Download Light affects motility and infectivity of Agrobacterium tumefaciens

Environmental Microbiology (2008) 10(8), 2020–2029
doi:10.1111/j.1462-2920.2008.01618.x
Light affects motility and infectivity of
Agrobacterium tumefaciens
Inga Oberpichler,1*† Ran Rosen,2,3‡ Aviram Rasouly,3
Michal Vugman,3 Eliora Z. Ron3 and
Tilman Lamparter1†
1
Freie Universität Berlin, Pflanzenphysiologie,
Königin-Luise-Straße 12-16, 14195 Berlin, Germany.
2
The Maiman Institute for Proteome Research, and
3
Department of Molecular Microbiology and
Biotechnology, The George S. Wise Faculty of Life
Sciences Tel Aviv University, Tel Aviv, Israe.
Summary
Response to changes in light conditions involves a
variety of receptors that can modulate gene expression, enzyme activity and/or motility. For the study
of light-regulated effects of Agrobacterium tumefaciens, we used a global analysis approach – proteomics – and compared the protein patterns of
dark- and light-grown bacteria. These analyses
revealed a significant reduction of FlaA and FlaB –
proteins of the flagellum – when the cells were
grown in light. The light effect was confirmed by
SDS-PAGE with isolated flagella. Quantitative PCR
experiments showed a 10-fold increase of the transcription level of flaA, flaB and flaC within 20 min
after the transfer from light to darkness. Electron
microscopy revealed that these molecular events
result in a light-induced reduction of the number of
flagella per cell. These changes have major physiological consequences regarding motility, which is
considerably reduced with exposure to light. The
inhibitory effect of light on the motility is not unique
to A. tumefaciens and was also seen in other species
of the Rhizobiaceae. Previous studies suggested that
the flagella function is significant for bacteria–plant
interactions and bacterial virulence. In our studies,
light reduced the attachment of A. tumefaciens to
tomato roots and the virulence of the bacteria in a
cucumber infection assay.
Received 21 February, 2008; accepted 21 February, 2008. *For
correspondence. E-mail [email protected]; Tel. (+49) 721
6082993. Fax (+49) 721 6084193. Present address: †Universität
Karlsruhe, Botanik 1, Kaiserstr. 2, 76131 Karlsruhe, Germany;
‡Agentek (1987) Ltd. Atidim Scientific Park Tel Aviv, Israel.
Introduction
Motility changes in response to alterations of light quantity
and quality are ubiquitous features of (photosynthetic)
bacteria. Three distinct types of responses to light were
described (Hader, 1987; Ragatz et al., 1994; 1995; Gest,
1995). The scotophobic response (fear of darkness) is
characterized by a tumbling, cessation or reversal of
movement that occurs when a swimming bacterium experiences a step-down in light intensity. Photokinesis
describes an alteration in the rate of motility caused by
differences in light intensity. A phototactic response
involves an oriented movement of a cell towards or away
from a light source. An important distinction is that the
direction of irradiation is not relevant for scotophobic or
photokinetic responses, whereas it is a critical determinant in phototaxis (Jiang et al., 1998).
Light can also severely harm the cells at high
intensities. Hence, it is important for organisms to sense
and appropriately respond to light signals (Hellingwerf,
2002). Bacteria contain a large variety of sensory and
regulatory proteins which respond to light. These currently
include bacteriophytochrome (Bph), sensory rhodopsin
(SR), photoactive yellow protein (PYP), cryptochrome
(CRY), and photoreceptors that contain the FAD-binding
BLUF domains or FMN-binding LOV domains (Losi, 2004;
Briggs and Spudich, 2005; Swartz et al., 2007).
The genome sequence of the plant pathogen Agrobacterium tumefaciens revealed the existence of two phytochrome genes (Lamparter et al., 2002; Karniol and
Vierstra, 2003) and a gene for a cryptochrome/photolyase
type protein which might also function as photoreceptor
(Goodner et al., 2001; Wood et al., 2001; Kleine et al.,
2003; Partch and Sancar, 2005). Phytochromes are biliprotein photoreceptors that are defined by a red/far-redreversible photoconversion between the red-absorbing Pr
form and the far-red-absorbing Pfr form. Most bacterial
phytochromes are light-regulated histidine kinases that
trans-phosphorylate cognate response regulator proteins.
Agrobacterium tumefaciens phytochromes are designated Agp1 and Agp2 (Lamparter et al., 2002) or AtBphP1
and AtBphP2 (Karniol and Vierstra, 2003). Both phytochromes are present in cell extracts with concentrations of
10–20 molecules per cell (Oberpichler et al., 2006) and
have extensively been analysed as recombinant proteins
(Lamparter et al., 2002; 2004; Karniol and Vierstra, 2003;
© 2008 The Authors
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd
Light affects A. tumefaciens motility and infectivity 2021
Table 1. Agrobacterium tumefaciens proteins affected by light.
Protein
SwissProt Accession No.
A. tumefaciens proteins upregulated in light
TktA
Q8U9J2
IlvD
Q8UE43
RpsA*
Q8U8I8
Tuf
Q8UE16
GlyA
Q8UG75
MetE
Q8U9A5
Function
MW
pI
Transketolase
Dihydroxy-acid dehydratase
30S ribosomal protein S1
Elongation factor TU
Serine hydroxymethyltransferase
5-Methyltetrahydropteroyltriglutamate-homocysteine methyltransferase
71561
64983
62256
42599
46533
38656
5.99
5.63
5.05
5.23
6.11
5.61
77849
78800
64486
73834
50563
46533
45446
42451
31637
32967
4.88
5.88
6.26
5.44
4.75
6.11
6.07
5.57
4.75
4.73
A. tumefaciens proteins upregulated in darkness
PtrB
Q8UGY8
Protease II
NrdE
Q8UJ68
Ribonucleoside-diphosphate reductase 2 alpha chain
Edd*
Q8UHT1
Phosphogluconate dehydratase
NuoG
Q8UFX1
NADH ubiquinone oxidoreductase chain G
PdhB
Q8UFG7
Pyruvate dehydrogenase beta subunit
GlyA
Q8UG75
Serine hydroxymethyltransferase
CysD
Q8UFZ3
O-acetylhomoserine sulfhydrylase
ArgD
Q8UI71
Acetylornithine aminotransferase
FlaA*
Q7D187
Flagella-associated protein
FlaB*
Q8UHW7
FlaB
This table contains only proteins which were upregulated at least twofold. Proteins marked with an asterisk (*) were present only under one growth
condition and were not detected in the contrary condition. GlyA was detected at two positions on each gel. At one position it appears upregulated
in the light, at the other position upregulated in darkness. MW, molecular weight; pI, isoelectric point.
