Download Factor-1-Deficient Mice IL-15-Deficient and IFN Regulatory 3 Cells

This information is current as
of June 14, 2017.
Developmental and Functional Defects of
Thymic and Epidermal V γ3 Cells in
IL-15-Deficient and IFN Regulatory
Factor-1-Deficient Mice
An De Creus, Katrien Van Beneden, Frederik Stevenaert,
Veronique Debacker, Jean Plum and Georges Leclercq
J Immunol 2002; 168:6486-6493; ;
doi: 10.4049/jimmunol.168.12.6486
http://www.jimmunol.org/content/168/12/6486
Subscription
Permissions
Email Alerts
This article cites 63 articles, 43 of which you can access for free at:
http://www.jimmunol.org/content/168/12/6486.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2002 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
References
The Journal of Immunology
Developmental and Functional Defects of Thymic and
Epidermal V␥3 Cells in IL-15-Deficient and IFN Regulatory
Factor-1-Deficient Mice1
An De Creus, Katrien Van Beneden, Frederik Stevenaert, Veronique Debacker, Jean Plum, and
Georges Leclercq2
T
hymocyte development in the murine thymus starts at
days 11–12 of fetal development with the influx of precursor cells. The first wave of cells in thymic ontogeny is
unique in that they express an invariant ␥␦ TCR characterized by
a lack of junctional diversity. V␥3 cells are the first TCR-positive
cells that can be found in the fetal thymus around gestation days
14 –16 (1–3). At a later time point, other TCR ␥␦ and TCR ␣␤
thymocytes appear. In adult mice, TCR V␥3 cells are detected only
in the epidermis (2). Due to their dendritic morphology, these cells
are called dendritic epidermal T cells (DETCs)3 and represent the
main T cell population in the epidermis of mice (4). It has been
shown that mature fetal V␥3 thymocytes are the precursors of
DETCs in the skin (5, 6).
Mice deficient in the common ␥-chain (␥c), which is shared by
the IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21 receptors, have a
marked impairment of B, T, and NK cell development (7). The
defect in T cell development seen in ␥c⫺/⫺ mice mainly reflects the
absence of IL-7R signaling, while the defect in NK cell develop-
Department of Clinical Chemistry, Microbiology, and Immunology, University of
Ghent, University Hospital, Ghent, Belgium
Received for publication December 7, 2001. Accepted for publication April 12, 2002.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by grants from the research fund of the University of
Ghent and the Fund for Scientific Research of Flanders (Belgium).
2
Address correspondence and reprint requests to Dr. Georges Leclercq, Department
of Clinical Chemistry, Microbiology, and Immunology, University of Ghent, University Hospital, B-9000 Ghent, Belgium. E-mail address: [email protected]
Abbreviations used in this paper: DETC, dendritic epidermal T cell; ␥c, common
␥-chain; HPRT, hypoxanthine phosphoribosyltransferase; EC, epidermal cell; FCA,
flow cytometric analysis; RAG, recombination-activating gene; FD, fetal day;
HSA, heat-stable Ag; IRF-1, IFN regulatory factor-1; rhu, recombinant human;
WT, wild type.
3
Copyright © 2002 by The American Association of Immunologists, Inc.
ment seen in these mice is due to the absence of IL-15R signaling.
IL-7⫺/⫺ and IL-7R⫺/⫺ mice have major defects in T cell development, but NK cell development is not compromised (8, 9). IL-7
and IL-7R play a critical role in lymphopoiesis by inducing survival and proliferation of progenitor T lymphocytes (10). Studies
in IL-15⫺/⫺ mice and IL-15R␣⫺/⫺ mice have confirmed a critical
role for IL-15 in regulating the development and/or expansion of
NK cells, NK-T cells, and distinct intestinal intraepithelial lymphocyte populations (11, 12). In addition, these studies have revealed a role for IL-15 in the maintenance of the memory CD8⫹
T cell population in the periphery (11). The finding that IL-15⫺/⫺
and IL-15R␣⫺/⫺ mice are lymphopenic suggests that IL-15 may
also support adaptive CD4⫹ and CD8⫹ T cells. Whether IL-15
regulates adaptive lymphocyte differentiation remains to be elucidated (11, 12).
Some cytokines have also been demonstrated to affect the
growth and differentiation of ␥␦ T cells. ␥␦ T cells derived from
the fetal thymus and from adult skin, spleen, or peritoneal cavity
can proliferate in vitro in response to IL-2, IL-7, or IL-15 (13–19).
␥c⫺/⫺ mice have confirmed these findings, as these mice have
defects in ␥␦ T cell development. ␥c⫺/⫺ mice have severely reduced numbers of immature fetal V␥3 cells and lack mature fetal
thymic V␥3 cells. V␥3 DETCs are absent from the skin epidermis
of ␥c⫺/⫺ mice (20). In IL-7R⫺/⫺ and IL-7⫺/⫺ mice, maturation of
V␥3 cells in the fetal thymus is inhibited and no V␥3 DETCs are
detected in the skin, showing the importance of IL-7 in the development and/or survival of V␥3 cells or their precursors (8, 21). In
addition, several other studies have suggested a role for IL-15 and
IL-2 in the development of V␥3 cells (18, 22, 23). Both cytokines
interact with receptor complexes that contain the ␥c, the IL-2R␤
chain, and a specific IL-2R or IL-15R ␣-chain (22, 23). Mature
fetal V␥3 thymocytes and V␥3 DETCs are known to express the
IL-2R␤ chain (14). IL-2R␤-deficient mice show a moderate
0022-1767/02/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
In this study, the role of IL-15 and its regulation by the transcription factor IFN regulatory factor-1 (IRF-1) in murine V␥3 T cell
development and activity is assessed. Compared with wild-type (WT) mice, reduced numbers of mature V␥3 cells were found in
the fetal thymus of IL-15ⴚ/ⴚ mice, while IRF-1ⴚ/ⴚ mice displayed normal frequencies. V␥3ⴙ dendritic epidermal T cells (DETCs)
were absent in IL-15ⴚ/ⴚ mice but present in IRF-1ⴚ/ⴚ mice. DETCs from IRF-1ⴚ/ⴚ mice displayed morphologically a less mature
phenotype and showed different emergence kinetics during ontogeny. This corresponded with lower IL-15 mRNA levels in the skin
epidermis. Comparable levels of IL-7 were found in the skin of WT and IL-15ⴚ/ⴚ mice. Adoptive transfer experiments of WT fetal
thymocytes into IL-15ⴚ/ⴚ mice did not result in the development of V␥3ⴙ DETCs, confirming the nonredundant role of IL-15 in
the skin during DETC development. In vitro, cytolytic activity of IL-15ⴚ/ⴚ V␥3 cells was normal after stimulation with IL-15 and
was further enhanced by addition of IL-12. In contrast, cytolytic activity of IRF-1ⴚ/ⴚ V␥3 cells remained defective after stimulation with IL-15 in combination with IL-12. These data suggest that IL-15 is redundant for the development and/or survival of
mature V␥3 cells in the fetal thymus, whereas it is essential for the localization of V␥3 cells in the skin. Furthermore, a possible
role for IRF-1 in inducing morphological maturation of DETCs and cytolytic capacity of V␥3 cells is suggested. The Journal of
Immunology, 2002, 168: 6486 – 6493.
The Journal of Immunology
Materials and Methods
Mice
C57BL/6J wild-type (WT) mice were provided by Proefdierencentrum
(Catholic University Leuven, Leuven, Belgium). IRF-1⫺/⫺ mice (C57BL/6
background) (26) were kindly provided by Dr. P. Matthys (Catholic University Leuven). IL-15⫺/⫺ mice (C57BL/6 background) were kindly provided by Dr. J. Peschon (Immunex, Seattle, WA) (11). Recombinationactivating gene (RAG)-1⫺/⫺ mice (C57BL/6 background) were purchased
from Kankerinstituut (Amsterdam, The Netherlands) and C57BL/6JRagtm1/Mom mice were purchased from The Jackson Laboratory (Bar Harbor, ME). Mice were bred in our facility and housed in a specific pathogenfree environment. Mice were treated and used in agreement with
institutional guidelines.
