Download Volume 29, Number 1, 2013

V o l u m e 29, N u m b e r 1, 2013
Immunohematology
Volume 29, Number 1, 2013
CONTENTS
1
Case Report
An AQP1 allele associated with Co(a–b–) phenotype
S. Vege, S. Nance, D. Kavitsky, X. Li, T. Horn, G. Meny, and C.M. Westhoff
5
Report
Warm autoantibodies: time for a change
J.R. Nobles and C. Wong
11
Case Report
Major non-ABO incompatibility caused by anti-Jka in a patient
before allogeneic hematopoietic stem cell transplantation
M.Y. Kim, P. Chaudhary, I.A. Shulman, and V. Pullarkat
15
Case Report
A case of autoimmune hemolytic anemia with anti-D specificity
in a 1-year-old child
R.S. Bercovitz, M. Macy, and D.R. Ambruso
19
Review
An update on the GLOB blood group system and collection
Å. Hellberg, J.S. Westman, and M.L. Olsson
25
Review
P1PK: the blood group system that changed its name and
expanded
Å. Hellberg, J.S. Westman, B. Thuresson, and M.L. Olsson
34
C o m m u n i c at i o n
35
Announcements
38
A dv ertisements
42
Instructions
Letter to the Readers—new blood group allele report
for
Authors
Editor-in- Chief
E d i t o r ia l B o a r d
Sandra Nance, MS, MT(ASCP)SBB
Philadelphia, Pennsylvania
Managing Editor
Cynthia Flickinger, MT(ASCP)SBB
Philadelphia, Pennsylvania
Patricia Arndt, MT(ASCP)SBB
Thierry Peyrard, PharmD, PhD
James P. AuBuchon, MD
Joyce Poole, FIBMS
Pomona, California
Paris, France
Seattle, Washington
Bristol, United Kingdom
Lilian Castilho, PhD
Campinas, Brazil
Mark Popovsky, MD
Senior M edi cal Editor
Ralph R. Vassallo, MD
Martha R. Combs, MT(ASCP)SBB
S. Gerald Sandler, MD
Geoffrey Daniels, PhD
Jill R. Storry, PhD
Anne F. Eder, MD
David F. Stroncek, MD
Norcross, Georgia
George Garratty, PhD, FRCPath
Nicole Thornton
Senior M edi cal Editor
Brenda J. Grossman, MD
Philadelphia, Pennsylvania
Te c h n i c a l E d i t o r s
Christine Lomas-Francis, MSc
New York City, New York
Dawn M. Rumsey, ART(CSMLT)
Ralph Vassallo, MD
Philadelphia, Pennsylvania
A s s o c iat e M e d i c a l E d i t o r s
David Moolten, MD
Durham, North Carolina
Bristol, United Kingdom
Washington, District of Columbia
Lund, Sweden
Washington, District of Columbia
Bethesda, Maryland
Pomona, California
Bristol, United Kingdom
St. Louis, Missouri
Emeritus Editors
Christine Lomas-Francis, MSc
Supply, North Carolina
Delores Mallory, MT(ASCP) SBB
New York City, New York
Marion E. Reid, PhD, FIBMS
Geralyn M. Meny, MD
Philadelphia, Pennsylvania
San Antonio, Texas
Joy Fridey, MD
Paul M. Ness, MD
Pomona, California
Braintree, Massachusetts
New York City, New York
Baltimore, Maryland
M olecul ar Editor
Margaret A. Keller
Philadelphia, Pennsylvania
E d i t o r ia l A s s i s ta n t
Sheetal Patel
P r o d u c t i o n A s s i s ta n t
Marge Manigly
Immunohematology is published quarterly (March, June, September, and December) by the
American Red Cross, National Headquarters, Washington, DC 20006.
Immunohematology is indexed and included in Index Medicus and MEDLINE on the
MEDLARS system. The contents are also cited in the EBASE/Excerpta Medica and Elsevier
BIOBASE/Current Awareness in Biological Sciences (CABS) databases.
The subscription price is $50 for individual, $100 for institution (U.S.) and
$60 for individual, $100 for institution (foreign) per year.
