Download Plant Cell and Environment

Plant, Cell and Environment (2001) 24, 557–563
Expression of pH-sensitive green fluorescent protein in
Arabidopsis thaliana
N. MOSEYKO & L. J. FELDMAN
Department of Plant and Microbial Biology, University of California at Berkeley, 111 Koshland Hall, Berkeley,
CA 94720–3102, USA
ABSTRACT
This is the first report on using green fluorescent protein
(GFP) as a pH reporter in plants. Proton fluxes and pH
regulation play important roles in plant cellular activity and
therefore, it would be extremely helpful to have a plant
gene reporter system for rapid, non-invasive visualization
of intracellular pH changes. In order to develop such a
system, we constructed three vectors for transient and
stable transformation of plant cells with a pH-sensitive
derivative of green fluorescent protein. Using these vectors,
transgenic Arabidopsis thaliana and tobacco plants were
produced. Here the application of pH-sensitive GFP technology in plants is described and, for the first time, the visualization of pH gradients between different developmental
compartments in intact whole-root tissues of A. thaliana is
reported. The utility of pH-sensitive GFP in revealing
rapid, environmentally induced changes in cytoplasmic pH
in roots is also demonstrated.
Key-words: fluorescence ratio imaging; green fluorescent
protein (GFP); pH; proton fluxes.
INTRODUCTION
Maintaining cytoplasmic pH (pHc) within a physiological
range and its regulation are very important for protein
stability, enzyme and ion channel activity, and many other
processes required for cell growth or survival (Busa &
Nuccitelli 1984; Putnam 1998). Moreover, in plants the
proton pumps are the primary electrogenic force for the
generation of ion gradients (Sze 1985; Briskin & Hanson
1992). Growing evidence suggests the involvement of pH
changes in cell signalling, either directly or in concert with
plant hormones, calcium and other ions (Felle 1989;
Zimmermann et al. 1999). Thus, it would be helpful to have
a plant pH-sensitive reporter gene system for non-invasive
monitoring of intra- and extra-cellular pH dynamics. Such
a system would have many advantages over conventional
pH-sensitive fluorescent dyes, such as 2¢,7¢-bis-(2carboxyethyl)-5-(and-6)-carboxyfluorescein (BCECF) or
Correspondence: Dr N. Moseyko. Fax: + 1 510 6424995; e-mail:
[email protected]
© 2001 Blackwell Science Ltd
seminaphthorhodafluor (SNARF), in terms of loading,
effects on cellular processes, targeting to different compartments and organelles, and time-lapse studies. Due to
the presence of a cell wall and rapid compartmentalization
of fluorescent dyes, plant cells are notoriously difficult to
load and handle in quantitative imaging (Fricker et al.
1999). It has recently been demonstrated that several
mutant green fluorescent proteins (GFPs) can be used as
non-invasive intra- and extracellular pH sensors (Kneen,
Farinas & Verkman 1998; Llopis et al. 1998; Miesenbock,
Angelis & Rothman 1998). In particular, a pH-sensitive
GFP derivative, ‘ratiometric pHluorin’, exhibits a reversible
excitation ratio between pH 5·5 and 7·5, which makes it
especially useful for ratio imaging in this pH range
(Miesenbock et al. 1998). However, there were potential
problems in the application of pHluorins for monitoring pH
changes in plants: a wild-type Aequorea victoria gfp cDNA
was used as a template for polymerase chain reaction
(PCR) mutagenesis and development of pHluorins.
Attempts at stable expression of the wild-type GFP in
transgenic plants were unsuccessful until codon usage was
optimized and the site of aberrant splicing was removed
(Haseloff et al. 1997).
Therefore, we modified the ratiometric pHluorin gene
and expressed it in Arabidopsis thaliana and tobacco plants.
MATERIALS AND METHODS
Gene construction
Because the pHluorin gene contains all ‘pH-sensitive’
mutations downstream of the AGGTATTG sequence,
the 5¢ site of aberrant splicing in plants (Haseloff et al.