Antibodies
Monoclonal Abs used for staining were anti-Fc␥RII/III (unconjugated, rat
IgG2b; kindly provided by Dr. J. Unkeless, Mount Sinai School of Medicine, New York, NY), anti-heat-stable Ag (HSA; biotin-conjugated, rat
IgG2b; BD PharMingen, San Diego, CA), anti-NK1.1 (PE-conjugated,
mouse IgG2a; BD PharMingen), anti-Thy1.2 (PE- and FITC-conjugated,
rat IgG2b; BD PharMingen), anti-IL-2R␤ (FITC-conjugated, rat IgG2b;
kindly provided by Dr. T. Tanaka, Tokyo, Japan), and anti-TCR V␥3
(FITC-conjugated, hamster hybridoma F536 (kindly provided by Dr. J. P.
Allison, University of California, Berkeley, CA) and PE-conjugated (BD
PharMingen)).
Epidermal sheets
Epidermal sheets were prepared as described previously (27). Epidermal
sheets were labeled with FITC-conjugated anti-Thy1.2 mAb or with FITCconjugated anti-V␥3 mAb at 4°C for 18 h. DETCs were counted with a
fluorescence microscope in a field that equaled 0.2 mm2. Ten mice were
used for each strain and for each specimen five random fields were counted.
Data are expressed as the mean (⫾ SD) number of positive cells per square
millimeter.
Preparation of cell suspensions
Epidermal cell (EC) suspension. Skin samples were freed of fatty tissue
and were floated dermal side down in a petri dish containing 0.3% trypsinPBS solution (Difco, Detroit, MI) at 4°C for 18 h. Epidermal sheets were
peeled from the underlying dermis. Epidermal skin samples were then
pooled in DMEM (Life Technologies, Paisley, U.K.) containing 0.25%
DNase (Boehringer Mannheim, Mannheim, Germany). Single cell suspensions were prepared as described before (27). Cells were counted with
trypan blue to exclude dead cells.
Thymic cell suspension from fetal day (FD)17 mice. Mice were mated
overnight. Thymuses from FD17 (plug date ⫽ day 0) WT IRF-1⫺/⫺ mice
and IL-15⫺/⫺ mice were removed and disrupted using a small potter homogenizer. Cells were counted with trypan blue to exclude dead cells.
Thymocytes were suspended in RPMI 1640 medium supplemented with
10% FCS, 100 U/ml penicillin, 100 ␮g/ml streptomycin, 0.03% glutamine,
and 5 ⫻ 10⫺5 M 2-ME (all from Life Technologies). This medium will be
further referred to as RPMI 1640 medium.
Semiquantitative RT-PCR for IL-12R and real-time PCR for
IL-15 and IL-7
TRIzol LS Reagent (Life Technologies) was added to the sorted cells or
total cell suspensions and RNA was extracted according to the manufacturer’s instructions. Before reverse transcription, digestion of DNA was
performed with DNase I (Life Technologies). cDNA was synthesized with
oligo(dT) as primer using the Superscript kit (Life Technologies). Primers used
for RT-PCR for murine hypoxanthine phosphoribosyltransferase (HPRT), a
housekeeping gene, were GTAATGATCAGTCAACGGGGGAC (sense) and
CCAGCAAGCTTGCAACCTTAACCA (antisense). For IL-12R␤2, primers
used were AAAGCCAACTGGAAAGCATTCG (sense) and AGTTTT
GAGTCAGGGTCTCTGC (antisense). Semiquantitative RT-PCR amplification was performed using a PTC-200 Peltier Thermal Cycler (MJ Research,
Biozym, Landgraaf, The Netherlands) for 35 cycles at 94°C for 30 s, 55°C for
30 s, and 72°C for 1 min (HPRT) or with 35 cycles at 94°C for 30 s, 60°C for
30 s, and 72°C for 1 min (IL-12R). For semiquantitative RT-PCR, three 3-fold
dilutions of each cDNA were amplified. H2O and genomic DNA were used as
negative controls (data not shown).
Amplification reactions for IL-15, IL-7, and HPRT mRNA were performed with the SYBR Green assay which contained 1⫻ SYBR PCR
buffer, 3 mM MgCl2, 0.2 mM dATP, 0.2 mM dCTP, 0.4 mM dUTP, 1.25 U
AmpliTaq Gold, and 0.5 U AmpErase UNG (all from PE Applied Biosystems,
Foster City, CA). Primers for murine IL-15 (AAAGCTTTATACGCATT
GTCCAAA T (sense) and CATGCAGTCAGGACGTGTTGAT (antisense)),
murine IL-7 (GGAATTCCTCCACTGATCCTTG (sense) and TTCCTGT
CATTTTGTCCAATTCA (antisense)), and HPRT (AATACGAGGAGTC
CTGTTGATGTTG (sense) and CATTCATAGAAGGTTCATGCAAAAAG
(antisense)) were designed with Primer Express 1.0 software (PE Applied
Biosystems) and used at 50 nM (IL-15) and 200 nM (IL-7, HPRT) concentrations. The PCR conditions were 95°C for 10 min followed by 40 cycles at
95°C for 15 s and 60°C for 1 min. Melting curves were generated after
amplification. Amplification reactions for GAPDH, a housekeeping gene,
were performed with the TaqMan assay kit for GAPDH amplification from
PE Applied Biosystems. Amplification was performed in 1⫻ TaqMan Universal PCR Master Mix (PE Applied Biosystems), using 100 nM of each
primer and 200 nM probe for rodent GAPDH. Data were collected using
the 5700 SDS thermal cycler (PE Applied Biosystems). Each sample was
tested in triplicate and all PCR runs were performed three times.
Cytokine culture
FD17 thymic cell suspensions were prepared and cultured in 24-well plates
(Falcon; BD Biosciences, Mountain View, CA) at 2 ⫻ 106 cells/well in 2
ml RPMI 1640 medium with a final concentration of 50 ng/ml recombinant
human (rhu)IL-15 (R&D Systems, Abingdon, U.K.). After culture for 4
days in 5% CO2 at 37°C, cells were harvested, washed, and counted with
trypan blue. Cells were sorted into V␥3⫹ and NK1.1⫹V␥3⫺ populations.
Sorted cells were cultured in 96-well plates (Falcon; BD Biosciences) at
1 ⫻ 105 cells/well in 200 ␮l RPMI 1640 medium for an additional 2 days,
with a final concentration of 50 ng/ml rhuIL-15 with or without 2 ng/ml
rIL-12 (PeproTech, Rocky Hill, NJ). After these additional 2 days of culture, the purity of the V␥3 and NK cells was ⬎99%.
FCA and sorting
To avoid aspecific binding, the Fc␥R was blocked by preincubating the
cells with saturating amounts of anti-Fc␥RII/III mAb. Freshly isolated
FD17 thymocytes were incubated with anti-HSA (biotin-conjugated), antiV␥3 (PE-conjugated), and anti-IL2R␤ (FITC-conjugated) at 4°C for 45
min. After washing, cells were incubated with streptavidin-allophycocyanin (BD Biosciences) at 4°C for 20 min. ECs were incubated with antiThy1.2 (PE-conjugated) mAb at 4°C for 45 min. Cells were analyzed for
fluorescence using a FACSCalibur (BD Biosciences) equipped with an
argon (488 nm) and helium (325 nm) laser with the CellQuest software
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
reduction of mature V␥3 cells in the fetal thymus. Small numbers
of V␥3 DETCs are detected in the fetal skin, but they are absent in
adult mice (17). Because V␥3 cells are present in normal numbers
in the fetal thymus and in the adult skin of IL-2⫺/⫺ mice (24),
IL-15 rather than IL-2 signaling through the IL-2R␤ chain seems
to be important for the development and/or the expansion of V␥3
cells and the maintenance of these cells in the skin.