Noack et al., 2007). Cryptochromes and photolyases are
flavoproteins which are homologous to each other and are
most sensitive in the blue/UV spectral region. Photolyases bind to UV photoproducts of DNA and repair them
in a process called photoreactivation (Thompson and
Sancar, 2002). Cryptochromes are unable to repair DNA
damage, but function as photoreceptors for various
effects and as components of the circadian clock in plants
and animals (Lin, 2002).
Although much is known about the molecular biology of
A. tumefaciens, very little is known about the role of photoreceptors and the effect of light on A. tumefaciens in
general. It has been reported that during co-cultivation of
A. tumefaciens and plant callus or root tissue, the transfer
of a reporter gene is light dependent, but this effect was
assigned to increased competence of the plant tissues
(Zambre et al., 2003).
To gain insight into light-regulated effects of A. tumefaciens, we used a global analysis approach – proteomics –
for comparing the expression pattern of dark- and lightgrown cells. The proteome analyses showed that the
major flagella proteins FlaA and FlaB are more abundant
in darkness, which led to the analysis of the light effect
on motility and virulence. Here we show that transfer of
A. tumefaciens from light to darkness involves induction of
flagella genes. This induction results in an increase in the
number of flagella, cell motility and virulence.
Results
Proteome analyses
The comparison of the protein patterns revealed several
differences between the proteome of light- and dark-
grown A. tumefaciens. The proteins whose abundance
varied between the different growth conditions at least
twofold were identified by mass spectrometry. A list of
proteins that appeared to be light regulated in three out of
three independent experiments is given in Table 1. The
level of six proteins was significantly increased in lightgrown cells. Two of these are related to translation, three
are enzymes of amino acid metabolism and one is
involved in carbohydrate metabolism. Of the 10 proteins
that were more abundant in dark-grown cells, eight have
enzymatic functions of various kinds. The two other proteins, FlaA and FlaB, are components of the flagellum.
GlyA was detected at two positions on two-dimensional
(2D) gels. At one position it appears upregulated in the
light, at the other position upregulated in darkness. This
effect is probably the result of a light-dependent, posttranslational modification.
In the present study, we focused on the flagella proteins
FlaA and FlaB, as the Fla protein content may affect
motility, which is an essential attribute in terms of responding to environmental changes. Figure 1 shows an overlay
of the relevant sections from 2D gels obtained from darkand light-grown cells, indicating that both proteins – undetected in cells grown in the light – are significantly induced
in dark-grown cells.
Isolation and electron microscopy of
A. tumefaciens flagella
To further determine the effect of light on flagella,
two alternative approaches were chosen. In the first
approach, proteins from purified flagella were analysed on
SDS-polyacrylamide gels. On these gels, FlaA and FlaB
© 2008 The Authors
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 2020–2029
2022 I. Oberpichler et al.
grown cells exhibit either one or two flagella (mean value:
1.7; SE 0.5; n = 6) per cell, three to five flagella (mean
value: 3.6; SE 0.5; n = 6) were observed in dark-grown
cells.
Quantitative transcriptional analysis of the fla gene
Fig. 1. Effect of light on FlaA and FlaB. Agrobacterium tumefaciens
proteins of stationary-phase cultures grown in darkness or under
white light with an intensity of 150 mmol m-2 s-1 were separated by
2DE on a pH 4–7 gradient. The protein spots are presented in false
colours; proteins of bacteria grown in darkness or white light are
given in green and magenta, respectively. Both images were
overlaid by the Z3 software. Only the sections around the FlaA and
FlaB spots are shown.
appear as major bands, whereas FlaC and FlaD are
detectable as minor bands (Deakin et al., 1999). For a
semi-quantitative comparison of the flagella proteins, the
protein contents of the cell pellets were estimated and the
volumes of the flagella protein suspensions adjusted
accordingly. We obtained the expected protein patterns
on SDS gels (Fig. 2A) showing that the level of all the Fla
proteins was significantly lower in flagella preparations
from light-grown cells, compared with dark-grown cells.
This result is compatible with the finding that the fla genes
are induced in the dark and implies either that darkadapted cells have more flagella or that their flagella are
longer as compared with light-grown cells.
In the second approach the flagella were visualized by
transmission electron microscopy after negative staining
(Fig. 2B and C). This analysis showed that the effect of
light was on the number of flagella per cell. While light-
The results presented so far suggest the existence of a
light-dependent control mechanism that regulates flagella
protein synthesis. To analyse whether the regulation is at
the level of transcription, we performed real-time PCR
analyses and measured the relative levels of mRNAencoding flagella proteins following a shift from light to
dark (Fig. 3). Within 20 min after the transfer, the mRNA
levels of flaA, flaB and flaC, which are encoded by the
flaABC operon of A. tumefaciens (Deakin et al., 1999),
increased by about 10-fold. The high RNA level remained
constant for at least 1 h of incubation in the dark. The
transcript level of the flaD gene, which is located in a
different operon, did not increase, suggesting that flaD
expression is not under light control.