1997), we reasoned that exchanging the 5¢ portion of the
gene (which contains the 5¢ splice site) with the corresponding part from the plant-modified smGFP gene (Davis
& Vierstra 1998), would prevent aberrant splicing of the
pHluorin premRNA. In addition, it would introduce the
F99S mutation for increased protein solubility (Davis &
Vierstra 1998). To replace the 5¢ part of the pHluorin
gene, the smGFP gene was cloned into the pBluescript
II KS + and the ClaI–SacI fragment of the smGFP was
exchanged with the corresponding fragment from the pHluorin (Fig. 1a). The smGFP gene was excised from the
plasmid psmGFP (obtained from the Arabidopsis Biologi557
558 N. Moseyko & L. J. Feldman
(a)
(b)
absence of any undesirable PCR-introduced nucleotide
misincorporations was verified after sequencing of both
strands of the resulting phGFP gene. The phGFP gene was
then expressed in Escherichia coli under the control of the
lac promoter, and phGFP spectral properties were found to
be identical to that of the ratiometric pHluorin (in particular, 395 and 475 nm excitation wavelengths, 510 nm emission wavelength, and 427 nm isoexcitation point).
Plasmid construction for transient expression
(c)
(d)
In order to transiently express phGFP in plant cells, the
phGFP gene was placed under the control of the CaMV
35S promoter (Odell, Nagy & Chua 1985) by substituting
the smGFP gene sequence between the BamHI and
SacI sites in the psmGFP with the corresponding phGFP
sequence. The plasmid obtained, pHGFP-TR, was used for
particle bombardment transformation of A. thaliana and
Nicotiana benthamiana plants.
Binary vector construction for stable
transformation
Figure 1. DNA constructs for expression of the pH-sensitive
GFP in plants. (a) phGFP gene. Contains the BamHI–ClaI gene
sequence (including F99S mutation) from smGFP (Davis &
Vierstra 1998) and the ClaI – Sac I DNA fragment with ‘pHsensitive’ mutations (E132D, S147E, N149L, I161T, N164I,
K166Q, I167V, S202H) corresponding to the ratiometric
pHluorin gene sequence (Miesenbock et al. 1998). (b) pHGFPTR plasmid vector for transient expression of phGFP in plant
cells. CaMV35S, the promoter of the cauliflower mosaic virus 35S
RNA; pAnos, nopaline synthase gene transcription terminator.
(c) pHGFP-35S binary vector for stable transformation of plants
with phGFP. RB and LB, right and left T-DNA borders,
respectively; nptII, neomycin phosphotransferase gene containing
the promoter and transcription terminator of the nopaline
synthase gene. (d) pHGFP-SP plant binary vector for stable
expression of phGFP under the control of the chimeric
(ocs)3mas promoter.
cal Resource Center, Columbus, OH, USA) using BamHI
and SacI restriction endonucleases (Promega, Madison,WI,
USA) and cloned into the pBluescriptII KS + (Stratagene,
La Jolla, CA, USA). A ClaI–SacI DNA fragment of the
smGFP was exchanged with the corresponding fragment
from the ratiometric pHluorin gene (kindly made available
to us from Dr James E. Rothman of The Memorial SloanKettering Cancer Center, New York, USA). To facilitate the
replacement of the above fragment in the smGFP gene,
ClaI and SacI recognition sites were introduced into the
corresponding DNA fragment of the pHluorin gene using
PCR with Thermococcus litoralis Vent DNA polymerase
(New England Biolabs, Beverly, MA, USA) and two
mutagenic oligonucleotides, GGTATCGATTTTAAAGA
TGATGGAAAC and GGGAGCTCTTATTTGTATAG
TTCATCCATGC. (Sequences complementary to the ClaI
and SacI restriction endonuclease sites are underlined).The
Two binary plasmid vectors, pHGFP-35S and pHGFP-SP,
were constructed for stable plant transformation with the
phGFP gene under the control of the CaMV35S and the
chimeric (ocs)3mas (Ni et al. 1995) promoters, respectively.