Our aim was to determine whether intrathymic IL-15 is required
for the generation of fetal thymic V␥3 cells and whether peripheral
expression of IL-15 in the skin is necessary for the development
and/or survival of V␥3 DETCs. In addition, we wanted to determine whether the transcription factor IFN regulatory factor-1
(IRF-1) is required for the development of V␥3 cells in the fetal
thymus and in the skin epidermis. IRF-1 binds regions within the
promoter of type I IFNs and several IFN-inducible genes and is
responsible for the induction of IL-15 but not the constitutive expression of this gene. Mice that do not express the transcription
factor IRF-1 have been shown to exhibit a severe NK, NK-T, and
intestinal intraepithelial lymphocyte deficiency (25). To clarify the
role of IL-15 and IRF-1 in V␥3 T cell development, we studied the
development and function of these cells in IL-15⫺/⫺ mice and
IRF-1⫺/⫺ mice. Our results suggest a redundant role for IL-15
expression during V␥3 T cell development in the fetal thymus and
a nonredundant function for localization of V␥3 cells in the skin.
In addition, we show that the transcription factor IRF-1 is important for the morphological maturation of DETCs, probably by regulating IL-15 expression in the skin epidermis during ontogeny.
Furthermore, our data imply an important role for IRF-1 in regulating V␥3 T cell-mediated cytotoxicity.
6487
6488
V␥3 T CELL DEVELOPMENT AND MATURATION
program (BD Biosciences) for data acquisition and analysis. Propidium
iodide was added to the cells (2 ␮g/ml) just before flow cytometric analysis
(FCA). Gating was done on propidium iodide-negative cells to exclude
dead cells.
FD17 thymocytes from WT mice and IRF-1⫺/⫺ mice cultured for 4 days
in the presence of rhuIL-15 were incubated with anti-NK1.1 (PE-conjugated) and anti-V␥3 (FITC-conjugated) mAbs at 4°C for 45 min. V␥3⫹
cells and V␥3⫺NK1.1⫹ cells were sorted to a purity of ⬎99% using a
FACSVantage flow cytometer (BD Biosciences) equipped with an argon
laser.
In vivo injection of FD18 thymocytes
Freshly isolated FD18 thymocytes (107) from WT and IL-15⫺/⫺ mice were
i.v. injected into syngeneic RAG-1⫺/⫺ and/or IL-15⫺/⫺ mice. Six weeks
after injection, mice were analyzed for the presence of V␥3⫹ DETCs by
immunolabeling of epidermal sheets. Experiments were repeated three
times with three mice of each genotype per experiment.
Cytotoxic assay
Results
The cell number of mature V␥3 cells in the fetal thymus is
reduced in IL-15⫺/⫺ mice, whereas it is normal in
IRF-1⫺/⫺ mice
To examine the role of IL-15 in fetal V␥3 T cell development, we
analyzed FD17 thymocytes from IL-15⫺/⫺ mice. Fetal V␥3 thymocytes consist of immature HSAhigh and mature HSAlow cells
(28). Maturation of V␥3 thymocytes is also associated with the
expression of the IL-2/IL-15R␤ chain (14). The total cell number
of the fetal thymus of WT and IL-15⫺/⫺ mice was comparable
(data not shown). As shown in Fig. 1, a selective reduction of
mature HSAlow V␥3⫹ thymocytes in FD17 IL-15⫺/⫺ mice could
be observed, but all mature HSAlowV␥3⫹ thymocytes from IL15⫺/⫺ mice expressed the IL-2R␤ chain at normal levels. To examine whether regulation of IL-15 expression determines fetal
V␥3 T cell development, we examined FD17 thymocytes from
IRF-1⫺/⫺ mice. Others have shown that mice deficient for IRF-1
fail to up-regulate IL-15 expression after stimulation, but low basal
amounts of IL-15 can be detected (25). We found no reduction of
mature V␥3⫹ thymocytes in the fetal thymus of IRF-1⫺/⫺ mice
(Fig. 1). The total cell number of the fetal thymus of WT and
IRF-1⫺/⫺ mice was comparable (data not shown).
tected in the skin of adult (12 wk) IL-15⫺/⫺ mice by in situ immunofluorescent staining of epidermal sheets (Fig. 2B). To determine whether the transcription factor IRF-1 is important during
development of V␥3⫹ DETCs, we also examined epidermal sheets
of IRF-1⫺/⫺ mice. First, we determined whether IL-15 mRNA was
expressed in ECs of IRF-1⫺/⫺ mice. As expected, unstimulated
ECs expressed mRNA for IL-15 but, compared with WT mice, no
up-regulation was found after stimulation with LPS and IFN-␥
(data not shown). In contrast to IL-15⫺/⫺ mice, V␥3 cells could be
detected in normal numbers in epidermal sheets of adult IRF-1⫺/⫺
mice (Fig. 2C). However, IRF-1⫺/⫺ V␥3 DETCs differed from
WT cells in their morphology, as V␥3⫹ DETCs from IRF-1⫺/⫺
mice had less extensive dendrites (Fig. 2).
Kinetics in the appearance of V␥3⫹ and Thy1⫹ cells in the skin
are affected in IL-15⫺/⫺ and IRF-1⫺/⫺ mice
Because no V␥3⫹ DETCs could be detected in the skin of adult
IL-15⫺/⫺ mice and DETCs of adult IRF-1⫺/⫺ mice had a less
mature dendritic morphology, we studied the role of IL-15 for the
emergence kinetics of V␥3⫹ and Thy-1⫹ DETCs. Epidermal
sheets from WT, IL-15⫺/⫺, and IRF-1⫺/⫺ mice were examined at
different time points after birth. Epidermal sheets 2 days after birth
contained round-shaped Thy1⫹ ECs and V␥3⫹ ECs in both WT
V␥3⫹ DETCs are absent in IL-15⫺/⫺ mice but present in
IRF-1⫺/⫺ mice
V␥3 thymocytes migrate from the fetal thymus to the skin (5, 6).
After birth, V␥3 cells can only be detected in the epidermis (2).
IL-2R␤⫺/⫺ mice have no V␥3 cells in the skin epidermis (17),
whereas IL-2⫺/⫺ mice have normal DETC numbers (24). To determine whether the absence of epidermal V␥3 cells in IL-2R␤⫺/⫺
mice is due to the lack of IL-15 signaling, epidermal sheets from
IL-15⫺/⫺ mice were examined. No V␥3⫹ DETCs could be de-
FIGURE 2. V␥3⫹ DETCs are absent in the skin of IL-15⫺/⫺ mice but
present in the skin of IRF-1⫺/⫺ mice. Epidermal V␥3⫹ DETCs from 12wk-old WT (A), IL-15⫺/⫺ (B), and IRF-1⫺/⫺ (C) mice were visualized by
immunolabeling of epidermal sheets using FITC-conjugated anti-V␥3
mAb. Results are representative of at least eight mice of each genotype.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
The tumor target used was the YAC-1 cell line (kindly provided by Dr. M.
Joniau, K. V. Leuven, Kortrijk, Belgium). Target cells (106) were labeled
with 100 ␮Ci 51Cr (Amersham International, Little Chalfont, U.K.) for 60
min at 37°C. Cells were washed three times. Effector cells used were sorted
FD17 thymic V␥3⫹ cells or NK cells derived from WT, IL-15⫺/⫺, or
IRF-1⫺/⫺ mice, cultured in the presence of IL-15 with or without IL-12.
Graded effector cell numbers were cocultured in triplicate with 103 51Crlabeled YAC-1 cells in a total volume of 100 ␮l RPMI 1640 medium in
96-well V-bottom plates (Nunc, Roskilde, Denmark). Alternatively, to determine the spontaneous and maximal 51Cr release, medium and 1% Triton
X-100 solution, respectively, was added to the target cells instead of effector cells. After incubation for 6 h at 37°C, 70 ␮l supernatant was removed from each well. Then, 225 ␮l Optiphase Supermix (Wallac, Turku,
Finland) was added to the supernatants, and radioactivity was measured
using a 96-well scintillation counter (Microbeta; Wallac). Data are expressed as the mean percentage of specific 51Cr release. Percentage of
specific release was calculated as follows: 100 ⫻ ((experimental ⫺ spontaneous release)/(maximal ⫺ spontaneous release)).
