction of pMIWVSV-G, plasmid pSV2TKneo (a kind gift from Dr
Takashi Morimoto) was digested with HindIII. The isolated fragment
was then ligated to the pMIW vector cut with HindIII.
Cell culture and transfection
COS-1 cells were maintained in DME with 10% FBS, 50 U/ml penicillin, and 50 µg/ml streptomycin at 37°C in a 5% CO2 incubator, and
were replated by trypsinization the day before transfection. Transfection was performed using the calcium phosphate precipitation method
(Wigler et al., 1978) as described previously (Masaki et al., 1994).
For immunofluorescence experiments, cells were grown on coverslips
in a 35 mm dish and were transfected with 4 µg plasmid DNA per
dish. For immunogold localization, cells were plated in a 60 mm dish,
and were transfected with 10 µg plasmid DNA per dish.
Indirect immunofluorescence microscopy and confocal
laser microscopy
Cells grown on coverslips were used for immunofluorescence
microscopy as described previously (Masaki et al., 1994). Cells were
washed with phosphate buffered saline (PBS), fixed in 4%
paraformaldehyde in PBS containing 1 mM CaCl2 and 0.5 mM MgCl2
(PBS+) for 20 minutes, and permeabilized with 0.1 % Triton X-100
in PBS(+) for 1 hour. They were then rinsed twice with PBS(+), and
incubated with 2% FBS in PBS(+) for 1 hour followed by 45 minutes
incubation with primary antibody in 2% FBS/PBS(+). After washing
four times (5 minutes each) with PBS(+), cells were incubated with
secondary antibody in 2% FBS/PBS(+) for 45 minutes. After washing
with PBS(+), they were then mounted on glass slides with 90%
glycerol in PBS containing 1 mg/ml paraphenylenediamine, and
observed under an Olympus BH-2 microscope (Olympus Corp.,
Tokyo, Japan) or an Olympus LSM-GB200 confocal laser microscope
(Olympus Corp., Tokyo, Japan).
Conventional electron microscopy
Transfected cells were harvested by centrifugation at 1,000 g for 3
1730 A. Yamamoto, R. Masaki and Y. Tashiro
minutes, then the pellet was fixed with 2.5% glutaraldehyde dissolved
in 0.1 M cacodylate buffer, pH 7.4, for 1 hour, postfixed in 1% OsO4,
dehydrated in a series of ethanols, then embedded in Epon.
Immunoelectron microscopy on frozen ultrathin sections
Frozen ultramicrotomy was performed as described by Tokuyasu
(1986). A pellet of transfected cells was fixed with 4% paraformaldehyde and 0.1% glutaraldehyde dissolved in 0.1 M sodium cacodylate
buffer, pH 7.4, for 15 minutes. Small pieces of the fixed pellets of
COS-1 cells were incubated overnight in 0.1 M sodium phosphate
buffer, pH 7.4, containing 2.3 M sucrose and 20% polyvinyl pyrrolidone, and rapidly frozen in liquid propane at −180°C. Frozen ultrathin
sections were cut with a Reichert Ultracut-N ultramicrotome
(Reichert, Wien, Australia) with a cryoattachment (FC-4D). The
sections were picked up on Formvar-carbon-coated nickel grids,
incubated with 2% gelatin in PBS containing 10 mM glycine, then
reacted with rabbit polyclonal anti-msALDH antibody (10 µg/ml) and
with mouse monoclonal anti-PDI antibody (10 µg/ml) diluted in the
gelatin solution for 30 minutes. The sections were washed six times
with gelatin solution, and reacted with goat anti-rabbit IgG gold
conjugate (10 nm in diameter) and anti-mouse IgG gold conjugate (5
nm in diameter) (British BioCell, Cardiff, UK) for 15 minutes. After
washing with sodium cacodylate buffer, pH 7.4, the sections were
postfixed in 2% glutaraldehyde, then in 1% OsO4, stained with uranyl
acetate, embedded in LR white resin, and observed with an Hitachi
H-7000 electron microscope (Hitachi, Tokyo, Japan).
RESULTS
Confocal laser microscopic observation of the
msALDH-transfected COS-1 cells
Expression of wild-type msALDH caused marked morphological alteration of the ER in COS-1 cells, as reported previously
(Masaki et al., 1994). The changes in the ER structure were
analyzed in detail by a confocal laser microscope. For this
purpose, COS-1 cells were immuno-labeled for both msALDH
and an endogenous ER protein, PDI, at 48 hours after transfection of msALDH. As shown in Fig. 1A-D, expressed
msALDH and endogenous PDI were exactly colocalized. In
the COS-1 cells not expressing msALDH, the immunofluorescence staining of PDI showed a typical reticular pattern (arrow
in Fig. 1B). When msALDH was strongly expressed in COS1 cells, large granular structures containing both msALDH and
PDI appeared in addition to the reticular staining (Fig. 1A-D).