Plasmid pHGFP-35S was obtained by subcloning the
phGFP into the plasmid pBI121 (Clontech, Palo Alto, CA,
USA) between BamHI and SacI restriction endonuclease
sites, and the pHGFP-SP was obtained after replacing the
uidA gene sequence with the phGFP between XbaI and
SacI sites in the pBISN1 (obtained from Dr Stanton B.
Gelvin of the Purdue University, West Lafayette, IN, USA).
Plant transformation
Transient bombardment-mediated transformations of
A. thaliana and N. benthamiana tissues were carried out
with pHGFP-TR DNA using the protocol of Seki et al.
(1991).
Transgenic A. thaliana (Columbia and Wassilevskija
ecotypes) and tobacco N. benthamiana plants were produced using Agrobacterium-mediated transformation.
Strain GV3101 of Agrobacterium tumefaciens was transformed with either pHGFP-35S or pHGFP-SP, and used for
in planta transformation of A. thaliana as described by
Clough & Bent (1998), as well as for in vitro transformation of N. benthamiana leaf discs as described by Horsch
et al. (1985). Transgenic plants were screened for antibiotic
resistance on selective growth media supplied with
kanamycin, and, later, for phGFP expression using a Zeiss
Axiophot fluorescence microscope (Carl Zeiss,Thornwood,
NY, USA) equipped with a Plan-Neofluar 10¥ dry objective, N.A. 0·3 (Zeiss), and a Chroma Technology GFP filter
set (exciter HQ450/50, dichroic mirror Q480LP, emitter
HQ510/50; Chroma Technology Corp., Brattleboro, VT,
USA).
© 2001 Blackwell Science Ltd, Plant, Cell and Environment, 24, 557–563
pH-sensitive GFP in plants 559
Cell imaging
Subcellular localization of phGFP in transformed plant
cells was examined using a Zeiss confocal laser scanning
microscope LSM 510 equipped with a krypton-argon laser,
and a Plan-Neofluar 40¥, N.A. 1·3, oil objective.
For ratio imaging experiments, 5- to 21-day-old seedlings
of transgenic plants were monitored on a Nikon FN600
microscope (Nikon, Melville, NY, USA) fitted with Plan
Fluor 10¥, 0·30 N.A., 40¥, 0·75 N.A., Super Fluor 10¥, 0·50
N.A., 40¥, 0·90 N.A. dry objectives, and a Chroma Technology pHluorin filter set (exciters D410/30 and D470/20,
dichroic mirror 500DCXR, emitter HQ535/50). Image
acquisition and processing were carried out using a Hamamatsu Orca-100 cooled CCD camera (Hamamatsu Corp.,
Bridgewater, NJ, USA) and MetaFluor 4·0 image analysis
software (Universal Imaging Corp., West Chester, PA,
USA). In some experiments a camera binning of 2 or 4 was
used to improve signal-to-noise ratio and to minimize photobleaching. Pixel by pixel ratio of intensities at 410 nm and
470 nm was calculated after background subtraction, and
was used to calibrate pHc. The pH titrations were performed in situ at the end of each experiment, using media
containing 0·5¥ Murashige and Skoog basal salt mix (MS)
salts, 0·005% digitonin, 50 mM HEPES or 50 mM 2-(NMorpholino)ethanesulfonic acid (MES), adjusted to a pH
of between 5 and 8.
RESULTS AND DISCUSSION
Expression of phGFP in plants
In order to develop a plant pH-sensitive gene reporter
system we modified the ratiometric pHluorin gene as
described in the ‘Gene construction’ section of the Materials and Methods. For transient expression of the modified gene, phGFP, in plant cells, the phGFP gene was placed
under the control of the strong constitutive plant promoter
CaMV35S (Fig. 1b). The resulting plasmid, pHGFP-TR, was
used for bombardment-mediated transformation of leaf
and root cells of A. thaliana and tobacco plants. The phGFP
was detectable after 8–24 h, and, using laser confocal scanning microscopy, was found to be distributed throughout
the cytoplasm (Fig. 4a). As expected for cytoplasmically
expressed GFP, it apparently could penetrate the nuclear
membrane and accumulated within the nucleoplasm.