FIGURE 1. IL-15⫺/⫺ mice have moderate reduced numbers of mature
fetal V␥3 thymocytes, whereas IRF-1⫺/⫺ mice have normal numbers. Thymocyte cell suspensions were freshly prepared from FD17 fetuses. Cells
were labeled with FITC-conjugated anti-IL-2R␤ mAb, PE-conjugated antiV␥3 mAb, and biotinylated anti-HSA mAb (second-step streptavidin-allophycocyanin). Propidium iodide was added just before FCA. Gating was
done on propidium iodide-negative cells (dot plots) or on propidium iodide-negative, V␥3⫹HSAlow cells (histograms). The open histograms represent background staining; the filled histograms represent staining by the
indicated mAb. Results are representative of more than three experiments.
The Journal of Immunology
IRF-1⫺/⫺ mice express lower levels of IL-15 in the skin during
ontogeny
Because IL-15 seems to be essential for the proliferation and/or
survival of V␥3⫹ DETCs, we determined whether the difference
FIGURE 4. Emergence kinetics of V␥3⫹ DETCs and Thy-1⫹ DETCs
in WT vs IRF-1⫺/⫺ mice. Epidermal sheets from WT, IL-15⫺/⫺, or IRF1⫺/⫺ mice at the indicated ages were stained with FITC-conjugated antiV␥3 mAb (A) or FITC-conjugated anti-Thy-1 mAb (B). Data are expressed
as the number of cells per square millimeter ⫾ SD for at least eight mice
of each genotype. A, ⴱ, p ⫽ 0.0001; ⴱⴱ, p ⫽ 0.0075; ⴱⴱⴱ, p ⫽ 0.04 (unpaired t test). B, ⴱ, p ⫽ 0.04; ⴱⴱ, p ⬍ 0.0001 (unpaired t test).
observed in emergence kinetics and dendritic morphology between
WT V␥3⫹ DETCs and IRF-1⫺/⫺ V␥3⫹ DETCs correlated with a
different IL-15 mRNA expression in the skin during ontogeny. We
prepared EC suspensions at different time points after birth. Realtime PCR for IL-15 showed lower mRNA levels in the skin of
IRF-1⫺/⫺ mice compared with WT mice at all time points examined (Fig. 5).
No V␥3⫹ DETCs are present after adoptive transfer of WT
FD18 thymocytes into IL-15⫺/⫺ mice and mRNA levels for IL-7
are similar in the skin of WT and IL-15⫺/⫺ mice
Previously it has been shown that circulating CD3⫹TCR V␥3⫹
fetal murine thymocytes home to the skin and give rise to proliferating DETCs (5, 6). In addition, an important role for IL-7 during
the survival and/or proliferation of V␥3⫹ DETCs in vitro has been
suggested (15). To determine further the role of IL-15 and IL-7
during V␥3 cell development in the skin, we injected WT FD18
thymocytes i.v. into syngeneic IL-15⫺/⫺ mice. We also injected
FIGURE 3. Comparison of morphological features of V␥3⫹ and
Thy-1⫹ DETCs in WT, IL-15⫺/⫺, and IRF-1⫺/⫺ mice during ontogeny.
V␥3⫹ DETCs (A) and Thy-1⫹ DETCs (B) from WT, IL-15⫺/⫺, and IRF1⫺/⫺ mice were visualized by immunolabeling of epidermal sheets using
FITC-conjugated anti-V␥3 mAb or FITC-conjugated anti-Thy-1 mAb. Results are representative of at least eight mice of each genotype.
FIGURE 5. Lower expression of IL-15 mRNA in the skin of IRF-1⫺/⫺
mice. EC suspensions were prepared from WT and IRF-1⫺/⫺ mice at the
indicated ages. cDNA was prepared and real-time PCR for IL-15 and
GAPDH was performed. Results represent the relative expression of IL-15
mRNA after normalization to GAPDH mRNA (mean ⫾ SD) in ECs from
WT or IRF-1⫺/⫺ mice.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
and IRF-1⫺/⫺ mice, although lower numbers were detected in
IRF-1⫺/⫺ compared with WT mice (Figs. 3 and 4). During the next
few days, WT mice showed a gradual increase of V␥3⫹ DETCs
with peak numbers 2 wk after birth (Fig. 4). After 2 wk of age, WT
V␥3⫹ DETC numbers decreased until steady cell numbers were
reached. At 12 wk after birth, all WT V␥3⫹ DETCs had a dendritic
morphology (Fig. 3A). In IRF-1⫺/⫺ mice we also found an increase of V␥3⫹ DETCs until 2 wk after birth, but cell numbers at
1 and 2 wk were significantly lower compared with WT mice. No
decrease was observed at later time points. The end result was that
at 12 wk there was no difference in the cell number of V␥3⫹
DETCs in IRF-1⫺/⫺ vs WT mice. In contrast, higher numbers of
Thy1⫹ DETCs were reached in IRF-1⫺/⫺ mice compared with
WT mice at 2 and 4 wk of age; at 12 wk there was again no
difference detectable (Fig. 4). DETCs from IRF-1⫺/⫺ mice had
fewer dendrites at all time points examined (Fig. 3). No V␥3⫹
DETCs could be detected at any time point after birth in the epidermis of IL-15⫺/⫺ mice, and only marginal numbers of Thy1⫹
cells were present (Figs. 3 and 4). FCA of EC suspensions showed
that these Thy1⫹ cells stained positive for CD3, although expression levels were lower compared with WT Thy1⫹ cells (data not
shown). To exclude the possibility that we could not detect very
small numbers of V␥3⫹ DETCs in the epidermis of IL-15⫺/⫺ mice
by immunolabeling in situ, we prepared EC suspensions at different time points after birth, cultured them with IL-15 for 24 h,
and examined them by flow cytometry for the presence of V␥3⫹
DETCs and/or other Thy1⫹ cells. Compared with adult WT mice,
only small numbers of Thy1⫹ cells were present in EC suspensions
of IL-15⫺/⫺ mice, but no V␥3 cells could be detected (data not
shown).
6489
V␥3 T CELL DEVELOPMENT AND MATURATION
6490
WT FD18 thymocytes i.v. into RAG-1⫺/⫺ mice as a positive control, and IL-15⫺/⫺ FD18 thymocytes were adoptively transferred
into RAG-1⫺/⫺ mice to see whether IL-15⫺/⫺ fetal V␥3 T cells
developed normally within the thymus. Six weeks after injection,
epidermal sheets were prepared and V␥3⫹ DETCs were detected
by in situ immunofluorescent staining. V␥3⫹ DETCs could be
detected in the skin of RAG⫺/⫺ mice after adoptive transfer of WT
and IL-15⫺/⫺ FD18 thymocytes. In contrast, V␥3⫹ DETCs could
not be detected in the skin of IL-15⫺/⫺ mice after adoptive transfer
of WT FD18 thymocytes (Fig. 6). We compared the expression of
IL-7 mRNA by real-time PCR in the skin of WT and IL-15⫺/⫺
mice. Levels of mRNA for IL-7 in the skin were comparable between WT and IL-15⫺/⫺ mice (Fig. 7).
IL-15⫺/⫺ V␥3 cells cultured in the presence of IL-15 and IL-12
are cytotoxic, whereas IRF-1⫺/⫺ V␥3 cells are not
⫺/⫺
FIGURE 6. Adoptive transfer of WT and IL-15⫺/⫺ fetal thymocytes
into RAG-1⫺/⫺ mice gives rise to V␥3⫹ DETCs, whereas adoptive transfer
of WT fetal thymocytes into IL-15⫺/⫺ mice does not. WT FD18 thymocytes were i.v. injected into RAG-1⫺/⫺ (A) and IL-15⫺/⫺ (B) mice. IL15⫺/⫺ FD18 thymocytes were i.v. injected into RAG-1⫺/⫺ mice (C). Six
weeks later, V␥3⫹ DETCs were visualized by immunolabeling of epidermal sheets with FITC-conjugated anti-V␥3 mAb.