These granular structures were dispersed throughout the
cytoplasm (Fig. 1C), though in some cells they were preferentially located around the nucleus (Fig. 1A). In the COS-1 cells
in which msALDH was weakly expressed, both msALDH and
PDI showed reticular as well as patchy localization (arrowheads in Fig. 1A). The latter may correspond to small aggregates of the ER. Fig. 1E shows confocal optical serial sections
of a COS-1 cell strongly expressing msALDH. The msALDH
positive granular structures appeared throughout the cytoplasm
near and apart from the nucleus. A three dimensional view of
the cell is reconstituted in Fig. 1F.
Time course of appearance of granular structures
We examined the time course of appearance of the granular
structures by immunofluorescence microscopy (Fig. 2).
MsALDH positive cells were first detected at 4 hours after
transfection (Fig. 2A). At 8-12 hours, a reticular staining pattern
became more apparent, but no granular structures were detected
(Fig. 2C and E). MsALDH and PDI positive granular structures
first appeared at 24 hours and further increased during the next
24 hours (Fig. 2G and I). Among the msALDH positive cells
at 24 and 48 hours after the transfection, the percentage of the
cells showing the granular staining was ~9% and ~54%, respectively. MsALDH and PDI were always colocalized during the
appearance of the granular structures (Fig. 2).
Electron microscopic observation
COS-1 cells transfected with the cDNA for msALDH investigated electron microscopically, exhibited crystalloid ER in the
cytoplasm (Fig. 3A-C). The crystalloid ER is composed either
of tubular smooth ER packed together in a regular square (Fig.
3A and upper inset in C), or hexagonal pattern (lower inset in
Fig. 3C) like UT-1 cells (Chin et al., 1982), or of undulating
smooth ER in a regular array (Fig. 3B). Similar square and
undulating patterns have been reported in luminous cells of
marine annelid (Bassot, 1966) and in germ cells of hemiptera
species (Wolf and Motzko, 1995). In some cases, the direction
of the arrangement changed (Fig. 3C). Direct connection of the
crystalloid ER to the nucleus was never detected. Sometimes
vacuoles containing membrane wheels were associated with
the crystalloid ER (Fig. 3A and B). Marked proliferation of the
smooth ER was also observed in the COS-1 cells transfected
with msALDH (Fig. 3D and E), and the proliferated smooth
ER was occasionally continuous to rough ER cisternae (arrows
in Fig. 3D and E), indicating that the smooth ER originates
from the rough ER. Neither crystalloid ER nor proliferation of
the smooth ER was observed in the COS-1 cells without transfection (Fig. 3F).
Immunogold-electron microscopic observation
To confirm the localization of msALDH on the crystalloid ER,
ultra-thin cryosections of the COS-1 cells were doubly stained
by the immuno-gold technique. MsALDH and PDI were
densely colocalized on the crystalloid ER (Fig. 4).
Formation of crystalloid ER does not interfere with
intracellular transport of proteins
According to Nishikawa et al. (1994), protein transport from the
ER to the Golgi apparatus is inhibited when the BiP bodies are
formed. We examined therefore whether the formation of the
crystalloid ER disturbs intracellular protein export from the ER
to the final destinations. For this purpose, we used an exogenously expressed protein, VSV-G protein (a plasma membrane
protein), and an endogenous protein, CD63 (a lysosomal
membrane protein; Metzelaar et al., 1991). Fig. 5A and B show
immunofluorescence micrographs of a COS-1 cell transfected
with cDNA for VSV-G protein 48 hours after transfection of
msALDH cDNA, and fixed 24 hours after the second transfection. Expressed VSV-G protein was mainly localized on the
plasma membrane and never detected in the crystalloid ER. No
difference in the localization of VSV-G protein was detected
between the msALDH-expressed and unexpressed cells. CD63
was localized in the lysosome-like punctate structures around
the nucleus both in the msALDH-expressed and in the unexpressed cells. CD63 was not detected in the crystalloid ER (Fig.
5C and D). These results suggest that the formation of the crystalloid ER does not disturb intracellular transport from the ER
either to the plasma membranes, or to lysosomes.
Crystalloid ER formation by msALDH 1731
Fig. 2. Time course of the appearance of
granular structures. COS-1 cells were
transfected with cDNA for msALDH and fixed
at 4 hours (A and B), 8 hours (C and D), 12
hours (E and F) 24 hours (G and H), 48 hours
(I and J) after transfection, and doubly
immuno-stained for msALDH (A,C,E,G,H)
and PDI (B,D,F,H,I), respectively. Bar, 20 µm.
Formation of crystalloid ER in deletion mutants of
msALDH
In order to determine which part of msALDH molecules is
responsible for the formation of crystalloid ER, we expressed
several deletion mutants of msALDH in COS-1 cells.
As shown in Fig. 6, msALDH has a hydrophobic membrane
spanning region (amino acids 464-480) near the carboxyl
terminus. In the previous study (Masaki et al., 1994), we found
that the protein can be localized to the ER membrane, if it
contains the hydrophobic region and one of the two hydrophilic
sequences KQF (amino acids 457-459) or KDQL (amino acids
481-484) on both sides of the hydrophobic region. The mutant
protein lacking membrane spanning region could not locate to the
ER membrane and form crystalloid ER in COS-1 cells, whereas
the mutant protein lacking only the carboxyl terminal KDQL was
localized to the ER and formed the granular structures (Masaki
et al., 1994). The effects of deletions of the stem region on the
crystalloid ER formation were now investigated (Fig. 6).