For stable expression of ratiometric pH-sensitive GFP in
plants we constructed two binary plasmid vectors, pHGFP35S and pHGFP-SP (Fig. 1c & d, respectively).The pHGFP35S vector was constructed by cloning the phGFP gene into
the pBI121 under the control of the CaMV35S promoter.
To maximize the fluorescent signal for ratio imaging of pHc
we also constructed the plasmid pHGFP-SP containing the
phGFP gene under the control of the chimeric (ocs)3mas
promoter (Ni et al. 1995). To our knowledge, the (ocs)3mas
promoter is the strongest available promoter for expression
of foreign genes in plants (Ni et al. 1995).
Transgenic A. thaliana and N. benthamiana plants
expressing ratiometric pH-sensitive GFP were produced
© 2001 Blackwell Science Ltd, Plant, Cell and Environment, 24, 557–563
using an agrobacterial transformation with pHGFP-35S and
pHGFP-SP binary vectors. Transgenic lines that expressed
phGFP at sufficient levels were selected for further ratio
imaging experiments. On average, the plants transformed
with the phGFP gene under the control of the chimeric
(ocs)3mas promoter show brighter fluorescence in comparison with plants transformed with this gene under the
control of the CaMV35S (data not shown). As a rule, fluorescence is readily detectable in roots and hypocotyls, and
to a lesser extent in other tissues such as leaves and stems.
Monitoring intracellular pH changes
using phGFP
It should be noted that although ratio ion imaging
measurements are considered to be much more accurate in
comparison with single-wavelength, non-ratiometric
measurements, nonetheless, they also suffer from a number
of optical artifacts. In our system, some of the optical artifacts originated from using wide-field fluorescence
microscopy, from subcellular localization, and from different expression levels of phGFP in a particular cell type or
whole plant tissue. On the other hand, relative pHc changes
in response to various environmental and internal factors
can be readily and reliably detected.
As wide-field (not confocal) fluorescence microscopy
was used the 410 nm/470 nm ratio could significantly
change depending on the microscope objectives used, depth
of field, camera binning and phGFP expression level. Thus,
in vitro calibration could give erroneous data and so calibration was routinely performed in situ at the end of
an experiment. We found in our experimental system that
a commonly used method of in situ pHc calibration with
nigericin, a proton ionophore, severely damaged the cells
and led to increased background fluorescence at 410 nm
(data not shown). To calibrate pHc, we applied appropriate
buffers with pH between 5 and 8, and containing 0·005%
digitonin (as described by Kneen et al. 1998). Digitonin was
used to permeabilize the plasma membrane, and to equilibrate the pH of the external calibration buffers and pHc.
Digitonin appeared to be less toxic to cells compared to
nigericin and did not inhibit cytoplasmic streaming. Figure 2
shows a typical calibration curve. phGFP has a reversible
410 nm/470 nm excitation ratio and optimal dynamic range
for pH measurements between pH 5·5 and 7·5.
Next, we examined responsiveness of phGFP to intracellular pH changes using treatment of transgenic plants
with weak membrane-permeable acids and bases. Treatment of Arabidopsis thaliana roots with 20 mM propionic
or butyric acid caused rapid acidification of the cytoplasm,
resulting in a 0·3–0·5 pH units downshift from pH 7·2 within
15–20 min of beginning an experiment (Fig. 3a). On the
other hand, treatment with 10 mM trimethylamine or
ammonium chloride, which are weak membrane-permeable
bases, leads to alkalization of the cytoplasm, increasing the
pH between 0·5 and 1 units within a 60 min time frame
(Fig. 3a). It was concluded that phGFP reliably reflected
cytoplasmic pH changes.