Discussion
In this report, we determined the role of IL-15 in the development
and maturation of V␥3 cells. We demonstrate that IL-15, but not
the transcription factor IRF-1, is important for the phenotypic maturation of V␥3 thymocytes within the fetal thymus and is essential
for the presence of V␥3⫹ DETCs in the epidermis of adult mice.
The results found in IRF-1⫺/⫺ mice suggest that the level of IL-15
expression during ontogeny might determine the normal morphologic maturation of V␥3⫹ DETCs within the epidermis. The in
vivo experiments of adoptive transfer of fetal thymocytes and the
data obtained by real-time PCR for IL-7 confirmed the nonredundant role of IL-15 during V␥3 T cell development in the skin. Our
data also indicate that IRF-1 is essential for the induction of V␥3
T cell-mediated cytotoxicity.
Our results show that mature V␥3 thymocytes were decreased
but not completely eliminated in IL-15⫺/⫺ mice, whereas normal
FIGURE 8. Normal and aberrant cytotoxic capacity of IL-15⫺/⫺ and
IRF-1⫺/⫺ V␥3 cells, respectively, after culture in IL-15 with or without
IL-12. FD17 thymocytes were cultured in the presence of 50 ng/ml rIL-15
for 4 days. V␥3 cells and NK cells were sorted and cultured for an additional 2 days in the presence of 50 ng/ml rIL-15 with or without 2 ng/ml
IL-12. The cytotoxicity of V␥3 cells (upper panel) and NK cells (lower
panel) was analyzed in a 51Cr release assay against YAC-1 target cells.
Experiments were performed four times in triplicate. Results are expressed
as the mean ⫾ SD.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
mice and IRFTo determine whether V␥3 cells from IL-15
1⫺/⫺ mice are functional we tested their cytolytic activity against
YAC-1 cells. FD17 thymocytes from WT mice and from both
knockout mice were cultured in the presence of IL-15. After 4
days, V␥3 cells and NK cells, as a control, were sorted and cultured for an additional 2 days in the presence of IL-15 to remove
the anti-V␥3 and anti-NK1.1 mAbs from the cell surface. Compared with WT V␥3 cells, V␥3 cells from IL-15⫺/⫺ mice exhibited
reduced killing activity, but cytotoxicity could clearly be detected.
The same results were found for IL-15⫺/⫺ NK cells (Fig. 8). In
contrast, IRF-1⫺/⫺ V␥3 cells exhibited very low killing activity,
while IRF-1⫺/⫺ NK cells cultured in the presence of IL-15 exhibited killing activity, but weaker when compared with WT NK cells
(Fig. 8).
Because the addition of IL-12 augments the killing capacity of
NK cells, NK-T cells, and human ␥␦ T cells (29 –34), we determined whether addition of IL-12 could restore the killing activity
of IRF-1⫺/⫺ V␥3 cells. IL-15-cultured V␥3 cells from IRF-1⫺/⫺
mice were sorted and cultured for an additional 2 days in the presence of IL-15 plus IL-12. IL-12 did not increase the killing activity
of IRF-1⫺/⫺ V␥3 cells, while the killing activity of WT V␥3 cells
and IL-15⫺/⫺ V␥3 cells was significantly enhanced (Fig. 8). Next,
we determined whether the lack of cytolytic activity seen in V␥3
cells from IRF-1⫺/⫺ mice upon IL-12 triggering was due to a
diminished IL-12R expression. RT-PCR confirmed the presence of
mRNA of IL-12R␤2 chain in V␥3 cells from IRF-1⫺/⫺ mice cultured in the presence of IL-15, and no difference was found as
compared with WT V␥3 cells (Fig. 9).
FIGURE 7. Comparable expression of IL-7 mRNA in the skin of IL15⫺/⫺ and WT mice. EC suspensions were prepared from adult WT and
IL-15⫺/⫺ mice. cDNA was prepared and real-time PCR for IL-7 and HPRT
was performed. Results represent the quantitative expression of IL-7 after
normalization to HPRT (mean ⫾ SD) in ECs from WT or IL-15⫺/⫺ mice.
The Journal of Immunology
FIGURE 9. Comparable expression levels of IL-12R mRNA in WT and
IRF-1⫺/⫺ V␥3 cells. FD17 thymocytes were cultured in the presence of 50
ng/ml rIL-15 for 4 days. V␥3 cells were sorted to a purity of ⱖ99.7%.
cDNA was prepared and semiquantitative RT-PCR for HPRT and IL12R␤2 was performed.
point after birth in the skin of IL-15⫺/⫺ mice. Because the transcription factor IRF-1 regulates IL-15 expression (25), we postulate that the amount of IL-15 expression during ontogeny could
determine the maturation of DETC precursors in the epidermis.
IL-15 mRNA levels in the epidermis of WT mice were indeed
higher compared with the levels found in IRF-1⫺/⫺ mice at each
time point examined. Although this might indicate that also higher
levels of IL-15 protein are present, one has to keep in mind that
IL-15 synthesis and secretion can be negatively regulated at multiple levels, i.e., at the levels of transcription, translation, and intracellular trafficking (41, 42). We were not able to measure IL-15
protein levels, as no reliable IL-15 ELISA method is available at
the moment. It has already been postulated that skin epithelium has
the capacity to induce DETC maturation (40) and that cytokines
expressed in the epidermis might determine the localization and
maturation of V␥3⫹ DETCs in the epidermis (8, 17, 18, 43, 44).
Our results obtained in IL-15⫺/⫺ and IRF-1⫺/⫺ mice suggest that
the presence of threshold amounts of IL-15 in the skin epithelium
is essential during the development and maturation of DETCs in
the epidermis.
V␥3 cells, cultured in the presence of IL-2 or IL-15, proliferate
and acquire lymphokine-activated killing capacities (45). IL15⫺/⫺ V␥3 cells, cultured in the presence of IL-15, acquired reduced but significant killing capacity when compared with WT
V␥3 cells, whereas IRF-1⫺/⫺ V␥3 cells exhibited a drastically
decreased killing activity. In contrast, and in agreement with published data (25), IRF-1⫺/⫺ NK cells acquired significant killing
activity in response to IL-15, but it was still somewhat lower when
compared with WT NK cells. Our in vitro studies on V␥3 and NK
killing capacity from IL-15⫺/⫺ mice and IRF-1⫺/⫺ mice, and previous data showing the importance of IL-15 in the development of
functional cytotoxic cells (11), suggest that IRF-1 controls the expression of other, non-IL-15, target gene(s) that contributes to the
acquisition of cytotoxicity in V␥3 cells. In this context, IL-12 has
been shown to enhance ␥␦ T cell cytotoxicity activity (29, 33).
Because IRF-1 is known to regulate IL-12 expression (46), IL-12
could be the missing factor to induce lytic activity in IRF-1⫺/⫺
V␥3 cells. But, in contrast to WT V␥3 cells and IL-15⫺/⫺ V␥3
cells, addition of IL-12 did not enhance the killing capacity of
IRF-1⫺/⫺ V␥3 cells. As this might be due to inadequate expression
of the IL-12R, we measured IL-12R mRNA levels by semiquantitative RT-PCR. However, V␥3 cells from IRF-1⫺/⫺ mice expressed the same levels of mRNA for IL-12R as compared with
WT V␥3⫹ thymocytes. This is in contrast with a previous report
which shows a reduced expression of IL-12R mRNA in IRF-1⫺/⫺
mice. But mRNA levels were determined only for hepatic and
pulmonary tissues and macrophages, not for ␥␦ T cells (47). IL-12
induces cytotoxicity, presumably through the induction of genes
involved in target cell lysis, such as perforin or granzyme B (48,
49). The induction of lytic granules containing perforin and granzymes might be defective in IRF-1⫺/⫺ mice, explaining the lack of
lytic activity. But V␥3 cells from IRF-1⫺/⫺ mice showed normal
expression of perforin and contained lytic granules (data not
shown). Because the presence of perforin is sufficient for the lysis
of YAC-1 target cells (50), we did not examine whether granzymes
were present. Furthermore, IRF-1⫺/⫺ V␥3 cells showed normal
adhesion to the target cells and expressed normal levels of the 2B4
NK receptor (data not shown), which has been shown to augment
the killing capacity of V␥3 cells (51, 52).