Fig. 7A-G shows intracellular localization of the deletion
mutants of msALDH lacking the stem region (amino acids 450463). The level of expression of the mutant proteins was
presumed to be similar as there were no marked differences in
1732 A. Yamamoto, R. Masaki and Y. Tashiro
Fig. 3. Electron micrographs of
the COS-1 cells. COS-1 cells
transfected with cDNA for
msALDH (A-E) and untreated
COS-1 cells (F) were processed
for conventional electron
microscopy. Crystalloid ER (C)
forms in the COS-1 cells
transfected with cDNA for
msALDH (A-C). Upper and
lower insets in C show higher
magnification views of the parts
indicated by an arrow and an
arrowhead, respectively. The
crystalloid ER shows square (A
and upper inset in C) or
hexagonal (lower inset in C)
arrays of undulating smooth ER
(B). Asterisks in A and B show
vacuoles containing membrane
wheels. Marked proliferation of
the smooth ER (S) was observed
in the COS-1 cells transfected
with cDNA for msALDH (D and
E). Arrows in D and E show the
continuity between the smooth
ER and rough ER (R). G, Golgi
apparatus. A, ×7,200;
B, ×20,000; C, ×40,000; inset
×80,000; D, ×40,000;
E, ×24,000; F, ×12,000. Bars,
0.5 µm.
the strength of the immunofluorescence staining among them.
Deletion of the whole stem region abolished the formation of
crystalloid ER (Fig. 7A), although the deletion mutant normally
located to the ER. When the FFLL sequence (amino acids 453456) only in the stem region was deleted, formation of the crystalloid ER was also inhibited (Fig. 7C). In contrast deletion of
a single amino acid F (amino acid 453) or L (amino acid 456)
did not affect the formation of the crystalloid ER. These results
suggest that the FFLL sequence in the stem region is important
for the formation of the crystalloid ER in the COS-1 cells.
Fig. 7H shows the distribution of a chloramphenicol acetyltransferase (CAT) fusion protein containing the last 35 amino
acids (stem, hydrophobic, and KDQL regions) of msALDH at
the carboxyl terminus. In agreement with our previous report
(Masaki et al., 1994), this chimera protein located on the ER
but did not induce crystalloid ER formation. This result
suggests that the carboxyl terminal 35 amino acids is insufficient to induce the formation of the crystalloid ER and that the
bulky amino terminal domain (amino acid 1-449) is essential
for the formation of the crystalloid ER.
Crystalloid ER formation by msALDH 1733
Effect of various drugs on formation of crystalloid ER
We examined the effect of brefeldin A, an inhibitor of ER-Golgi
transport (Misumi et al., 1986; Lippincott-Schwartz et al.,
1989); colchicine, an anti-microtubule drug; cytochalasin B, an
anti-microfilament drug; and thapsigargin, an inhibitor of ER
Ca-ATPase (Thastrup et al., 1990), on the formation of the crystalloid ER (Fig. 8). COS-1 cells were incubated for 1 hour in
the presence of either 10 µg/ml brefeldin A (Fig. 8B), 1 µM
colchicine (Fig. 8C), 5 µM cytochalasin B (Fig. 8E) or 100 nM
thapsigargin (Fig. 8F) 48 hours after transfection of cDNA for
msALDH, and the formation of the crystalloid ER was
examined by immunofluorescence microscopy to detect
msALDH. None of these drugs did affect the formation of the
granular immunofluorescence corresponding to the crystalloid
ER. Depolymerization of microtubules by colchicine treatment
was confirmed by immunofluorescence staining of α-tubulin
(Fig. 8D).
DISCUSSION
In this report, we have shown that overexpression of wild-type
msALDH by cDNA transfection induces formation of the crys-
1734 A. Yamamoto, R. Masaki and Y. Tashiro
talloid ER in COS-1 cells. Crystalloid ER is an aggregate of the
smooth ER in a regular array. Similar structures have been
Fig. 4. Double immuno-gold localization of msALDH and PDI in the
msALDH transfected COS-1 cells. COS-1 cells were transfected
with cDNA for msALDH and fixed 48 hours after transfection, and
doubly immuno-stained for msALDH (10 nm gold particles) and PDI
(5 nm gold particles), successively. N, nucleus; C, crystalloid ER.
Bar, 0.2 µm.
reported in some animal cells (Bassot, 1966; Chin et al., 1982;
Wolf and Motzko, 1995). In UT-1 cells, formation of the crystalloid ER was accompanied by a marked increase in the content
of HMG-CoA reductase (Chin et al., 1982). Overexpression of
a single ER membrane protein, HMG-CoA reductase, by cDNA
transfection caused formation of crystalloid ER in CHO cells
(Jingami et al., 1987; Roitelman et al., 1992).
The insertion of msALDH into the ER membrane in vivo
appears to be quite different from that of HMG-CoA reductase.