560 N. Moseyko & L. J. Feldman
We also investigated cytoplasmic pH changes in response
to low extracellular pH and aluminium. Aluminium toxicity is one the most important limitation factors for plant
growth on acidic soils (Horst 1995). It has been recently
demonstrated that low external pH decreases cytoplasmic
pH in Arabidopsis roots; the roots respond to low external
pH by a sustained elevation in [Ca2+]c; and aluminium ions
inhibit this elevation in [Ca2+]c, preventing any potential
calcium-mediated protection against low pH (Plieth et al.
1999). To mimic root growth conditions on very acidic soils,
the pH of the growth media was adjusted to 3·8 with
hydrochloric acid. Proton pumps of epidermal root cells of
A. thaliana apparently are not able to buffer such a pH drop
of the external growth media, and cytoplasmic pH downshifts 0·5–0·8 pH units within 60 min of an experiment
(Fig. 3b). The addition of 3 mM aluminium chloride had an
additive effect on cytoplasmic pH; when mixed with the
growth media, it caused an additional 0·1–0·2 pH unit drop
in cytoplasmic pH in comparison with hydrochloric acid
alone (Fig. 3b). The mechanism of aluminium-induced cytoplasmic acidification is not known. A possible explanation
is that aluminium ions inhibit plasma membrane H+ATPases at low extracellular pH via inhibition of calciummediated signalling. The observed additive effect of
aluminium ions on cytoplasmic acidification at low extracellular pH deserves further investigation.
1·2
410/470 ratio
1·0
0·8
0·6
0·4
0·2
0·0
5·0
5·5
6·0
6·5
pH
7·0
7·5
8·0
Figure 2. Standard calibration curve. Calibration was
performed in situ at the end of an experiment using appropriate
buffers with pH between 5 and 8, and containing 0·005%
digitonin. Epidermal root cells of Arabidopsis thaliana were
used.
In order to demonstrate the suitability of phGFP for
monitoring intracellular pH changes in response to various
physiological stimuli, Arabidopsis roots were challenged
with 10 mM fusicoccin, a fungal phytotoxin produced by
Fusicoccum amygdali, which is known to stimulate plasma
membrane H+-ATPase of higher plants (Marré 1979). Fusicoccin treatment caused cytoplasm acidification in epidermal
cells of the root elongation zone, with the most pronounced
change, 0·1–0·3 pH units, occurring within the first 15 min
(Fig. 3b). The observed cytoplasm acidification in response
to fusicoccin was consistent with earlier data obtained on
Zea mays cells using pH-sensitive microelectrodes and fluorescent dyes (Brummer et al. 1985; Felle et al. 1986).
9·0
(a)
8·5
8·5
8·0
8·0
7·5
7·5
pH
pH
9·0
7·0
An obvious advantage of the application of pH-sensitive
GFP in plants is that it allows one to visualize pHc changes
in many cells and even whole plant tissues simultaneously.
Figure 4c shows the pHc pattern in an intact A. thaliana root
tip. In this transgenic line phGFP is relatively uniformly
expressed throughout the whole root (Fig. 4b). Therefore,
optical artifacts due to uneven pH sensor distribution
should be minimal (except the edges of the root where the
(b)
7·0
6·5
6·5
6·0
6·0
5·5
5·5
5·0
phGFP reports the existence of pH gradients
between different developmental regions in
roots of Arabidopsis thaliana
5·0
0
15 30 45
Time (min)
60
0
15 30 45
Time (min)
60
Figure 3. Monitoring cytoplasmic pH
changes in epidermal cells of the root
elongation zone of Arabidopsis thaliana
using phGFP. (a) Cells were challenged with
weak membrane-permeable acid and base,
20 mM propionic acid, pH adjusted to 5·0
using 0·1 M KOH (——), and 10 mM
NH4Cl pH adjusted to 9 using 0·1 HCl
(——). (b) pHc changes following
treatment of Arabidopsis roots with (i)
10 mM fusicoccin (——); (ii) hydrochloric
acid, pH adjusted to 3·8 using 0·1 M KOH
(——); (iii) 3 mM aluminium and
hydrochloric acid, pH adjusted to 3·8 using
0·1 M KOH (——). Data are averages of
five independent experiments ± SE
(standard error).