The difference observed in V␥3 T cell morphology and function
between IRF-1⫺/⫺ and WT mice can be due to differences in basal
and inducible expression levels, respectively, of IL-15 (25). In
addition, because IRF-1 is known to regulate several other genes in
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
numbers were found in IRF-1⫺/⫺ mice. These observations indicate that 1) other cytokines can support the development and/or
survival of mature fetal V␥3 thymocytes, and 2) minimal concentrations of IL-15 are sufficient to support the normal survival
and/or differentiation of mature fetal V␥3 thymocytes. In this context, it has been reported that IL-7 is involved in the maturation of
V␥3 cells in the fetal thymus (14, 35). IL-7 signaling is important
during thymic differentiation of V␥3 cells, because maturation of
fetal V␥3 thymocytes is almost completely blocked in IL-7⫺/⫺ and
IL-7R␣⫺/⫺ mice (8, 9). In addition, IL-7R signaling induces germline transcription in the TCR ␥ locus and supports the proliferation
and survival of lymphocyte precursors (10, 36). The absence of
mature V␥3 cells in IL-7⫺/⫺ mice shows that IL-15 alone is not
sufficient for maturation of V␥3 thymocytes to occur.
␥c⫺/⫺ mice have severely reduced numbers of immature fetal
V␥3 thymocytes, no mature V␥3 thymocytes, and an absence of
epidermal V␥3⫹ DETCs (20). IL-7 and IL-15 are known to share
the ␥c. V␥3⫹ DETCs are absent in IL-7⫺/⫺ and IL-7R␣⫺/⫺ mice,
indicating a role for IL-7 in V␥3⫹ DETC development (8, 9, 21).
However, our data also show that IL-15 is nonredundant for the
development and/or survival of V␥3⫹ DETCs in vivo, because
these cells were completely absent in the epidermis of IL-15⫺/⫺
mice. Adoptive transfer of WT FD18 thymocytes into IL-15⫺/⫺
mice clearly indicated that IL-15 plays a nonredundant role in
V␥3⫹ DETC development. In addition, we found comparable levels of IL-7 mRNA in the skin of IL-15⫺/⫺ and WT mice, suggesting that although IL-7 is present in the skin of IL-15⫺/⫺ mice it is
not sufficient to support the development of V␥3⫹ DETCs. These
data indicate that, whereas other cytokines like IL-7 can promote
the development of fetal V␥3 thymocytes and support the proliferation and survival of DETCs in vitro (8, 9, 15), they cannot
compensate for IL-15 during development of V␥3⫹ DETCs in the
epidermis. Results obtained by others have already shown a reduction of mature fetal V␥3 thymocytes and the absence of DETCs
in IL-2R␤⫺/⫺ mice. Furthermore, in contrast to the IL-7R, an essential role for the IL-2R␤ chain in the proliferation and survival
of DETCs in the skin has been shown (37). Our data are in agreement with these results and, in addition, confirm the previous assumption that signaling through the IL-2R␤ chain by the cytokine
IL-15, rather than IL-2, is a key factor in DETC development.
The kinetic studies we performed (Figs. 3–5) support the assumption that IL-15 is a key factor for normal development of V␥3
cells in the skin. Newly arriving DETC precursors in the skin,
derived from fetal V␥3⫹ thymocytes (5, 38), are known to undergo
proliferation in the epidermis (6, 39, 40). Colonization of the epidermis occurs in the perinatal period. The results we found for the
kinetics in appearance of mature Thy⫹ and V␥3⫹ DETCs in the
epidermis of WT mice are in agreement with previously reported
data (39). Different kinetics in appearance of Thy1⫹ and V␥3⫹
DETCs were found in IRF-1⫺/⫺ mice. In addition, morphologically, most Thy1⫹ and V␥3⫹ DETCs from IRF-1⫺/⫺ mice had
less extensive dendrites compared with WT DETCs at each time
point investigated. No V␥3⫹ DETCs could be found at any time
6491
6492
Acknowledgments
We thank Dr. J. Peschon and Dr. P. Matthys for providing us with IL15⫺/⫺ and IRF-1⫺/⫺ mice, respectively. We also thank M. De Smedt for
purification of Abs and C. Collier and G. De Smet for animal care. We
thank T. Van Belle for optimizing and performing the real-time PCR for
IL-15 and T. Taghon and T. Kerre for excellent discussions.
References
1. Ito, K., M. Bonneville, Y. Takagaki, N. Nakanishi, O. Kanagawa, E. G. Krecko,
and S. Tonegawa. 1989. Different ␥␦ T cell receptors are expressed on thymocytes at different stages of development. Proc. Natl. Acad. Sci. USA 86:631.
2. Havran, W. L., and J. P. Allison. 1988. Developmentally ordered appearance of
thymocytes expressing different T-cell antigen receptors. Nature 335:443.
3. Lafaille, J. J., A. DeCloux, M. Bonneville, Y. Takagaki, and S. Tonegawa. 1989.
Junctional sequences of T cell receptor ␥␦ genes: implications for ␥␦ T cell
lineages and for a novel intermediate of V-(D)-J joining. Cell 59:859.
4. Tigelaar, R. E., J. M. Lewis, and P. R. Bergstresser. 1990. TCR ␥/␦⫹ dendritic
epidermal T cells as constituents of skin-associated lymphoid tissue. J. Invest.
Dermatol. 94:58.
5. Havran, W. L., and J. P. Allison. 1990. Origin of Thy-1⫹ dendritic epidermal
cells of adult mice from fetal thymic precursors. Nature 344:68.
6. Payer, E., A. Elbe, and G. Stingl. 1991. Circulating CD3⫹/T cell receptor V␥3⫹
fetal murine thymocytes home to the skin and give rise to proliferating dendritic
epidermal T cells. J. Immunol. 146:2536.
7. DiSanto, J. P., D. Guy Grand, A. Fisher, and A. Tarakhovsky. 1996. Critical role
for the common cytokine receptor ␥ chain in intrathymic and peripheral T cell
selection. J. Exp. Med. 183:1111.
8. Maki, K., S. Sunaga, Y. Komagata, Y. Kodaira, A. Mabuchi, H. Karasuyama,
K. Yokomuro, J. I. Miyazaki, and K. Ikuta. 1996. Interleukin 7 receptor-deficient
mice lack ␥␦ T cells. Proc. Natl. Acad. Sci. USA 93:7172.
9. Moore, T. A., U. von Freeden Jeffry, R. Murray, and A. Zlotnik. 1996. Inhibition
of ␥␦ T cell development and early thymocyte maturation in IL-7⫺/⫺ mice. J. Immunol. 157:2366.
10. Peschon, J. J., P. J. Morrissey, K. H. Grabstein, F. J. Ramsdell, E. Maraskovsky,
B. C. Gliniak, L. S. Park, S. F. Ziegler, D. E. Williams, C. B. Ware, et al. 1994.
Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. J. Exp. Med. 180:1955.
11. Kennedy, M. K., M. Glaccum, S. N. Brown, E. A. Butz, J. L. Viney, M. Embers,
N. Matsuki, K. Charrier, L. Sedger, C. R. Willis, et al. 2000. Reversible defects
in natural killer and memory CD8 T cell lineages in interleukin 15-deficient mice.
J. Exp. Med. 191:771.
12. Lodolce, J. P., D. L. Boone, S. Chai, R. E. Swain, T. Dassopoulos, S. Trettin, and
A. Ma. 1998. IL-15 receptor maintains lymphoid homeostasis by supporting lymphocyte homing and proliferation. Immunity 9:669.
13. Leclercq, G., M. De Smedt, B. Tison, and J. Plum. 1990. Preferential proliferation
of T cell receptor V␥3-positive cells in IL-2-stimulated fetal thymocytes. J. Immunol. 145:3992.
14. Leclercq, G., M. De Smedt, and J. Plum. 1995. Cytokine dependence of V␥3
thymocytes: mature but not immature V␥3 cells require endogenous IL-2 and
IL-7 to survive: evidence for cytokine redundancy. Int. Immunol. 7:843.