C opy Editor
Subscriptions, Change of Address, and Extra Copies:
Mary L. Tod
Immunohematology, P.O. Box 40325
Philadelphia, PA 19106
Proofreader
Lucy Oppenheim
Or call (215) 451-4902
Web site: www.redcross.org/about-us/publications/immunohematology
Electroni c Publisher
Copyright 2013 by The American National Red Cross
ISSN 0894-203X
Paul Duquette
O n O ur C ov er
Grainstacks at the End of Summer, Evening Effect was one of 25
canvases of wheat or haystacks Claude Monet painted between 1890
and 1891, which explored the effect of variations in point of view, time
of day, season, and weather on their common theme. These works
were as a group commercially successful and popular with both critics
and the public. They marked a turning point in Monet’s career not
only in this regard, but also for his having painted them in the fields
surrounding a house he purchased that year in Giverny. They represent
the beginning of a more grounded life there and what would become
a frequent serial approach to his subjects. The painting on the cover
follows the impressionist strategy of focusing on archetypal shape and
color rather than detail, here the warm shades with which Monet imbues
the estivating ricks. In this issue Nobles and Wong report on a modified,
more time-efficient method of warm autoantibody adsorption.
David Moolten, MD
Case R ep ort
An AQP1 allele associated with Co(a–b–)
phenotype
S. Vege, S. Nance, D. Kavitsky, X. Li, T. Horn, G. Meny, and C.M. Westhoff
The Colton (CO) blood group system consists of four antigens,
Coa, Cob, Co3, and Co4, located on aquaporin-1 (AQP1), with
Coa highly prevalent in all populations (99.8%). The Colton null
phenotype, Co(a–b–), is very rare, and individuals with this
phenotype lack the high-prevalence antigen Co3. To date, only
six Co(a–b–) probands have been reported and four silencing
alleles characterized. We identified an AQP1-null allele in a white
woman with anti-Co3 caused by deletion of a G at nucleotide
601 (nt601delG) that results in a frameshift and premature
termination (Val201Stop). Available family members were
tested for the allele. Although anti-Co3 has been associated with
mild to severe hemolytic disease of the fetus and newborn, the
antibody was not clinically significant as evidenced by a low
titer and delivery of asymptomatic newborns with moderate to
weakly positive direct antiglobulin tests for all four pregnancies.
Immunohematology 2013;29:1–4.
Key Words: Colton blood group, Co(a–b–), AQP1 Conull,
anti-Co3
The Colton (CO) blood group system consists of four
antigens, Coa, Cob, Co3, and Co4, located on aquaporin-1
(AQP1). The prevalence of Coa is high in all populations
(99.8%). The antithetical antigen, Cob, is found in approximately
10 percent of Europeans and 5 percent of Hispanics and less
frequently in Japanese.1–3 Co3 is the high-prevalence antigen
absent in Co(a–b–) individuals. The Conull phenotype, Co(a−
b−), Co:–3, is extremely rare. Co4 is a high-prevalence antigen
that was reported in two samples that were initially thought
to be phenotype Co(a−b−) with a possible anti-Co3. Further
expression studies and reevaluation of antibody specificity
indicated this antibody is associated with a new antigen, Co4.4,5
The AQP1 protein is a member of a large family of water
transport channels expressed on the erythrocyte membrane.
Individuals with the Co(a−b−) phenotype also lack AQP1
protein in other tissues. Although no severe clinical effects
are associated with the null phenotype,6 it has been shown
that such individuals, when in water-deprived conditions,
have a limited ability to concentrate urine and have decreased
pulmonary vascular permeability.7
The AQP1 gene, consisting of four exons, is located on the
short arm of chromosome 7 (7q14). The gene encodes a protein
of 268 amino acids with a 28-kDa relative molecular mass. The
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Coa and Cob antigens correspond to a nucleotide (nt) 134C>T
change, encoding an amino acid change at position 45 from
alanine to valine.8 Only six probands with the rare Co(a−b−)
phenotype have been reported, and five silencing alleles have
been characterized: (1) deletion of most of exon 1 (CO*N.01),9
(2) insertion of T at nt 307 that results in a frameshift in
the protein at Gly104 (CO*N.02),9 (3) an nt 576C>A change
encoding Asn192Lys (CO*01N.03),10 (4) deletion of G at nt 232
causing a frameshift at amino acid 78 and a premature stop
codon at position 119 (CO*01N.04),11 and (5) an nt 112C>T
change encoding Pro38Ser (CO*01N.05).12 A homozygous
113C>T change (Pro38Leu) (CO*M.01) was found in an
individual whose red blood cells (RBCs) typed Co(a–b–)
with weak AQP1 expression (<1% of control) detected in RBC
membrane immunoblots.9 Importantly, Conull individuals have
been reported to make clinically significant anti-Co3, causing
mild to severe hemolytic disease of the fetus and newborn
(HDFN).11,13 Transfusion of patients with anti-Co3 is difficult
because of the rarity of the type. Autologous donation and
testing of family members are strongly recommended. The
American Rare Donor Program has one Co:–3 donor. The
World Health Organization International Panel has two donors
listed in Canada and nine units frozen in France (number of
donors not known).