© 2001 Blackwell Science Ltd, Plant, Cell and Environment, 24, 557–563
pH-sensitive GFP in plants 561
(a)
(d)
(e)
(b)
(f)
(c)
(g)
edge-artifacts are clearly pronounced; Fig. 4c). Ratio
imaging of the pHc using pH-sensitive GFP revealed the
existence of a distinct pHc gradient between root tip cells.
As the developmental activities of roots are separated
into distinct regions or zones (e.g. the terminal root cap
where gravity is sensed; a region predominantly of mitosis;
and a region predominantly of cell elongation), roots have
recently attracted considerable attention (Evans &
Ishikawa 1997; Van Den Berg et al. 1997; Blancaflor, Fasano
& Gilroy 1998; Scott & Allen 1999). Here we demonstrate
for the first time a gradient in pHc between the various
developmental compartments of the root. This gradient
is present in at least 50% of vertically growing transgenic
Arabidopsis roots. Although the root cap cells have acidified cytoplasm (pH 6·5–7·0; Fig. 4c), cells of the distal elongation zone are characterized by relatively alkaline pHc
© 2001 Blackwell Science Ltd, Plant, Cell and Environment, 24, 557–563
Figure 4. Visualizing pHc in an intact
Arabidopsis thaliana root using ratiometric
pH-sensitive GFP. (a) Transient expression
of phGFP in a root epidermal cell. The
image was acquired using a Zeiss confocal
laser scanning microscope LSM 510 at
488 nm excitation and 525 nm emission
wavelengths. phGFP accumulates in the
peripheral cytoplasm regions close to the
plasma membrane and within the
nucleoplasm (except nucleolus). (b–g)
Stable transformation: (b) image of the
root tip was acquired at 470 nm
wavelength using conventional wide-field
fluorescence microscopy; (c) calibrated
410 nm/470 nm ratio image of the same
root tip. phGFP shows the existence of pH
gradients between different developmental
regions: root cap cells have acidified
cytoplasm (pH 6·5–7·0), cells of the distal
elongation zone have relatively alkaline
pHc (7·3–7·6), and meristem cells have
intermediate pHc (7–7·3); (d–g) images of
the root tip with non-uniform phGFP
expression patterns; (d, e) strong
fluorescence in the mature and elongation
zone of the root, weak fluorescence in the
root tip; (f, g) strong fluorescence in the
root tip, weak fluorescence in the rest of
the root.
(7·3–7·6), and cells of the root meristem have intermediate
pHc (7–7·3). The observed pH gradient is consistent with
electrophysiological data obtained earlier on corn roots
(Mulkey & Evans 1981; Pilet 1991). In growing maize roots,
proton efflux occurs in the elongation zone and proton
influx occurs at the root cap and meristem. These proton
fluxes correspond to cytoplasmic alkalization of cells of the
elongation zone, and acidification of cells of the cap and
meristem. Interestingly, growing pollen tubes possess a
constitutive alkaline band in the clear zone and a growthdependent acidic tip (Feijo et al. 1999). It seems plausible
that intracellular pH and proton fluxes might play similar
roles in the growth of single plant cells such as pollen and
multicellular organs such as roots.