15. Matsue, H., P. R. Bergstresser, and A. Takashima. 1993. Keratinocyte-derived
IL-7 serves as a growth factor for dendritic epidermal T cells in mice. J. Immunol.
151:6012.
16. Nishimura, H., K. Hiromatsu, N. Kobayashi, K. H. Grabstein, R. Paxton,
K. Sugamura, J. A. Bluestone, and Y. Yoshikai. 1996. IL-15 is a novel growth factor
for murine ␥␦ T cells induced by Salmonella infection. J. Immunol. 156:663.
17. Kawai, K., H. Suzuki, K. Tomiyama, M. Minagawa, T. W. Mak, and P. S. Ohashi.
1998. Requirement of the IL-2 receptor ␤ chain for the development of V␥3 dendritic
epidermal T cells. J. Invest. Dermatol. 110:961.
18. Tanaka, T., Y. Takeuchi, T. Shiohara, F. Kitamura, Y. Nagasaka, K. Hamamura,
H. Yagita, and M. Miyasaka. 1992. In utero treatment with monoclonal antibody
to IL-2 receptor ␤-chain completely abrogates development of Thy-1⫹ dendritic
epidermal cells. Int. Immunol. 4:487.
19. Watanabe, Y., T. Sudo, N. Minato, A. Ohnishi, and Y. Katsura. 1991. Interleukin
7 preferentially supports the growth of ␥␦ T cell receptor-bearing T cells from
fetal thymocytes in vitro. Int. Immunol. 3:1067.
20. Malissen, M., P. Pereira, D. J. Gerber, B. Malissen, and J. P. DiSanto. 1997. The
common cytokine receptor ␥ chain controls survival of ␥/␦ T cells. J. Exp. Med.
186:1277.
21. Laky, K., L. Lefrancois, U. von Freeden Jeffry, R. Murray, and L. Puddington.
1998. The role of IL-7 in thymic and extrathymic development of TCR ␥␦ cells.
J. Immunol. 161:707.
22. Giri, J. G., M. Ahdieh, J. Eisenman, K. Shanebeck, K. Grabstein, S. Kumaki,
A. Namen, L. S. Park, D. Cosman, and D. Anderson. 1994. Utilization of the ␤
and ␥ chains of the IL-2 receptor by the novel cytokine IL-15. EMBO J. 13:2822.
23. de Jong, J. L. O., N. L. Farner, M. B. Widmer, J. G. Giri, and P. M. Sondel. 1996.
Interaction of IL-15 with the shared IL-2 receptor ␤ and common ␥ subunits: the
IL-15/␤/common ␥ receptor-ligand complex is less stable than the IL-2/␤/common ␥ receptor-ligand complex. J. Immunol. 156:1339.
24. Schimpl, A., T. Hünig, A. Elbe, I. Berberich, S. Krämer, H. Merz, A. C. Feller,
B. Sadlack, H. Schorle, and I. Horak. 1994. Development and function of the
immune system in mice with targeted disruption of the interleukin-2 gene. In
Transgenesis and Targeted Mutagenesis in Immunology. H. Bleuthmann and
P. S. Ohashi, eds. Academic, San Diego, p. 191.
25. Ohteki, T., H. Yoshida, T. Matsuyama, G. S. Duncan, T. W. Mak, and
P. S. Ohashi. 1998. The transcription factor interferon regulatory factor 1 (IRF-1)
is important during the maturation of natural killer 1.1⫹ T cell receptor-␣/␤⫹
(NK1⫹ T) cells, natural killer cells, and intestinal intraepithelial T cells. J. Exp.
Med. 187:967.
26. Kimura, T., K. Nakayama, J. Penninger, M. Kitagawa, H. Harada, T. Matsuyama,
N. Tanaka, R. Kamijo, J. Vilcek, T. W. Mak, et al. 1994. Involvement of the
IRF-1 transcription factor in antiviral responses to interferons. Science 264:1921.
27. De Creus, A., K. Van Beneden, T. Taghon, V. Debacker, J. Plum, and
G. Leclercq. 2000. Langerhans cells that have matured in vivo in the absence of
T cells are fully capable of inducing a helper CD4 as well as a cytotoxic CD8
response. J. Immunol. 165:645.
28. Leclercq, G., J. Plum, D. Nandi, M. De Smedt, and J. P. Allison. 1993. Intrathymic differentiation of V␥3 T cells. J. Exp. Med. 178:309.
29. Cesano, A., S. Visonneau, S. C. Clark, and D. Santoli. 1993. Cellular and molecular mechanisms of activation of MHC nonrestricted cytotoxic cells by IL-12.
J. Immunol. 151:2943.
30. Chehimi, J., S. E. Starr, I. Frank, M. Rengaraju, S. J. Jackson, C. Llanes,
M. Kobayashi, B. Perussia, D. Young, E. Nickbarg, et al. 1992. Natural killer
(NK) cell stimulatory factor increases the cytotoxic activity of NK cells from both
healthy donors and human immunodeficiency virus-infected patients. J. Exp.
Med. 175:789.
31. Fujimiya, Y., Y. Suzuki, R. Katakura, T. Miyagi, T. Yamaguchi, T. Yoshimoto,
and T. Ebina. 1997. In vitro interleukin 12 activation of peripheral blood
CD3⫹CD56⫹ and CD3⫹CD56⫺ ␥␦ T cells from glioblastoma patients. Clin.
Cancer Res. 3:633.
32. Hashimoto, W., K. Takeda, R. Anzai, K. Ogasawara, H. Sakihara, K. Sugiura,
S. Seki, and K. Kumagai. 1995. Cytotoxic NK1.1 Ag⫹ ␣␤ T cells with intermediate TCR induced in the liver of mice by IL-12. J. Immunol. 154:4333.
33. Klein, J. L., H. Fickenscher, J. E. Holliday, B. Biesinger, and B. Fleckenstein.
1996. Herpesvirus saimiri immortalized ␥␦ T cell line activated by IL-12. J. Immunol. 156:2754.
34. Satoh, M., S. Seki, W. Hashimoto, K. Ogasawara, T. Kobayashi, K. Kumagai,
S. Matsuno, and K. Takeda. 1996. Cytotoxic ␥␦ or ␣␤ T cells with a natural killer
cell marker, CD56, induced from human peripheral blood lymphocytes by a
combination of IL-12 and IL-2. J. Immunol. 157:3886.
35. Leclercq, G., V. Debacker, M. De Smedt, and J. Plum. 1996. Differential effects
of interleukin-15 and interleukin-2 on differentiation of bipotential T/natural
killer progenitor cells. J. Exp. Med. 184:325.
36. Maki, K., S. Sunaga, and K. Ikuta. 1996. The V-J recombination of T cell receptor-␥ genes is blocked in interleukin-7 receptor-deficient mice. J. Exp. Med.
184:2423.
37. Ye, S., K. Maki, H. Lee, A. Ito, K. Kawai, H. Suzuki, T. Mak, Y. Chien,
T. Honjo, and K. Ikuta. 2001. Differential roles of cytokine receptors in the
development of ␥␦ T cells. J. Immunol. 167:1929.
38. Allison, J. P., D. M. Asarnow, M. Bonyhadi, A. Carbone, W. L. Havran,
D. Nandi, and J. Noble. 1991. ␥␦ T cells in murine epithelia: origin, repertoire,
and function. Adv. Exp. Med. Biol. 292:63.
39. Elbe, A., E. Tschachler, G. Steiner, A. Binder, K. Wolff, and G. Stingl. 1989.
Maturational steps of bone marrow-derived dendritic murine epidermal cells:
phenotypic and functional studies on Langerhans cells and Thy-1⫹ dendritic epidermal cells in the perinatal period. J. Immunol. 143:2431.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
addition to IL-12, such as type I IFNs, IL-18, inducible NO synthase, and Fas ligand (25, 46, 53–58), and is located downstream
from IFN-␥, IFN-␣␤, IL-6, IL-1, and TNF (59 – 62), we cannot
rule out the possibility that one of these factors is involved in the
morphological maturation and function of V␥3 T cells.