Motility tests
Following the observation that light affects the expression
of flagella proteins and the number of flagella, we studied
the effect of light on cell motility. To this end, A. tumefaciens cells were inoculated in the centre of LB soft agar
‘swimming plates’ and incubated either under white light
(150 mmol m-2 s-1) or in darkness for 24 h (Fig. 4A). For
comparison, the same assay was performed with Escherichia coli (Fig. 4A), Pseudomonas aeruginosa and Serratia
marcescens (data not shown). Whereas the diameter of
the E. coli, P. aeruginosa and S. marcescens colonies did
not differ significantly between darkness and light, a
strong light/dark difference was found for A. tumefaciens:
the mean diameter of dark colonies was ~1.8-fold higher
in comparison with colonies kept under white light. To our
Fig. 2. Influence of light on flagella.
A. SDS-PAGE of isolated flagella of A. tumefaciens grown overnight on LB agar under white light as in Fig. 1 (lane 1) or in darkness (lane 2).
The flagella protein suspension was normalized to the protein content of the cells. The identity of the Fla proteins was confirmed by mass
spectrometry.
B and C. Electron micrographs of A. tumefaciens cells. Microscopy was performed on negatively stained cells from cultures grown overnight
under white light (B) or in darkness (C). The flagella are marked with arrows. Scale bar: 200 nm.
© 2008 The Authors
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 2020–2029
Light affects A. tumefaciens motility and infectivity 2023
Fig. 3. Flagella gene expression.
Agrobacterium tumefaciens cultures were
grown in AB minimal media under white light
to exponential phase, the cultures were
transferred to darkness and samples were
taken at 20 min intervals from 0 to 60 min.
The figure shows the normalized RNA levels
as measured by real-time PCR; each
transcript was normalized to time 0.
surprise, a similar effect was found for other Rizobiaceae
species. Motility experiments with Agrobacterium vitis,
Rhizobium radiobacter and Rhizobium leguminosarum on
TY soft agar ‘swimming plates’ imply that the light effect is
general for Rhizobiaceae (Fig. 5): The colony diameters
of all three species were smaller in light than in darkness.
Photoreceptor mutants
To identify the photoreceptor involved in the lightdependent regulation of motility, we constructed
gene-knockouts in the A. tumefaciens photoreceptor
candidates. Based on the genome sequence (Goodner
et al., 2001; Wood et al., 2001), three (putative) photoreceptors have been identified in A. tumefaciens, two phytochromes (Lamparter et al., 2002; Karniol and Vierstra,
2003), termed Agp1 and Agp2, and a member of the
cryptochrome/photolyase family (Goodner et al., 2001;
Wood et al., 2001; Kleine et al., 2003), termed PhrA here.
The insertion knockout mutants agp1- (Atu1990), agp2(Atu2165) and agp1-agp2- (Oberpichler et al., 2006),
defective in one or both phytochromes, were used to test
for the light effect on the motility. We also generated an
B
Relative colony diameter
A
insertion knockout mutant phrA- which encodes the
cryptochrome/photolyase gene (Atu1218, Wood et al.,
2001). In all four mutants, the light effect on the swimming
behaviour was comparable with that of the wild type. In
addition, we analysed the proteins from isolated flagella of
the agp1-, agp2-, agp1-/agp2- and phrA- mutant grown in
light and in darkness. The Fla protein level of all mutants
was significantly lower in flagella preparations from lightgrown cells as compared with dark-grown cells (data not
shown) as it was found for the wild type. Thus, none of the
three known A. tumefaciens photoreceptors by itself is
responsible for the light effect on cell motility. These
results suggest that there is an additional photoreceptor in
A. tumefaciens or alternatively that the three photoreceptors can compensate for each other in terms of the effect
of light on motility despite their different spectral absorption characteristics.
Light-dependent adherence and virulence
Flagella are not only required for cell motility and the
chemotactic response, but also important virulence
factors, as motility improves host–pathogen interactions
Fig. 4. Effect of light on A. tumefaciens
incubated on swimming plates.
A. Agrobacterium tumefaciens (upper plates)
and E. coli (lower plates) were incubated on
LB swimming plates under white light (L, left)
or in darkness (D, right). Photographs were
taken after 24 h. Scale bar: 1 cm.
B. Mean values ⫾ SE of colony diameters;
n = 20. For a comparison of both species, the
values were normalized to the mean values of
the dark samples. Mean diameters of A.
tumefaciens and E. coli colonies were 4.5 mm
and 28 mm, respectively.
2
1.5
1
0.5
0
L D
A.tumefaciens
L D
E. coli
© 2008 The Authors
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 2020–2029
2024 I. Oberpichler et al.
applied, was covered with a black paper, whereas the
leaves and major part of the stem remained exposed to
the light. Tumours were inspected 2 weeks following the
inoculation of bacteria. The results indicated that tumours
of covered stem bases (Fig. 7B) were significantly larger
than those of uncovered (light-exposed) stem bases
(Fig. 7A). Tumours that were induced in darkness were
three to four times heavier than those induced under
light exposure (Fig. 7C). The light/dark difference was
obtained irrespective of whether the bacteria were directly
applied to injured stem regions or simply added to the soil
without direct contact to the plant (Fig. 7). These results
show that light can have a direct impact on the virulence
of A. tumefaciens, possibly by modulating flagella protein
expression and motility.
Fig. 5. Effect of light on the motility of different Rhizobiaceae
species. Agrobacterium tumefaciens, Rh. radiobacter, A. vitis and
Rh. leguminosarum were incubated on TY swimming plates under
white light (L) or in darkness (D). (Note that the medium differs
from that of Fig. 4.) Colony diameters were measured after 24 h.
Mean values ⫾ SE of colony diameters; n = 10.