As optical artifacts due to non-uniform phGFP expression patterns might affect the accuracy of pH measure-
562 N. Moseyko & L. J. Feldman
ments, we also examined the pH gradients in transgenic
Arabidopsis plants with strong fluorescence in the elongation zone and weak fluorescence in the root tip (Fig. 4d &
e), and these results were compared with plants with the
opposite phGFP expression pattern (Fig. 4f & g) (weak fluorescence in the root tip and strong fluorescence in the elongation zone). Even though the phGFP expression patterns
differed in these two roots – the pH patterns (acidified root
tip) were the same. Therefore, the observed pH gradients in
Arabidopsis roots cannot be explained by optical artifacts
due to uneven pH sensor distribution. A role for pH gradients in root growth and development remains to be elucidated. By documenting pH gradients we are provided with
another tool for investigating the distinct regional developmental events in roots.
In summary, we have demonstrated that phGFP: (a)
was expressed at a high level, sufficient for ratio imaging
in A. thaliana and tobacco plants; (b) was suitable for
cytoplasmic pH measurements in plants; (c) showed an
additive effect of aluminium ions on cytoplasmic acidification at low extracellular pH; (d) could be applied for noninvasive monitoring of pHc dynamics in individual plant
cells as well as in whole plant tissues; and (e) showed
for the first time the existence of significant pH gradients
between different developmental regions in roots of A.
thaliana.
ACKNOWLEDGMENTS
We thank Dr James E. Rothman of The Memorial SloanKettering Cancer Center, New York, for the generous gift
of the plasmid pGEX-2T containing a gene sequence of the
ratiometric pHluorin. We also thank the Arabidopsis Biological Resource Center, Columbus, OH, for the plasmid
psmGFP containing the smGFP gene. This work was
supported by grants from the NASA (98-HEDS-02) and
Novartis Agricultural Discovery Institute, Inc.
REFERENCES
Blancaflor E.B., Fasano J.M. & Gilroy S. (1998) Mapping the
functional roles of cap cells in the response of Arabidopsis
primary roots to gravity. Plant Physiology 115, 213–222.
Briskin D.P. & Hanson J.B. (1992) How does the plant plasma
membrane hydrogen-ATPase pump protons? Journal of Experimental Botany 43, 269–289.
Brummer B., Bertl A., Potrykus I., Felle H. & Parish R.W.
(1985) Evidence that fusicoccin and indole-3-acetic acid induce
cytosolic acidification of Zea mays cells. FEBS Letters 189,
109–113.
Busa W.B. & Nuccitelli R. (1984) Metabolic regulation via
intracellular pH. American Journal of Physiology 246,
409–438.
Clough S.J. & Bent A.F. (1998) Floral dip: a simplified method
for Agrobacterium-mediated transformation of Arabidopsis
thaliana. Plant Journal 16, 735–743.
Davis S.J. & Vierstra R.D. (1998) Soluble, highly fluorescent
variants of green fluorescent protein (GFP) for use in higher
plants. Plant Molecular Biology 36, 521–528.
Evans M.L. & Ishikawa H. (1997) Cellular specificity of the
gravitropic motor response in roots. Planta 203, S115–S122.
Feijo J.A., Sainhas J., Hackett G.R., Kunkel J.G. & Hepler P.K.
(1999) Growing pollen tubes possess a constitutive alkaline band
in the clear zone and a growth-dependent acidic tip. Journal of
Cell Biology 144, 483–496.
Felle H. (1989) pH as a second messenger in plants. In Messengers
in Plant Growth and Development (eds W.F. Boss & D.J. Morre),
pp. 145–166. Liss, New York.
Felle H., Brummer B., Bertl A. & Parish R.W. (1986) Indole-3acetic acid and fusicoccin cause cytosolic acidification of corn
coleoptile cells. Proceedings of the National Academy of Sciences
USA 83, 8992–8995.
Fricker M.D., Plieth C., Knight H., Blancaflor E., Knight M.R.,
White N.S. & Gilroy S. (1999) Fluorescence and luminescence
techniques to probe ion activities in living plant cells. In
Fluorescent and Luminescent Probes for Biological Activity
(ed. W.T. Mason), pp. 569–596. Academic Press, San Diego,
CA.
Haseloff J., Siemering K.R., Prasher D. & Hodge S. (1997) Removal
of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants
brightly. Proceedings of the National Academy of Sciences USA
94, 2122–2127.