IL-15⫺/⫺ mice specifically lack NK cells, NK-T cells, intestinal
intraepithelial lymphocytes, and memory CD8⫹ T cells (11). The
loss of these cells demonstrates that IL-15 is mainly critical for the
development and/or maintenance of lymphoid cells of the innate
immune system. V␥3 cells share common features with both NK
and NK-T innate immune cells, as V␥3 cells also express NK cell
markers including 2B4 (52), IL-2R␤/IL-15R␤ (30), Ly49E, and
CD94/NKG2 (63), and as they express a canonical TCR V␥3/V␦1
(14, 52, 64). IL-7 is necessary for normal development of lymphoid cells of the adaptive immune system (10). Others have
shown that IL-7 is also essential for thymic differentiation of V␥3
cells (9, 21). These data, in combination with our finding that V␥3
cell development is impaired in the skin IL-15⫺/⫺ mice, indicate
that the cytokine requirements during fetal thymic differentiation
of V␥3 cells are characteristic of adaptive immune cells, whereas
cytokine requirements for peripheral survival are characteristic of
innate immune cells. This resemblance of V␥3 cells with both cells
from the innate immune system and the adaptive immune system
confirms the assumption that V␥3 cells are at the transition between these two systems.
V␥3 T CELL DEVELOPMENT AND MATURATION
The Journal of Immunology
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
family, is expressed on murine dendritic epidermal T cells and plays a functional
role in their killing of skin tumors. J. Invest. Dermatol. 105:592.
Fantuzzi, G., D. Reed, M. Qi, S. Scully, C. A. Dinarello, and G. Senaldi. 2001.
Role of interferon regulatory factor-1 in the regulation of IL-18 production and
activity. Eur. J. Immunol. 31:369.
Fujita, T., Y. Kimura, M. Miyamoto, E. L. Barsoumian, and T. Taniguchi. 1989.
Induction of endogenous IFN-␣ and IFN-␤ genes by a regulatory transcription
factor, IRF-1. Nature 337:270.
Hobart, M., V. Ramassar, N. Goes, J. Urmson, and P. F. Halloran. 1997. IFN
regulatory factor-1 plays a central role in the regulation of the expression of class
I and II MHC genes in vivo. J. Immunol. 158:4260.
Kamijo, R., H. Harada, T. Matsuyama, M. Bosland, J. Gerecitano, D. Shapiro,
J. Le, S. I. Koh, T. Kimura, S. J. Green, et al. 1994. Requirement for transcription
factor IRF-1 in NO synthase induction in macrophages. Science 263:1612.
Chow, W. A., J. J. Fang, and J. K. Yee. 2000. The IFN regulatory factor family
participates in regulation of Fas ligand gene expression in T cells. J. Immunol.
164:3512.
Coccia, E. M., E. Stellacci, G. Marziali, G. Weiss, and A. Battistini. 2000. IFN-␥
and IL-4 differently regulate inducible NO synthase gene expression through
IRF-1 modulation. Int. Immunol. 12:977.
Abdollahi, A., K. A. Lord, B. Hoffman Liebermann, and D. A. Liebermann. 1991.
Interferon regulatory factor 1 is a myeloid differentiation primary response gene
induced by interleukin 6 and leukemia inhibitory factor: role in growth inhibition.
Cell Growth Differ. 2:401.
Harada, H., T. Fujita, M. Miyamoto, Y. Kimura, M. Maruyama, A. Furia,
T. Miyata, and T. Taniguchi. 1989. Structurally similar but functionally distinct
factors, IRF-1 and IRF-2, bind to the same regulatory elements of IFN and IFNinducible genes. Cell 58:729.
Miyamoto, M., T. Fujita, Y. Kimura, M. Maruyama, H. Harada, Y. Sudo,
T. Miyata, and T. Taniguchi. 1988. Regulated expression of a gene encoding a
nuclear factor, IRF-1, that specifically binds to IFN-␤ gene regulatory elements.
Cell 54:903.
Senaldi, G., C. L. Shaklee, J. Guo, L. Martin, T. Boone, T. W. Mak, and
T. R. Ulich. 1999. Protection against the mortality associated with disease models
mediated by TNF and IFN-␥ in mice lacking IFN regulatory factor-1. J. Immunol.
163:6820.
Van Beneden, K., A. De Creus, F. Stevenaert, V. Debacker, J. Plum, and
G. Leclercq. 2002. Expression of inhibitory receptors Ly49E and CD94/NKG2
on fetal thymic and adult epidermal TCR V␥3 lymphocytes. J. Immunol. 168:
3295.
Havran, W. L., A. Carbone, and J. P. Allison. 1991. Murine T cells with invariant
␥␦ antigen receptors: origin, repertoire, and specificity. Semin. Immunol. 3:89.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
40. Elbe, A., O. Kilgus, R. Strohal, E. Payer, S. Schreiber, and G. Stingl. 1992. Fetal
skin: a site of dendritic epidermal T cell development. J. Immunol. 149:1694.
41. Kurys, G., Y. Tagaya, R. Bamford, J. A. Hanover, and T. A. Waldmann. 2000.
The long signal peptide isoform and its alternative processing direct the intracellular trafficking of interleukin-15. J. Biol. Chem. 275:30653.
42. Bamford, R. N., A. P. DeFilippis, N. Azimi, G. Kurys, and T. A. Waldmann.
1998. The 5⬘ untranslated region, signal peptide, and the coding sequence of the
carboxyl terminus of IL-15 participate in its multifaceted translational control.
J. Immunol. 160:4418.
43. Takashima, A., H. Matsue, P. R. Bergstresser, and K. Ariizumi. 1995. Interleukin-7-dependent interaction of dendritic epidermal T cells with keratinocytes.
J. Invest. Dermatol. 105:50.
44. Stingl, G., A. Elbe, E. Paer, O. Kilgus, R. Strohal, and S. Schreiber. 1991. The
role of fetal epithelial tissues in the maturation/differentiation of bone marrowderived precursors into dendritic epidermal T cells (DETC) of the mouse. Curr.
Top. Microbiol. Immunol. 173:269.
45. Leclercq, G., M. De Smedt, and J. Plum. 1991. Interleukin-2 stimulated T cell
receptor V␥3 positive thymocytes do not migrate to the skin. Immunol. Lett.
28:135.
46. Salkowski, C. A., K. Kopydlowski, J. Blanco, M. J. Cody, R. McNally, and
S. N. Vogel. 1999. IL-12 is dysregulated in macrophages from IRF-1 and IRF-2
knockout mice. J. Immunol. 163:1529.
47. Salkowski, C. A., K. E. Thomas, M. J. Cody, and S. N. Vogel. 2000. Impaired
IFN-␥ production in IFN regulatory factor-1 knockout mice during endotoxemia
is secondary to a loss of both IL-12 and IL-12 receptor expression. J. Immunol.
165:3970.
48. DeBlaker Hohe, D. F., A. Yamauchi, C. R. Yu, J. A. Horvath Arcidiacono, and
E. T. Bloom. 1995. IL-12 synergizes with IL-2 to induce lymphokine-activated
cytotoxicity and perforin and granzyme gene expression in fresh human NK cells.
Cell. Immunol. 165:33.
49. Salcedo, T. W., L. Azzoni, S. F. Wolf, and B. Perussia. 1993. Modulation of
perforin and granzyme messenger RNA expression in human natural killer cells.
J. Immunol. 151:2511.
50. Davis, J. E., M. J. Smyth, and J. A. Trapani. 2001. Granzyme A and B-deficient
killer lymphocytes are defective in eliciting DNA fragmentation but retain potent
in vivo anti-tumor capacity. Eur. J. Immunol. 31:39.
51. Schuhmachers, G., K. Ariizumi, P. A. Mathew, M. Bennett, V. Kumar, and
A. Takashima. 1995. Activation of murine epidermal ␥␦ T cells through surface
2B4. Eur. J. Immunol. 25:1117.
52. Schuhmachers, G., K. Ariizumi, P. A. Mathew, M. Bennett, V. Kumar, and
A. Takashima. 1995. 2B4, a new member of the immunoglobulin gene super-
6493