The latter spans the ER membrane several times at the aminoterminal one-third, and the carboxyl two-thirds of the polypeptide chain (catalytic site) faces the cytosolic side (Liscum et al.,
1985, Roitelman et al., 1992). The enzyme is co-translationally
inserted into the ER membrane in a signal recognition particle
(SRP) dependent manner (Brown and Simoni, 1984), although
it lacks a cleavable signal sequence (Brown and Simoni, 1984).
On the other hand, msALDH is a typical tail-anchored
protein. It also lacks a cleavable signal sequence at the amino
terminus but has a hydrophobic membrane spanning region at
the carboxyl terminus (Miyauchi et al., 1991). It is synthesized
in the free polysomes (Takagi et al., 1985), and the hydrophobic domain is post-translationally inserted into the ER
membranes, leaving the amino-terminal domain in the cytoplasmic side (Miyauchi et al., 1991; Masaki et al., 1994). Kutay
et al. (1995) suggested that synaptobrevin, a tail-anchored
protein is inserted into the ER membrane through a pathway
independent of SRP and sec61p. Despite the difference in the
mode of insertion into the ER membrane, HMG-CoA reductase
and msALDH have a common feature: that they expose a large
portion of the molecules to the cytoplasmic side of the ER
membrane. This overall structure of the two kinds of molecules
may be needed for the formation of crystalloid ER. As the
membrane topology of msALDH is much simpler than that of
HMG-CoA reductase, msALDH may be more suitable for
Fig. 5. Indirect immunofluorescence
microscopic localization of VSV-G
protein and CD63 in the COS-1 cells
forming crystalloid ER. For the
localization of VSV-G protein, COS1 cells were transfected with cDNA
for VSV-G protein 48 hours after
cDNA transfection of msALDH, and
the cells were fixed 24 hours after
the second transfection. For the
localization of CD63, COS-1 cells
were fixed 48 hours after transfection
of cDNA for msALDH. Then the
COS-1 cells were doubly immunostained for msALDH (A,C), and
VSV-G protein (B) or CD63 (D).
Arrows indicate a granular structure
corresponding to crystalloid ER.
Bars, 20 µm.
Crystalloid ER formation by msALDH 1735
investigating the mechanism of crystalloid ER formation and
also of the coordinated biogenesis of the ER membranes.
In a previous paper, we showed that the truncated msALDH
lacking the membrane spanning region cannot be localized to the
ER membrane and do not induce the formation of the granular
structures (Masaki et al., 1994). In the present investigation, we
showed that the granular structures correspond to the crystalloid
ER. This fact indicates that the existence of the membrane
domain is a prerequisite for the targeting of these proteins to the
ER membrane and the formation of the crystalloid ER.
In this study, we have shown that the FFLL sequence (amino
acids 453-456) in the stem region of msALDH and the bulky
amino-terminal cytoplasmic domain (amino acids 1-449) are
necessary for the formation of crystalloid ER, although precise
analysis of the residues important in the amino-terminal area
has not yet been done. We suggested previously that msALDH
has two independent ER targeting signals; KQF sequence
(amino acids 457-459) in the stem region and KDQL sequence
(amino acids 481-484) at the carboxyl terminus (Masaki et al.,
1994). Thus, the sequences necessary for crystalloid ER
Fig. 6. Schematic diagrams of wild-type msALDH and mutants
having a deletion in the stem region. The single amino acid code is
used to represent the carboxyl-terminal sequences of msALDH.
Deleted sequences are indicated by broken lines. The amino acid
numbers of wild-type msALDH are shown at the top. Underline
shows the membrane spanning region. Bold and white characters
show basic and acidic amino acids, respectively.
formation (amino acids 1-449, and FFLL in the stem) and those
for ER targeting appear to be clearly separable.
Crystalloid ER can conserve its structure independently of
the cytoskeletal elements such as microtubules and microfilaments. It is very probable that the crystalloid ER is formed by
the head to head association of the msALDH molecules on the
apposing ER membranes. It remains to be examined whether
the FFLL sequence is involved in the formation of the crystalloid ER directly or indirectly by affecting conformation of
the bulky cytoplasmic domain of the molecules.
It is to be noted here that human and hamster HMG-CoA
reductases have the FFLL sequence in the 4th transmembrane
region (Chin et al., 1984; Luskey and Stevens, 1985). Jingami
et al. (1987) reported that partial deletion of the transmembrane
domain (number 4-5) of HMG-CoA reductase prevents
formation of crystalloid ER. Though the location of the FFLL
sequence is different between msALDH (cytoplasmic side) and
HMG-CoA reductase (transmembrane region), it would be
interesting to know whether the FFLL sequence in the HMGCoA reductase molecule has some roles in the formation of the
crystalloid ER.
It has been reported that overexpression of various ER
membrane proteins induce marked aggregation, with cisternal
stack or crystalloid formation of the smooth ER (Table 1).