(Ramos et al., 2004). Therefore, we determined the effect
of light on the attachment of A. tumefaciens to plant tissue
by a root binding assay (Rosen et al., 2003). In this assay,
A. tumefaciens cells were incubated for 3 h with tomato
(Solanum lycopersicum) roots under continuous light or in
darkness. When the assay was performed in darkness,
the bacteria were already bound and imbedded into the
extracellular matrix (Fig. 6B), which is a process that
follows the initial binding and strengthens the attachment
to plant tissue. When the assay was performed in
the light, the bacteria seemed to be at the initial step of the
binding process with only few bacteria visible on the
tomato roots (Fig. 6A).
The increased motility of A. tumefaciens could also
affect tumour induction. To test this possibility, we infected
2-week-old cucumber (Cucumis sativus) plants in light or
darkness. In order to minimize the effect of darkness on
the general metabolism of the plant, only a small part at
the base of the plant stem, the region where bacteria were
Discussion
In this study, we demonstrated that light represses the
expression of flagella genes in A. tumefaciens. As a
result, bacteria grown in the dark are more motile, adhere
better to plants and are more virulent.
The effect of light on expression of flagella genes was
determined by three parameters: (i) increase in the concentration of the flagella proteins FlaA and FlaB, seen on
one-dimensional (1D) and 2D gels, (ii) dark induction of
the flaABC operon, and (iii) an increase in the number of
flagella per cell, visualized by electron microscopy.
The motility in A. tumefaciens is due to clockwiserotating flagella (Ashby et al., 1988). Flagella are composed of four similar flagellins, FlaA, FlaB, FlaC and FlaD
(Deakin et al., 1999). FlaA is the major flagella protein,
while FlaB and FlaC are less abundant and FlaD is a
minor component (Deakin et al., 1999). The flagellin
genes are found in a large cluster involved with flagella
synthesis, assembly and switching (Chesnokova et al.,
1997; Deakin et al., 1997a,b; 1999). The transcriptional
analysis showed dark induction of the flaABC operon
while flaD seems unaffected. The results of the regulation
of flaA and flaB expression are in accordance with the
proteome study, whereas FlaC was not identified on 2D
gels, probably due to its low abundance. A light effect on
Fig. 6. Attachment of A. tumefaciens to
tomato roots (Solanum lycopersicum). The
assay was performed as described in
Experimental procedures. The roots were
incubated with the bacteria under white light
(A) or in darkness (B). Photographs were
taken after 3 h. Scale bar: 50 mm.
© 2008 The Authors
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 2020–2029
Light affects A. tumefaciens motility and infectivity 2025
A
B
C
Fig. 7. Effect of light on A. tumefaciens
virulence. Two-week-old cucumber plants
(Cucumis sativus) were infected with
A. tumefaciens as described in Experimental
procedures. The infected plants were grown
under constant white light with the stem base
exposed (A) or covered by a black paper to
create local darkness (B). Arrows indicate
tumor region. Photographs were taken after 2
weeks. Scale bar: 1 cm. (C) Mass of the
induced tumours by bacteria application to the
soil; mean values ⫾ SE; n = 30.
18
Tumors mass (mg)
16
14
12
10
8
6
4
2
0
L
FlaC was, however, shown by flagella isolation followed
by 1D electrophoresis. It is therefore likely that the whole
flaABC operon, which is transcribed separately (Chesnokova et al., 1997), is light regulated in a fast kinetics, as
the maximum transcript level was reached within 20 min
after the light to dark transition. Although the transcription
of flaD is apparently not under light control, the light effect
on the FlaD protein content parallels that of the other Fla
proteins, as shown by 1D SDS-PAGE. Obviously, the
FlaD protein stability depends on the presence of the
proteins: FlaA, FlaB and FlaC. Deakin and colleagues
(1999) studied A. tumefaciens strains in which selected
flagella genes were knocked out. These authors found
that a flaABC- mutant does not accumulate FlaD, a finding
that is in line with our observation on the protein stability
of FlaD.
The correlation between the cellular levels of flagella
proteins and the number of flagella on the cellular
surface was confirmed by electron microscopy. These
changes have major physiological consequences regarding motility, bacteria–plant interactions and virulence, as
shown by swimming plate, binding and infection assays.
As such, A. tumefaciens motility is strongly reduced in
light. This light effect appears to be general for Rhizobiaceae as all representatives of this family tested in this
study (A. tumefaciens, A. vitis, Rh. radiobacter and Rh.
leguminosarum) show similar effects of light on motility.
However, the motility of other Gram-negative bacteria
tested here (E. coli, P. aeruginosa and S. marcescens) is
not affected by the same light treatment. It is known that
E. coli responds to changes in light intensity in a different
manner: a pulse of intense blue light results in a tumbling
or a repellent response that lasts for several seconds
(Yang et al., 1996). An other blue light effect, which
requires cell surface structures including the holdfast, pili
and flagellum, was reported for Caulobacter crescentus,
a species that is neither photosynthetic, phototactic
nor pigmented. Here a LOV family photosensory twocomponent system LovK/LovR can act to regulate bacterial cell–surface and cell–cell attachment (Purcell et al.,
2007). Phototactic responses are known for many bac-
D
teria including Halobacterium salinarum, Ectothiorhodospira halophila (Hellingwerf, 2002), Rhodospirillum
centenum (Jiang et al., 1998) or cyanobacteria such as
Synechocystis PCC6803 (Wilde et al., 2002; Yoshihara
and Ikeuchi, 2004). In our laboratory there was as yet no
indication for a phototactic response of A. tumefaciens,
i.e. movement towards or away from the light source
(G. Rottwinkel, pers. comm.). The light effect found in the
present study could be defined as photokinesis: an alteration in the rate of motility caused by differences in light
intensity.
Flagella are important components of the infection
process as shown by using a flagella-less bald strain
(Chesnokova et al., 1997; Li et al., 2002). Similarly, we
could show that a light-induced reduction of the flagella
number correlates with a reduction of infectivity. A direct
link between flagella, motility and infectivity is obvious in
both cases. Less motile bacteria will have a reduced
chance to get in contact with a susceptible plant cell.