Here, we identify a Colton null allele in a woman whose
RBCs type as Co(a−b−) with anti-Co3 in her serum. We report
results of testing family members and describe the clinical
management of her pregnancies.
Case Report
Anti-Co3 was identified in a 33-year-old gravida 2 para 1
white woman of European descent. Her RBCs typed Co(a−b−)
Co:–3. She had one pregnancy 14 years before and no history
of blood transfusions. Her first pregnancy was unremarkable.
During the course of the second pregnancy, the anti-Co3 was
identified and she donated two autologous directed units for
her or her baby’s potential need. These units were divided into
two aliquots each and frozen. Only two aliquots per unit could
be made because of her low hemoglobin levels at the time of
1
S. Vege et al.
the donations. A baby girl (child 2) was delivered by cesarean
delivery at 34 weeks’ gestation. The baby’s direct antiglobulin
test (DAT) was 1+. Neither the baby nor the mother required
transfusion. Nearly 2 years later, she delivered another baby
(child 3). This baby’s DAT was weakly positive. Two years
after the third child, she delivered a fourth child (child 4),
whose RBCs showed a microscopically weakly positive DAT.
The third and fourth pregnancies were managed with the
same protocol for autologous unit collection; neither required
transfusion.
Materials and Methods
EDTA-anticoagulated whole blood samples were obtained
from the proband, her husband, child 2, and child 3. A buccal
swab sample was obtained from child 4.
Serologic testing was performed on the husband’s sample;
no DNA was isolated for molecular analysis.
Serology
Antibody identification and RBC typing were performed
using standard methods. Determination of antibody titers
was performed with 6 percent albumin as a diluent on the
proband’s serum at 4, 5, 6, 7, and 8 months’ gestation, before
delivery, and 16 months after delivery of child 2. Samples were
obtained during the third pregnancy at 4, 6, and 8 months’
estimated gestational age (EGA) and at the time of autologous
donation in the fourth pregnancy.
Primers used for PCR amplification and DNA sequence
analysis are listed in Table 1. For some samples, PCR products
were cloned (TOPO TA-cloning kit, Invitrogen, Carlsbad, CA),
and plasmids were sequenced using vector primers. Sequences
were aligned to reference sequence (GenBank accession
#NM_198098) with ClustalX software (ClustalX, Science
Foundation Ireland and University College Dublin, Dublin,
Ireland).14
Western Blot Analysis
RBC membranes were prepared by centrifugation of whole
blood for 10 minutes and removal of plasma and the buffy
coat. Packed RBCs were washed with phosphate-buffered
saline (PBS) and lysed in 5 mM Tris HCl/0.1 mM EDTA,
pH 7.5, on ice for 15 minutes. Cell membranes were washed
four times with 5 mM Tris HCl/0.1 mM EDTA and one time
with PBS by centrifugation at 35,000 g. Protein concentration
was determined using Pierce BCA Protein Assay Kit, Thermo
Scientific, Rockford, IL). RBC membrane protein (100 μg) was
separated on 13.5 percent nonreducing sodium dodecylsulfate
(SDS) polyacrylamide gel electrophoresis, transferred to
nitrocellulose membrane, and incubated first with anti-Co3
and then with horseradish peroxidase–conjugated goat antihuman IgG. Anti-Co3 was a gift from Peter Agre. The blot was
visualized by chemiluminescence (ECL, Invitrogen).
Results
RBC Antigen Typing and Antibody Titrations
Polymerase Chain Reaction Amplification and DNA
The proband’s RBCs typed as group A, D+, C+, E−, c+,
Sequence Analysis
e+; M+N−S–s+; P1+; Le(a−b+); K+ k+; Fy(a+b+); Jk(a−b+)
DNA was isolated with QIAamp Blood Mini Kit (QIAamp
and Co(a−b−) Co:–3. Family studies revealed that RBCs from
Blood Mini Kit, QIAGEN, Hilden, Germany). CO (AQP1) was
her husband, two sisters, and mother all typed as Co(a+b−).