Takei et al. (1994) reported that ER cisternal stacks, which are
reminiscent of those observed in cerebellar Purkinje cells (Otsu
et al., 1990; Satoh et al., 1990; Yamamoto et al., 1991; Takei
et al., 1992), can be induced by overexpression of InsP3
receptor. In yeast cells, overproduction of HMG-CoA
reductase (Wright et al., 1988) or cytochrome b5 (Vergères et
al., 1993) induces karmellae, i.e. nuclear-associated, paired
membranes in place of the crystalloid ER. Recently, Ishihara
et al. (1995) showed that overexpression of malfolded
cytochrome P-450 causes vesicular aggregation of ER
membrane in the perinuclear cytoplasm of COS-7 cells. All
these proteins have a large cytoplasmic domain, and it is very
likely that the ER membranes aggregate themselves by the
head to head association of the cytoplasmic domain of these
proteins, similar to the crystalloid ER. It remains, however, to
be solved why regular crystalloid arrays of smooth ER are
Table 1. Formation of crystalloid ER and aggregation of the smooth ER in vivo and in transfected cells
Cells
Structure
Condition
References
UT-1 cells
CHO cells
COS-1 cells
Photocyte of marine annelid
Germ cells of hemiptera species
Purkinje cells
COS cells
Yeast
Yeast
COS-7 cells
CHO cells
Crystalloid ER
Crystalloid ER
Crystalloid ER
Crystalloid ER
Crystalloid ER
Cisternal stacks
Cisternal stacks
Karmellae
Karmellae
Vesicular aggregate
Tubular network*
1-5
6, 7
This study
8
9
10-13
14
15
16
17
18
Thymic epithelial cells of
TAP1-deficient mice
Tubular network*
In the presence of compactin
Overexpression of HMG-CoA reductase
Overexpression of msALDH
In vivo
In vivo
In vivo
Overexpression of InsP3 receptor
Overexpression of HMG-CoA reductase
Overexpression of cytochrome b5
Overexpression of malfolded cytochrome P-450
Overexpression of unassembled rubella virus
E1 glycoprotein subunits
Overexpression of misfolded major
Histocompatibility complex class-1 molecules
19
*This structure belongs to the ER-Golgi intermediate compartment.
References: (1) Chin et al., 1982. (2) Anderson et al., 1983. (3) Orci et al., 1984. (4) Pathak et al., 1986. (5) Kochevar and Anderson, 1987. (6) Jingami et al.,
1987. (7) Roitelman et al., 1992. (8) Bassot, 1966. (9) Wolf and Motzko, 1995. (10) Otsu et al., 1990. (11) Satoh et al., 1990. (12) Yamamoto et al., 1991. (13)
Takei et al., 1992. (14) Takei et al., 1994. (15) Wright et al., 1988. (16) Vergères et al., 1993. (17) Ishihara et al., 1995. (18) Hobman et al., 1992. (19) Raposo et
al., 1995.
1736 A. Yamamoto, R. Masaki and Y. Tashiro
Fig. 7. Localization of deletion mutants of
msALDH and CAT/ALDH chimera in
transfected cells by indirect
immunofluorescence microscopy. COS-1
cells were transfected with cDNA for
∆450-462 (A), ∆450-452 (B), ∆453-456
(C), ∆457-459 (D), ∆460-463 (E), ∆453
(F), ∆456 (G), or CAT-ALDH (carboxyl 35
amino acids) (H), respectively, and fixed 48
hours after transfection. Bar, 20 µm.
formed only when msALDH and HMG-CoA reductase are
overexpressed, and simply the membrane aggregates of smooth
ER are formed when other ER membrane proteins are overexpressed (Table 1). Recently, Parrish et al. (1995) reported that
the ER lumenal loop between transmembrane domains 6 and
7 of HMG-Co A reductase is required for the karmellae
formation in yeast. We could not find distinct similarity
between the stem region of msALDH and the ER lumenal loop
of yeast HMG-CoA reductase.
Formation of aggregates of smooth membranes has been also
reported in the ER-Golgi intermediate compartment (Table 1).
An extensive tubular network was formed by the overexpression
of unassembled rubella virus E1 glycoprotein subunits in CHO
cells (Hobman et al., 1992) or overexpression of misfolded
major histocompatibility complex class-1 molecules in thymic
epithelial cells of the TAP1-deficient mice (Raposo et al., 1995).
Both the membrane proteins possess only a small cytoplasmic
domain, and the mechanisms of the formation of tubular
networks in the ER-Golgi intermediate compartment may be
different from those of crystalloid ER formation.
Extensive proliferation of smooth ER occurs simultaneously
with the formation of the crystalloid ER. Similar extensive proliferation of the smooth ER was reported in UT-1 cells forming
the crystalloid ER (Pathak et al., 1986). In UT-1 cells,
however, lamellar stacks of smooth ER are the first to emerge
from the nuclear envelope, then crystalloid ER is formed
(Pathak et al., 1986). In the case of msALDH, proliferating
smooth ER shows direct continuity with the rough ER, not the
nuclear envelope, and some of the crystalloid ER of msALDH
is dispersed throughout the cytoplasm in the expressing COS1 cells. No direct membrane continuity of the crystalloid ER
with the nuclear envelope is observed. Thus our observation
indicates that the crystalloid ER is formed from rough ER.
Nishikawa et al. (1994) reported that overexpression of
Crystalloid ER formation by msALDH 1737
Fig. 8. Effect of various drugs
on formation of crystalloid ER.