Flagella might also be important for the attachment of the
bacteria to plant cells. Such a role has been reported for
flagella of other bacteria (Ramos et al., 2004; RodriguezNavarro, 2007) but – to the best of our knowledge – not for
A. tumefaciens.
Darkness – or limited light – can be added to the optimized infection conditions that were previously described
as acidic pH and the presence of certain plant secreted
phenolic compounds (Sheng and Citovsky, 1996). An
effect of light on the crucial ability of A. tumefaciens to
infect and colonize plants in order to induce its most
advantageous niche, the gall, must have an important
physiological role. Light provides information about the
daytime and the position within the environment. In addition, light positively effects the plant defence against
pathogens and is required for activation of several
defence genes (Chandra-Shekara et al., 2006). The dark
increase of flagella synthesis and infectivity could have
evolved to circumvent the plant defence and thereby
increase the success of DNA transfer. Alternatively, the
dark increase of motility could be a mechanism to direct
the bacteria to the surface of the soil. The plant tumours
© 2008 The Authors
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 2020–2029
2026 I. Oberpichler et al.
induced by A. tumefaciens, the crown galls, are preferentially formed at the base of the plant.
In some bacterial species, light effects on the motility
are absorbed by photosynthetic pigments which serve as
sensing molecules. Photosynthesis then generates a
signal via electron transport, which is transmitted to, for
example, a chemotaxis pathway (Armitage and Hellingwerf, 2003). However, there are several examples indicating that specific photoreceptors play a role in absorbing
the light (Armitage and Hellingwerf, 2003; Fiedler et al.,
2005). Our initial attempts to identify a single-gene
product among the known and putative photoreceptors of
A. tumefaciens for the regulation of the light/dark motility
were unsuccessful. In this study, we performed swimming
plate assays with phytochrome single and double mutants
and with a mutant defective in the cryptochrome/
photolyase gene. Neither of these mutations abolished
the light effect on cell motility. This might suggest that
there is a photoreceptor overlap and all three known
photoreceptors act in concert. Alternatively, there is
the intriguing option that there exists an additional, yet
unknown, photoreceptor that has not been revealed in the
genome sequence.
Light appears to have a major effect on A. tumefaciens
and other non-photosynthetic Rhizobiaceae. In future
studies, we plan to address the molecular mechanisms
that are involved in the light regulation of A. tumefaciens
motility.
Experimental procedures
Bacterial strains and growth conditions
Wild-type strains used in this study were A. tumefaciens C58,
which harbours the Ti nopaline plasmid and Rh. radiobacter
13874 (DSMZ stock centre, Braunschweig, Germany),
A. vitis S4 (Leon Otten, University Louis Pasteur, Strasbourg,
France), Rh. leguminosarum (soil isolate, J. Huckauf, University of Rostock, Germany), E. coli K-12 MG 1655, S. marcescens and P. aeruginosa (from our laboratory collection).
Bacteria were grown at 25°C for motility assays and at 28°C
for other studies. Media used were AB minimal medium
(Chilton et al., 1974) supplemented with 0.2% glucose,
Tryptone-Yeast medium (TY) or Luria–Bertani medium (LB).
For tomato root-binding experiments the pH of the AB
minimal medium was adjusted to 6.0–6.8 as this pH condition
was shown to be optimal for tomato root-binding experiments
(Rosen et al., 2003). White light (Osram L 36 W/765
cool daylight, Munich, Germany) with an intensity of
150 mmol m-2 s-1 was used for growth in the light. The emission spectrum of the lamp ranges from 380 to 690 nm and
has maxima at 440, 550 and 575 nm. Dark was achieved by
wrapping in aluminum foil. The temperature of the growth
media did not significantly differ between darkness and light
(28.0 ⫾ 0.1°C). In addition, there is no significant effect of
light on the growth rate of A. tumefaciens, as found in an
earlier study (Oberpichler et al., 2006).
Mutants of A. tumefaciens
In the A. tumefaciens knockout mutants agp1- and agp2-, one
of both phytochrome genes (also denominated Atu1990
and Atu2165, respectively, according to the nomenclature of
Wood et al., 2001) is interrupted by an omega spectinomycin
(W) resistance cassette. In the agp1-/agp2- double mutant,
the agp1 gene (Atu1990) is interrupted by an W and the agp2
gene (Atu2165) by a gentamicin resistance cassette (Oberpichler et al., 2006). A phrA- knockout mutant, in which the
cryptochrome/photolyase gene (Atu1218) is interrupted by an
W cassette, was constructed as follows: Genomic A. tumefaciens DNA was extracted using Nucleo Spin Tissue Kit
(Macherey-Nagel, Düren, Germany). The phrA gene was
PCR amplified using the primers phrA_5′ (ATTTGGTGGT
GGTTCCGCCAG) and phrA_3′ (ATCACCGTCTTGTAG
CCGAGC). The PCR parameters were: 30 cycles (94°C,
30 s; 61°C, 60 s; 72°C, 180 s). The phrA PCR product was
cloned into the EcoRV site of pBluescript II (KS-) (Stratagene)
to obtain pBSphrA. An MscI digests of pBSphrA was T-tailed
and ligated with a PCR product of the W cassette as
described by Oberpichler and colleagues (2006) to obtain
pBSphrAW. The plasmid pBSphrAW was digested with XbaI
and ApaI and the resulting phrAW construct was cloned into
the sites of pJQ200KS (Quandt and Hynes, 1993) to obtain
pJQphrAW. The pJQphrAW plasmid was used for transformation of A. tumefaciens cells by electroporation to gain the
strains phrA- [C58 DSMZ 5172 phrA::W (SpcR)]. Positive
clones were selected on LB agar supplemented with
spectinomycin. Knockout clones were selected by PCR
analysis and disruption of phrA was confirmed by Southern
blot analysis using the digoxygenin labelling system
(Roche).