5
amplified with previously published primers. Amplified
Samples from the children were not made available for RBC
polymerase chain reaction (PCR) products were purified (PCR
typing. At prenatal presentation during the second pregnancy,
Purification kit, Qiagen, Inc., Valencia, CA) and sequenced by
the anti-Co3 was detected. This antibody reacted 1+ in the
the Children’s Hospital of Philadelphia Sequencing Facility.
antiglobulin phase with albumin and ficin methods with antiIgG (Immucor, Norcross, GA),
hereafter referred to as -IgG. The
Table 1. Primer sequences used for amplification and sequencing of CO (AQP1)
serum titer was 1 (score 9).15 At
Primer
5, 6, and 7 months’ EGA, the
name
Sequence (5′–3′)
Region
Nucleotide position
Exon
Publication
11
antibody was not detected (titer
CoP1
catccctaacatggcatgcagtg
Promoter
−611 to −589
1
Joshi et al., 2001
0). At 8 months the titer was 2
CoP2
aactgctggccaagcttattcc
Intron 1
+291 to +270
1
Joshi et al., 200111
11
(score 18), and at delivery, the
CoP3
gggctggagtttcattaacacag
Intron 1
−215 to −193
2 to 4
Joshi et al., 2001
titer showed a moderate increase
CoP4
cttcacctcctccacaacttcaag
3′ UTR
261 to 237
2 to 4
Joshi et al., 200111
to 4 (score 21). After delivery the
CoIn2F
gagcacagggacctcctg
Intron 2
−169 to −152
Sequencing
This study
CoIn3F cttaccatgggacaccaaagctt
Intron 3
+29 to +51
Sequencing
This study
titer decreased to 2 (score 11;
UTR = untranslated region.
Table 2).
2
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Novel AQP1 allele associated with Co(a–b–)
Table 2. Anti-Co3 reactivity and titers, as available
Pregnancy
2nd
3rd
4th
A
Samples
AHG phase
reactivity
Titer
Score
4 months’ gestation
1+
1
9
5 months’ gestation
0
0
0
6 months’ gestation
0
0
0
7 months’ gestation
0
0
0
8 months’ gestation
1+
2
18
At delivery
1+
4
21
16 months after delivery
1+
2
11
4 months’ gestation
3+
16
44
6 months’ gestation
2+
8
33
8 months’ gestation (delivery)
2+s
NT
NT
At delivery
1+
NT
NT
12 months after delivery
2+
NT
NT
AHG = anti-human globulin; NT = not tested.
Two years later, when two autologous units were donated
(see Case Report), the anti-Co3 was 2+ in antiglobulin tests
with albumin (Immucor)-IgG and PEG (Sigma, St. Louis, MO)
-IgG methods on the first donation and 1+ in albumin-IgG and
2+ in ficin (Sigma)-IgG.
At 4 months’ EGA in the third pregnancy, the anti-Co3 was
3+ in albumin-IgG and 2+ in ficin-IgG. The titer was 16 (score
44). At 6 months’ EGA, the antibody was 2+ in albumin-IgG
with a titer of 8 (score 33). At delivery at 8 months’ EGA the
albumin-IgG reactivity was 2+s and 3+ in ficin-IgG; a titration
was not performed. A sample from child 3 showed a weakly
positive (microscopic only) DAT with polyspecific antiglobulin
sera (Immucor) only; anti-IgG and anti-C3 (Immucor) tests
were negative.
At delivery of child 4, the proband’s sample showed the
anti-Co3 to react 1+ by the albumin-IgG method and 1+s in
ficin-IgG. A subsequent sample obtained and evaluated more
than a year later when she donated an autologous unit was 2+
in albumin-IgG; titers were not performed in either the delivery
sample from the fourth pregnancy or the autologous unit.
No additional antibodies were detected in any of the
samples tested over the years, and none of the babies required
treatment for HDFN.