(A) An immuno-fluorescence
confocal laser micrograph of
the msALDH-transfected
COS-1 cells without drug
treatment. COS-1 cells were
transfected with cDNA for
msALDH and fixed 48 hours
after transfection, and doubly
immuno-stained for msALDH
(red) and for α-tubulin (green).
Crystalloid ER containing
msALDH is dispersed in the
networks of the microtubules.
(B-E) COS-1 cells were
incubated for 1 hour in the
presence of either 10 µg/ml
brefeldin A (B), 1 µM
colchicine (C,D), 5 µM
cytochalasin B (E) or 100 nM
thapsigargin (F) 48 hours after
transfection of cDNA for
msALDH, immuno-stained for
msALDH (B,C,E,F) or for αtubulin (D), and observed
under an immunofluorescence
microscope. None of these
drugs affected the formation of
the granular
immunofluorescence.
Microtubules are destroyed in
the colchicine-treated cells (D).
Bars, 20 µm.
Sec12 protein in yeast cells causes inhibition of ER-Golgi
transport and formation of BiP bodies. We examined whether
intracellular protein transport is disturbed by the formation of
crystalloid ER. Intracellular distribution of VSV-G protein and
CD63 did not change by the formation of crystalloid ER. These
results suggest that the ER-Golgi, Golgi-plasma membrane, and
Golgi-lysosome transports occur normally in the crystalloid ER
forming cells, consistent with the observations by Bergmann
and Fusco (1990) that VSV-G protein rapidly transported from
crystalloid ER to the Golgi apparatus in UT-1 cells.
What is the function of crystalloid ER? Similar structures
appear naturally in luminous cells of marine annelids (Bassot,
1966) and in the germ cells of Hemiptera species (Wolf and
Motzko, 1995). In the first cell type, the crystalloid ER is thought
to be a luminous organelle. The physiological meaning of ER
aggregation, including crystalloid ER, has not been clarified yet.
Further detailed analysis of the formation of the crystalloid ER
by overexpression of msALDH will be useful for elucidating not
only the molecular mechanisms of the process, but also the biogenesis and differentiation of ER membranes.
We thank Dr Takashi Morimoto, New York University, for generously providing us with the cDNA for VSV-G protein and for helpful
discussions. We also thank Ms Kimie Masaki for valuable technical
assistance, Mr Iwao Nishimura, Laboratory Research Center, Kansai
Medical University, for help with cryoultramicrotomy, Mr Kazumi
Kobayashi, Laboratory Research Center, Kansai Medical University,
for help with confocal microscopy and image processing, Dr Mituo
Tagaya, Tokyo University of Pharmacy and Life Science, Tokyo,
Japan, for the generous gift of the monoclonal antibody against
vesicular stomatitis virus (VSV)-G protein. This work was supported
in part by a Grant-in Aid for Scientific Research from the Ministry of
Education, Science, and Culture of Japan.
REFERENCES
Akagi, S., Yamamoto, A., Yoshimori, T., Masaki, R., Ogawa, R. and
Tashiro, Y. (1988). Distribution of protein disulfide isomerase in rat
hepatocytes. J. Histochem. Cytochem. 36, 1533-1542.
Anderson, R. G. W., Orci, L., Brown, M. S., Garcia-Segura, L. M. and
Goldstein, J. L. (1983). Ultrastructural analysis of crystalloid endoplasmic
reticulum in UT-1 cells and its disappearance in response to cholesterol. J.
Cell Sci. 63, 1-20.
Bassot, J. M. (1966). Une forme microtubulaire et paracristalline de reticulum
endoplasmique dans les photocytes des Annelides polynoinæ. J. Cell Biol.
31,135-158.
Bergmann, J. E. and Fusco, P. J. (1990). The G protein of vesicular stomatitis
virus has free access into and egress from the smooth endoplasmic reticulum
of UT-1 cells. J. Cell Biol. 110, 625-635.
1738 A. Yamamoto, R. Masaki and Y. Tashiro
Brown, D. A. and Simoni, R. D. (1984). Biogenesis of 3-hydroxy-3methylglutaryl-coenzyme A reductase, an integral glycoprotein of the
endoplasmic reticulum. Proc. Nat. Acad. Sci. USA 81, 1674-1678.
Chin, D. J., Luskey, K. L., Anderson, R. G. W., Faust, J. R., Goldstein, J. L.
and Brown, M. S. (1982). Appearance of crystalloid endoplasmic reticulum
in compactin-resistant chinese hamster cells with a 500-fold increase in 3hydroxy-3-methylglutaryl-coenzyme A reductase. Proc. Nat. Acad. Sci. USA
79, 1185-1189.
Chin, D. J., Gil, G., Russell, D. W., Liscum, L., Luskey, K. L., Basu, S. K.,
Okayama, H., Berg, P., Goldstein, J. L. and Brown, M. S. (1984).
Nucleotide sequence of 3-hydroxy-3-methylglutaryl CoA reductase, a
glycoprotein of the endoplasmic reticulum. Nature 308, 613-617.
Hobman, T. C., Woodward, L. and Farquar, M. G. (1992). The rubella virus
E1 glycoprotein is arrested in a novel post-ER, pre-Golgi compartment. J.
Cell Biol. 118, 795-811.