Proteome analysis
Bacteria were collected from stationary-phase cultures by
quick cooling to 4°C. The cells were then centrifuged and
washed twice with cold TE-PMSF [10 mM Tris pH 7.5; 1 mM
EDTA; 1.4 mM PMSF (Phenyl-methyl-sulfonyl-fluoride)]. The
washed cells were re-suspended in 0.5 ml of TE-PMSF and
disrupted by sonication. Cell debris and protein aggregates
were removed by centrifugation at 20000 g for 30 min at
4°C and the supernatants containing the proteins were
lyophilized. The protein concentration was determined using
the Bradford method (Bradford, 1976) with the Protein
Assays kit (Bio-Rad) and samples of 300 mg were separated
by two-dimensional gel electrophoresis (2DE) as described in
Rosen and colleagues (2001). The gels were stained with
colloidal Coomassie. The scanned gel images were analysed
and compared with the Z3 software (Compugen, Israel),
using the relative expression parameter. Proteins of interest
were cut out of the gels and identified by mass spectrometry
as previously described (Rosen et al., 2004). Briefly, protein
spots were excised from stained 2D gels and the gel pieces
were washed in a 200 mM NH4HCO3-50% acetonitril solution
for 30 min at 37°C. The solution was discarded and the gels
were dried in a SpeedVac for 30 min. The gels were rehydrated in a solution of 20 mg ml-1 trypsin (Promega, Madison,
WI, USA) and the proteins were digested for 16 h at 37°C.
Peptides were extracted from the gel by diffusion in water and
© 2008 The Authors
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 2020–2029
Light affects A. tumefaciens motility and infectivity 2027
the proteins were identified by liquid chromatography/tandem
mass spectrometry (LC/MS/MS) using an UltimateTM nano
HPLC (LC Packings, Amsterdam, the Netherlands) and a
QStar Pulsar mass spectrometer (Applied Biosystems,
Foster City, CA, USA).
Isolation of flagella
Flagella filaments were isolated as previously described
(Deakin et al., 1999). Briefly, bacteria were grown on LB agar
plates and incubated for 24 h in darkness or light. Thereafter,
bacterial lawns were washed off the agar plates using 150 mM
sodium chloride and the flagella were detached from the cells
by vortexing for 15 s. The bacterial cells were removed by two
centrifugation steps at 12000 and 15000 g for 15 min at 4°C
and the flagella filaments were pelleted from the supernatant
by centrifugation at 100.000 g for 2 h at 4°C. The flagella were
analysed on SDS-PAGE; the concentrations of acrylamide
and bis-acrylamide were 15% and 0.4%, respectively. The
gels were finally stained with colloidal Coomassie.
Microscopy
Light microscopy for the root attachment experiments was
performed with an IX 70 light microscope (Olympus, Japan)
using phase contrast optics. For electron microscopy, A. tumefaciens cultures were grown overnight without agitation. The
bacterial cultures were filtered, washed in 150 mM sodium
chloride and negatively stained with 1% uranyl acetate on a
Formvar-coated grid, which were viewed in an A JEM1200EX
transmitting electron microscope (JEOL-USA, Peabody, MA,
USA) equipped with a 25 ¥ 4 inch flat film camera.
Real-time quantitative PCR
Total RNA for real-time quantitative reverse transcription
polymerase chain reaction (RT-PCR) was extracted from
0.5 ml of exponential growth cultures using the RNeasy kit
(Qiagen), following immediate addition of 1 ml of RNAprotect
bacterial reagent (Qiagen). The isolated RNA was treated
with DNase I (Promega) to remove genomic DNA contamination and its quality and integrity were examined. One
microgram of the DNase-treated total RNA was reversetranscribed for first-strand cDNA by using the Improm-II
reverse transcriptase (Promega) as described by the
manufacturer. A relative analysis of flaA (Atu0545), flaB
(Atu0543), flaC (Atu0542) and flaD (Atu0567) RNAs was
performed using an ABI Prism 7700 DNA analyser (Applied
Biosystems), and the SYBER GREEN PCR Master mix
(Applied Biosystems). Relative gene expression data analysis was carried out with the DDCt method using the 16S rRNA
gene as the internal standard. The PCR primers are shown in
Table 2.
Swimming plates
Motility tests were performed as previously described (Das
et al., 2002). Briefly, bacteria were grown on solid media,
transferred with a toothpick to the centre of an LB or TY agar
Table 2. Real-time PCR primers.
Primer
Sequence
flaA_F
flaA_R
flaB_F
flaB_R
flaC_F
flaC_R
flaD_F
flaD_R
16S_F
16S_R
GCGGCACCGTTAGCGTCAAGA
CGTCGATCGTGCCCGGTGTAC
CCACCATGCGCTCCGACAACA
GCGGTGACCAGCTTTGCCTTGA
GGGCGCCAAGACCGTCGTTTC
TGCCGGCGGTGGTGTCGATAA
GCGCGTGTCATCGGGCTTTC
CGGCCGAAAGTGCGCTATTGTC
CAGCCATGCCGCGTGAGTGAT
GCGGCTGCTGGCACGAAGTTA
plate containing 0.3% agar and incubated for 24 h in white
light or in darkness. The plates were photographed after 24 h
and the colony diameter was measured.
Bacterial adherence and virulence assays
Adherence of bacteria to tomato (S. lycopersicum) roots was
determined in hydroponics as previously described (Rosen
et al., 2003). Briefly, to obtain axenic tomato roots, tomato
seeds were surface sterilized by soaking in 80% ethanol for
1 min, followed by 20 min in 1.05% sodium hypochlorite solution, after which they were rinsed four times with sterile water
and placed at room temperature in sterile water to germinate
in the dark for 10 days. The 10-day-old axenic roots were cut
into segments (2–3 cm long) under sterile conditions and
added at a root concentration of about 3 cm ml-1 to 5 ml of AB
minimal media-grown A. tumefaciens culture. The culture
was at stationary phase and was diluted 1:5 into fresh growth
medium. For light microscopy inspection the roots were
washed with water to remove unbound bacteria. Samples
were removed at 1 h intervals for microscopy.