Horsch R.B., Fry J.E., Hoffmann N.L., Eichholtz D., Rogers S.G. &
Fraley R.T. (1985) A simple and general method for transferring
genes into plants. Science 227, 1229–1231.
Horst W.J. (1995) The role of the apoplast in aluminium toxicity
and resistance of higher plants: a review. Zeitschrift Fuer
Pflanzenernaehrung und Bodenkunde 158, 419–428.
Kneen M., Farinas J., Li Y. & Verkman A.S. (1998) Green
fluorescent protein as a noninvasive intracellular pH indicator.
Biophysical Journal 74, 1591–1599.
Llopis J., McCaffery M., Miyawaki A., Farquhar M.G. & Tsien
R.Y. (1998) Measurement of cytosolic, mitochondrial, and
Golgi pH in single living cells with green fluorescent proteins.
Proceedings of the National Academy of Sciences USA 95,
6803–6808.
Marré E. (1979) Fusicoccin: a tool in plant physiology. Annual
Review of Plant Physiology 30, 273–288.
Miesenbock G., Angelis D.A.D. & Rothman J.E. (1998) Visualizing
secretion and synaptic transmission with pH-sensitive green
fluorescent proteins. Nature 394, 192–195.
Mulkey T.G. & Evans M.L. (1981) Geotropism in corn roots:
Evidence for its mediation by differential acid efflux. Science
212, 70–71.
Ni M., Cui D., Einstein J., Narasimhulu S., Vergara C.E. & Gelvin
S.B. (1995) Strength and tissue specificity of chimeric promoters
derived from the octopine and mannopine synthase genes. Plant
Journal 7, 661–676.
Odell J.T., Nagy F. & Chua N.H. (1985) Identification of DNA
sequences required for activity of the cauliflower mosaic virus
35S promoter. Nature 313, 810–812.
Pilet P.E. (1991) Root growth and gravireaction. Implications of
hormones and other regulators. In Plant Roots. The Hidden Half
(eds Y. Waisel, A. Eshel & U. Kafkafi), pp. 179–204. Dekker, New
York.
Plieth C., Sattelmacher B., Hansen U.-P. & Knight M.R. (1999)
Low-pH-mediated elevations in cytosolic calcium are inhibited
by aluminium: a potential mechanism for aluminium toxicity.
Plant Journal 18, 643–650.
Putnam R. (1998) Intracellular pH regulation. In Cell Physiology
Source Book (ed. N. Sperelakis), pp. 293–305. Academic Press,
San Diego, CA.
Seki M., Komeda Y., Iida A., Yamada Y. & Morikawa H. (1991)
Transient expression of beta-glucuronidase in Arabidopsis
© 2001 Blackwell Science Ltd, Plant, Cell and Environment, 24, 557–563
pH-sensitive GFP in plants 563
thaliana leaves and roots and Brassica napus stems using a pneumatic particle gun. Plant Molecular Biology 17, 259–263.
Scott A.C. & Allen N.S. (1999) Changes in cytosolic pH within
Arabidopsis root columella cells play a key role in the early
signaling pathway for root gravitropism. Plant Physiology 121,
1291–1298.
Sze H. (1985) Proton-translocating ATPase advances using
membrane vesicles. Annual Review of Plant Physiology 36,
175–208.
© 2001 Blackwell Science Ltd, Plant, Cell and Environment, 24, 557–563
Van Den Berg C., Willemsen V., Hendriks G., Weisbeek P. &
Scheres B. (1997) Short-range control of cell differentiation in
the Arabidopsis root meristem. Nature 390, 287–289.
Zimmermann S., Ehrhardt T., Plesch G. & Mueller-Roeber B.
(1999) Ion channels in plant signaling. Cellular and Molecular
Life Sciences 55, 183–203.
Received 2 November 2000; received in revised form 24 January
2001; accepted for publication 24 January 2001