Ishihara, N., Yamashina, S., Sakaguchi, M., Mihara, K. and Omura, T.
(1995). Malfolded cytochrome P-450(M1) localized in unusual membrane
structures of the endoplasmic reticulum in cultured animal cells. J. Biochem.
118, 397-404.
Jingami, H., Brown, M. S., Goldstein, J. L., Anderson, R. G. W. and
Luskey, K. L. (1987). Partial deletion of membrane-bound domain of 3hydroxy-3-methylglutaryl-coenzyme A reductase eliminates sterolenhanced degradation and prevents formation of crystalloid endoplasmic
reticulum. J. Cell Biol. 104, 1693-1704.
Kessel, R. G. (1992). Annulate lamellae: A last frontier in cellular organelles.
Int. Rev. Cytol. 133, 43-120.
Kochevar, D. T. and Anderson, R. G. W. (1987). Purified crystalloid
endoplasmic reticulum from UT-1 cells contains multiple proteins in
addition to 3-hydroxy-3-methylglutaryl coenzyme A reductase. J. Biol.
Chem. 262, 10321-10326.
Kramer, W. and Frits, H.-J. (1987). Oligonucleotide-directed construction of
mutations via gapped duplex DNA. Meth. Enzymol. 154, 350-367.
Kutay, U., Ahnert-Hilger, G., Hartmann, E., Wiedenmann, B. and
Rapoport, T. A. (1995). Transport route for synaptobrevin via a novel
pathway of insertion into the endoplasmic reticulum membrane. EMBO J.
14, 217-223.
Lippincott-Schwartz J., Yuan, L. C., Bonifacno, J. S. and Klausner, R. D.
(1989). Rapid redistribution of Golgi proteins into the ER in cells treated with
brefeldin A: evidence for membrane cycling from the Golgi to ER. Cell 56,
801-813.
Liscum, L., Finner-Moore, J., Stroud, R. M., Luskey, K. L., Brown, M. S.
and Goldstein, J. L. (1985). Domain structure of 3-hydroxy-3methylglutaryl-coenzyme A reductase, a glycoprotein of the endoplasmic
reticulum. J. Biol. Chem. 260, 522-530.
Luskey, K. L. and Stevens, B. (1985). Human 3-hydroxy-3-methylglutaryl
coenzyme A reductase. Conserved domains responsible for catalytic activity
and sterol-regulated degradation. J. Biol. Chem. 260, 10271-10277.
Masaki, R., Yamamoto, A. and Tashiro, Y. (1994). Microsomal aldehyde
dehydrogenase is localized to the endoplasmic reticulum via its carboxylterminal 35 amino acids. J. Cell Biol. 126,1407-1420.
Metzelaar, M. J., Wijngaard, P. L. J., Peters, P. J., Sixma, J. J.,
Nieuwenhuis, H. K. and Clevers, H. C. (1991). CD63 antigen. A novel
lysosomal membrane glycoprotein, cloned by a screening procedure for
intercellular antigens in eukaryotic cells. J. Biol. Chem. 266, 3239-3245.
Misumi, Y., Miki, A., Takatsuki, A., Tamura, G. and Ikehara, Y. (1986).
Novel blockage by brefeldin A of intracellular transport of secretory proteins
in cultured rat hepatocytes. J. Biol. Chem. 261, 11398-11403.
Miyauchi, K., Masaki, R., Taketani, S., Yamamoto, A., Akayama, M. and
Tashiro, Y. (1991). Molecular cloning, sequencing and expression of cDNA
for rat liver microsomal aldehyde dehydrogenase. J. Biol. Chem. 266, 1953619542.
Nishikawa, S., Hirata, A. and Nakano, A. (1994). Inhibition of endoplasmic
reticulum (ER)-to-Golgi transport induces relocalization of binding protein
(BiP) within the ER to form the BiP bodies. Mol. Biol. Cell 5, 1129-1143.
Orci, L., Brown, M. S., Goldstein, J. L., Garcia-Segura, L. M. and
Anderson, R. G. W. (1984). Increase in membrane cholesterol: A possible
trigger for degradation of HMG CoA reductase and crystalloid endoplasmic
reticulum in UT-1 cells. Cell 36, 835-845.
Orrenius, S., Ericsson, J. L. E. and Ernster, L. (1965). Phenobarbitalinduced synthesis of the microsomal drug-metabolizing enzyme system and
its relationship to the proliferation of endoplasmic reticulum. A
morphological and biochemical study. J. Cell Biol. 25, 627-639.
Otsu, H., Yamamoto, A., Maeda, N., Mikoshiba, K. and Tashiro, Y. (1990).
Immunogold localization of inositol 1,4,5-trisphosphate (InsP3) receptor in
mouse cerebellar Purkinje cells using three monoclonal antibodies. Cell
Struct. Funct. 15, 163-173.
Parrish, M. L., Sengstag, C., Rine, J. D. and Wright, R. L. (1995).
Identification of the sequence in HMG-CoA reductase required for karmellae
assembly. Mol. Biol. Cell 6, 1535-1547.
Pathak, R. K., Luskey, K. L. and Anderson, R G. W. (1986). Biogenesis of
the crystalloid endoplasmic reticulum in UT-1 cells: Evidence that newly
formed endoplasmic reticulum emerges from the nuclear envelope. J. Cell
Biol. 102, 2158-2168.