The cucumber virulence assays were performed on
14-day-old cucumber (C. sativus) plants cultivar Socrates
(Hishtil Yedidya Nursery, Kfar Yedidya, Israel). For infection
the stems were cut with a scalpel and 1 ml of a stationary
phase A. tumefaciens culture was applied onto the ground.
The plants were incubated at 25°C under constant white light
(150 mmol m-2 s-1), or with black paper covering the stem for
creating local darkness. Photographs were taken after 14
days, the tumours were removed and the masses were
determined.
Acknowledgements
The authors thank Ayelet Sacher of the Maiman Institute for
Proteome Research at Tel Aviv University for her help in
protein identification, Vered Holdengreber of the Electron
Microscopy Unit of The George S. Wise Faculty of Life Sciences for the electron micrographs, Dvora Biran of the
George S. Wise Faculty of Life Sciences Tel Aviv University
for her help with the tomato root binding, Jana Huckauf from
the University of Rostock, Germany, for kindly donating the
Rh. leguminosarum strain and Leon Otten of the University
Louis Pasteur, Strasbourg, France, for kindly donating the A.
vitis S4 strain. This work was partially supported by a DAAD
fellowship (I.O.), a Peikovsky Valachi Post Doctoral Fellow-
© 2008 The Authors
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 2020–2029
2028 I. Oberpichler et al.
ship (R.R.), the Deutsche Forschungsgemeinschaft (La799/
7-3), the Manja and Morris Leigh Chair for Biophysics and
Biotechnology (E.Z.R.) and a grant from BARD (US-Israel
Bionational Agriculture Foundation) (E.Z.R.).
References
Armitage, J.P., and Hellingwerf, K.J. (2003) Light-induced
behavioral responses (‘phototaxis’) in prokaryotes. Photosynth Res 76: 145–155.
Ashby, A.M., Watson, M.D., Loake, G.J., and Shaw, C.H.
(1988) Ti plasmid-specified chemotaxis of Agrobacterium
tumefaciens C58C1 toward vir-inducing phenolic compounds and soluble factors from monocotyledonous and
dicotyledonous plants. J Bacteriol 170: 4181–4187.
Bradford, M.M. (1976) A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the
principle of protein-dye binding. Anal Biochem 72: 248–
254.
Briggs, W.R., and Spudich, J.L. (2005) Handbook of Photosensory Receptors. Weinheim, Germany: Wiley-VCH.
Chandra-Shekara, A.C., Gupte, M., Navarre, D., Raina, S.,
Raina, R., Klessig, D., and Kachroo, P. (2006) Lightdependent hypersensitive response and resistance signaling against Turnip Crinkle Virus in Arabidopsis. Plant J 45:
320–334.
Chesnokova, O., Coutinho, J.B., Khan, I.H., Mikhail, M.S.,
and Kado, C.I. (1997) Characterization of flagella genes of
Agrobacterium tumefaciens, and the effect of a bald strain
on virulence. Mol Microbiol 23: 579–590.
Chilton, M.D., Currier, T.C., Farrand, S.K., Bendich, A.J.,
Gordon, M.P., and Nester, E.W. (1974) Agrobacterium
tumefaciens DNA and PS8 bacteriophage DNA not
detected in crown gall tumors. Proc Natl Acad Sci USA 71:
3672–3676.
Das, S., Chakrabortty, A., Banerjee, R., and Chaudhuri, K.
(2002) Involvement of in vivo induced icmF gene of Vibrio
cholerae in motility, adherence to epithelial cells, and conjugation frequency. Biochem Biophys Res Commun 295:
922–928.
Deakin, W.J., Furniss, C.S., Parker, V.E., and Shaw, C.H.
(1997a) Isolation and characterisation of a linked cluster of
genes from Agrobacterium tumefaciens encoding proteins
involved in flagellar basal-body structure. Gene 189: 135–
137.
Deakin, W.J., Sanderson, J.L., Goswami, T., and Shaw, C.H.
(1997b) The Agrobacterium tumefaciens motor gene,
motA, is in a linked cluster with the flagellar switch protein
genes, fliG, fliM and fliN. Gene 189: 139–141.
Deakin, W.J., Parker, V.E., Wright, E.L., Ashcroft, K.J.,
Loake, G.J., and Shaw, C.H. (1999) Agrobacterium tumefaciens possesses a fourth flagellin gene located in a large
gene cluster concerned with flagellar structure, assembly
and motility. Microbiology 145: 1397–1407.
Fiedler, B., Börner, T., and Wilde, A. (2005) Phototaxis in the
cyanobacterium Synechocystis sp. PCC 6803: role of different photoreceptors. Photochem Photobiol 81: 1481–
1488.
Gest, H. (1995) Phototaxis and other sensory phenomena in
purple photosynthetic bacteria. FEMS Microbiol Rev 16:
287–294.
Goodner, B., Hinkle, G., Gattung, S., Miller, N., Blanchard,
M., Qurollo, B., et al. (2001) Genome sequence of the plant
pathogene and biotechnology agent Agrobacterium tumefaciens C58. Science 294: 2323–2328.
Hader, D.P. (1987) Photosensory behavior in prokaryotes.
Microbiol Rev 51: 1–21.
Hellingwerf, K.J. (2002) The molecular basis of sensing and
responding to light in microorganisms. Antonie Van Leeuwenhoek 81: 51–59.
Jiang, Z.Y., Rushing, B.G., Bai, Y., Gest, H., and Bauer, C.E.
(1998) Isolation of Rhodospirillum centenum mutants
defective in phototactic colony motility by transposon
mutagenesis. J Bacteriol 180: 1248–1255.
Karniol, B., and Vierstra, R.D. (2003) The pair of bacteriophytochromes from Agrobacterium tumefaciens are histidine
kinases with opposing photobiological properties. Proc Natl
Acad Sci USA 100: 2807–2812.
Kleine, T., Lockhart, P., and Batschauer, A. (2003) An
Arabidopsis protein closely related to Synechocystis
cryptochrome is targeted to organelles. Plant J 35: 93–
103.
Lamparter, T., Michael, N., Mittmann, F., and Esteban, B.
(2002) Phytochrome from Agrobacterium tumefaciens has
unusual spectral properties and reveals an N-terminal
chromophore attachment site. Proc Natl Acad Sci USA 99:
11628–11633.
Lamparter, T., Carrascal, M., Michael, N., Martinez, E., Rottwinkel, G., and Abian, J. (2004) The biliverdin chromophore binds covalently to a conserved cysteine residue
in the N-terminus of Agrobacterium phytochrome Agp1.
Biochemistry 43: 3659–3669.
Li, L., Jia, Y.H., and Pan, S.Q. (2002) Agrobacterium flagellar
switch gene fliG is liquid inducible and important for
virulence. Can J Microbiol 48: 753–758.
Lin, C. (2002) Blue light receptors and signal transduction.
Plant Cell 14 (Suppl.): S207–S225.
Losi, A. (2004) The bacterial counterparts of plant
phototropins. Photochem Photobiol Sci 3: 566–574.
Noack, S., Michael, N., Rosen, R., and Lamparter, T. (2007)
Protein conformational changes of Agrobacterium
phytochrome Agp1 during chromophore assembly and
photoconversion. Biochemistry 46: 4164–4176.
Oberpichler, I., Molina, I., Neubauer, O., and Lamparter, T.
(2006) Phytochromes from Agrobacterium tumefaciens:
difference spectroscopy with extracts of wild type and
knockout mutants. FEBS Lett 580: 437–442.
Partch, C.L., and Sancar, A. (2005) Photochemistry and photobiology of cryptochrome blue-light photopigments: the
search for a photocycle. Photochem Photobiol 81: 1291–
1304.
Purcell, E.B., Siegal-Gaskins, D., Rawling, D.C., Fiebig, A.,
and Crosson, S. (2007) A photosensory two-component
system regulates bacterial cell attachment. Proc Natl Acad
Sci USA 104: 18241–18246.
Quandt, J., and Hynes, M.F. (1993) Versatile suicide vectors
which allow direct selection for gene replacement in gramnegative bacteria. Gene 127: 15–21.
Ragatz, L., Jiang, Z.Y., Bauer, C., and Gest, H. (1994) Phototactic purple bacteria. Nature 370: 104.
Ragatz, L., Jiang, Z.Y., Bauer, C.E., and Gest, H. (1995)
Macroscopic phototactic behavior of the purple photosyn-
© 2008 The Authors
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 2020–2029
Light affects A. tumefaciens motility and infectivity 2029
thetic bacterium Rhodospirillum centenum. Arch Microbiol
163: 1–6.
Ramos, H.C., Rumbo, M., and Sirard, J.C. (2004) Bacterial
flagellins: mediators of pathogenicity and host immune
responses in mucosa. Trends Microbiol 12: 509–517.
Rodriguez-Navarro, D.N., Dardanelli, M.S., and Ruiz-Sainz,
J.E. (2007) Attachment of bacteria to the roots of higher
plants. FEMS Microbiol Lett 272: 127–136.
Rosen, R., Buttner, K., Schmid, R., Hecker, M., and Ron, E.Z.
(2001) Stress-induced proteins of Agrobacterium tumefaciens. FEMS Microbiol Ecol 35: 277–285.
Rosen, R., Matthysse, A.G., Becher, D., Biran, D., Yura, T.,
Hecker, M., and Ron, E.Z. (2003) Proteome analysis of
plant-induced proteins of Agrobacterium tumefaciens.
FEMS Microbiol Ecol 44: 355–360.
Rosen, R., Sacher, A., Shechter, N., Becher, D., Buttner, K.,
Biran, D., et al. (2004) Two-dimensional reference map of
Agrobacterium tumefaciens proteins. Proteomics 4: 1061–
1073.
Sheng, J., and Citovsky, V. (1996) Agrobacterium-plant cell
DNA transport: have virulence proteins, will travel. Plant
Cell 8: 1699–1710.
Swartz, T.E., Tseng, T.S., Frederickson, M.A., Paris, G.,
Comerci, D.J., Rajashekara, G., et al. (2007) Blue-light-
activated histidine kinases: two-component sensors in
bacteria. Science 317: 1090–1093.
Thompson, C.L., and Sancar, A. (2002) Photolyase/
cryptochrome blue-light photoreceptors use photon energy
to repair DNA and reset the circadian clock. Oncogene 21:
9043–9056.
Wilde, A., Fiedler, B., and Börner, T. (2002) The cyanobacterial phytochrome Cph2 inhibits phototaxis towards blue
light. Mol Microbiol 44: 981–988.
Wood, D.W., Setubal, J.C., Kaul, R., Monks, D.E., Kitajima,
J.P., Okura, V.K., et al. (2001) The genome of the natural
genetic engineer Agrobacterium tumefaciens C58. Science
294: 2317–2323.
Yang, H., Sasarman, A., Inokuchi, H., and Adler, J. (1996)
Non-iron porphyrins cause tumbling to blue light by an
Escherichia coli mutant defective in hemG. Proc Natl Acad
Sci USA 93: 2459–2463.
Yoshihara, S., and Ikeuchi, M. (2004) Phototactic motility in
the unicellular cyanobacterium Synechocystis sp. PCC
6803. Photochem Photobiol Sci 3: 512–518.
Zambre, M., Terryn, N., De Clercq, J., De Buck, S., Dillen, W.,
Van Montagu, M., et al. (2003) Light strongly promotes
gene transfer from Agrobacterium tumefaciens to plant
cells. Planta 216: 580–586.
© 2008 The Authors
Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 2020–2029