Rajasekaran, A., Morimoto, T., Hanzel, D. K., Rodriguez-Boulan, E. and
Kreibich, G. (1993). Structural reorganization of the rough endoplasmic
reticulum without size expansion accounts for dexamethasone-induced
secretory activity in AR42J cells. J. Cell Sci. 105, 333-345.
Raposo, G., Van Santen, H. M., Leijendekker, R., Geuse, H. J. and Ploegh,
H. L. (1995). Misfolded major histocompatibility complex class I molecules
accumulate in an expanded ER-Golgi intermediate compartment. J. Cell
Biol. 131, 1403-1419.
Remmer, H. and Merker, H. J. (1963). Drug-induced changes in the liver
endoplasmic reticulum: Association with drug metabolizing enzymes.
Science 142, 1657-1658.
Roitelman, J., Olender, E. H., Bar-Nun, S., Dunn, W. A. and Simoni, R. D.
(1992). Immunological evidence for eight spans in membrane domain of 3hydroxy-3-methylglutaryl-coenzyme A reductase: Implications for enzyme
degradation in the endoplasmic reticulum. J. Cell Biol. 117, 959-973.
Satoh, T., Ross, C. A., Villa, A., Supattapone, S., Pozzan, T., Snyder, S. H.
and Meldolesi, J. (1990). The inositol 1,4,5-trisphosphate receptor in
cerebellar Purkinje cells: Quantitative immunogold labeling reveals
concentration in an endoplasmic reticulum subcompartment. J. Cell Biol.
111, 615-624.
Sitia, R. and Meldolesi, J. (1992). Endoplasmic reticulum: A dynamic
patchwork of specialized subregions. Mol. Biol. Cell 3, 1067-1072.
Stäubli, W., Hess, R. and Weibel, E. R. (1969). Correlated morphometric and
biochemical studies on the liver cell. II. Effect of phenobarbital on rat
hepatocytes. J. Cell Biol. 42, 92-112.
Takagi, Y., Ito, A. and Omura, T. (1985). Biogenesis of microsomal aldehyde
dehydrogenase in rat liver. J. Biochem. 98, 1647-1652.
Takei, K., Stukenbrok, H., Metcalf, A., Mignery, G. A., Südhof, T. C.,
Volpe, P. and De Camilli, P. (1992). Ca2+ stores in Purkinje neuron:
Endoplasmic reticulum subcompartment demonstrated by the heterogenous
distribution of InsP3 receptor, Ca2+-ATPase and calsequestrin. J. Neurosci.
12, 489-505.
Takei, K., Mignery, G. A., Mugnaini, E., Südhof, T. C. and De Camilli, P.
(1994). Inositol 1,4,5-trisphosphate receptor causes formation of ER
cisternal stacks in transfected fibroblasts and in cerebellar Purkinje cells.
Neuron 12, 327-342.
Thastrup, O., Cullen, P. J., Drøbak, B. K., Hanley, M. R. and Dawson, A. P.
(1990). Thapsigargin, a tumor promoter, discharges intracellular Ca2+ stores
by specific inhibition of the endoplasmic reticulum Ca2+-ATPase. Proc. Nat.
Acad. Sci. USA 87, 2466-2470.
Tokuyasu, K. T. (1986). Application of cryoultramicrotomy to immunocytochemistry. J. Microsc. 143, 139-149.
Vergères, G., Yen, T. S. B., Aggeler, J., Lausier, J. and Waskell, L. (1993).
A model system for studying membrane biogenesis. Overexpression of
cytochrome b5 in yeast results in marked proliferation of the intracellular
membrane. J. Cell Sci. 106, 249-259.
Wiest, D. L., Burkhardt, J. K., Hester, S., Hortsch, M., Meyer, D. I. and
Argon, Y. (1990). Membrane biogenesis during B cell differentiation: Most
endoplasmic reticulum proteins are expressed coordinately. J. Cell Biol. 110,
1501-1511.
Wigler, M., Pellicer, A., Silverstein, S. and Axel, R. (1978). Biochemical
transfer of single-copy eukaryotic genes using total cellular DNA as donor.
Cell 14, 725-731.
Wolf, K. W. and Motzko, D. (1995). Paracrystalline endoplasmic reticulum is
typical of gametogenesis in hemiptera species. J. Struct. Biol. 114, 105-114.
Wright, R., Basson, M., D’Ari, L. and Rine, J. (1988). Increased amounts of
HMG-CoA reductase induce ‘Karmellae’: A proliferation of stacked
membrane pairs surrounding the yeast nucleus. J. Cell Biol. 107, 101-114.
Yamamoto, A., Otsu, H., Yoshimori, T., Maeda, N., Mikoshiba, K. and
Tashiro, Y. (1991). Stacks of flattened smooth endoplasmic reticulum
highly enriched in inositol 1,4,5-trisphosphate (InsP3) receptor in mouse
cerebellar Purkinje cells. Cell Struct. Funct. 16, 419-432.
(Received 11 January 1996 - Accepted 1 April 1996)