Molecular Analysis
DNA sequence analysis of CO (AQP1) from the proband
revealed she was homozygous for a G nucleotide deletion at
position 601 in exon 3 (nt601delG). This deletion is predicted
to cause a premature stop (Val201Stop) in the protein and
silencing of the antigen (Fig. 1). This deletion was on the CO*A
allele, as evidenced by homozygosity for nt 134C/C in exon
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
B
Fig. 1 DNA sequence electropherogram of AQP1 exon 3. (A)
Proband (AQP1 null). (B) Consensus (conventional AQP1). The
proband was homozygous for a G nucleotide deletion at position
601, which is predicted to cause a premature stop (Val201Stop) in
the protein.
1. Sequence analysis of the proband’s mother and one sister
indicated both had two CO*A alleles, one with nt601delG.
A second sister had only wild-type sequences and was
homozygous for the conventional CO*A. Exon 3 products from
children 2 and 3 of the proband were cloned, and plasmids
representing the nt 601G and 601 deleted G were identified,
indicating the two children were heterozygous for nt601delG
(Fig. 2). Sequencing of the CO (AQP1) coding exons and
flanking sequences found no additional changes, and all exon
acceptor and donor splice sites were wild type.
NT
CO*01N.06/CO*01
Co(a+b–)
Proband
NT
CO*01/CO*01
Co(a+b–)
CO*01N.06/CO*01
Co(a+b–)
CO*01N.06/CO*01N.06
Co(a–b–), Co:–3
Co(a+b–)
NT
NT
CO*01N.06/CO*01
Co(a+b–)
CO*01N.06/CO*01
Co(a+b–)
Fig. 2 Inheritance of the CO*1N.06 (nt601delG) allele in the proband
family. The proband is indicated with an arrow. The CO*1N.06 allele
is designated in gray ( ) and CO*1 allele in white ( ). Family
members that were not tested (NT) are indicated with diagonal lines
( ).
To confirm loss of expression of AQP1 protein and a
null phenotype, RBC membranes from the proband were
immunoblotted with a Co3 antibody. A 25-kDa band,
representing the AQP1 protein, was detected in the positive
control but was not present in RBCs from the proband
(Fig. 3).
3
S. Vege et al.
ê Proband
ê Normal Control
75 kDa è
59 kDa è
37 kDa è
25 kDa è
ç AQP1
15 kDa è
Fig. 3 Western blot analysis. RBC membranes from the proband
(Lane 1) and a normal control (Lane 2) immunoblotted with antiCo3. The 25-kDa band, representing the AQP1 protein, was
detected in the control but absent in the proband, as indicated.
Discussion
An AQP1 null allele with a deletion of G at nt 601 (601delG)
in exon 3 was identified in the proband, whose RBCs typed as
Co(a−b−), Co:–3. The deletion is on a CO*A allele and causes
a premature stop at position 201 (Val201Stop). Absence of the
AQP1 protein in the RBCs from the proband was confirmed by
Western blot. Molecular analysis of family members showed
Mendelian inheritance, with the null allele present in the
proband’s mother, one sibling, and two children.
The Co(a−b−) phenotype is extremely rare, and individuals
with this phenotype can make anti-Co3, which has been
associated with HDFN. In this report, the maternal titer was
assessed throughout multiple pregnancies and did not exceed
16 during gestation. Child 2 had a positive DAT (1+) with antiIgG and did not require treatment. Child 3 had a very weak
DAT (microscopically positive) reactive with anti-IgG, with no
treatment reported. Although autologous units were collected
from the proband, no units were transfused. The antibody
in this proband was not clinically significant as evidenced
by a titer less than 32 and asymptomatic children. Because
Co(a−b−) units are rare and anti-Co3 has been reported to
cause complications in pregnancy, and no compatible family
members were found, autologous units were recommended;
however, none of the babies required treatment for HDFN.
While this paper was under review, the same allele was
found in a Gypsy family; this AQP1 null CO*A(601delG)
allele16 is provisionally designated CO*01N.06 and joins five
other silencing null alleles that have been characterized for
AQP1 to date.
4
References
1.Daniels G. Human blood groups. 1st ed. Oxford: Blackwell
Science Ltd, 1995:507–13.
2. Reid ME, Lomas-Francis C. The blood group antigen factsbook.
San Diego: Academic Press, 1997:268–74.
3. Halverson GR, Peyrard T. A review of the Colton blood group
system. Immunohematology 2010;26:22–6.
4.Wagner FF, Flegel WA. A clinically relevant Co(a)-like
allele encoded by AQP1 (Q47R) (abstract). Transfusion
2002;42(Suppl):24–5S.
5.Arnaud L, Helias V, Menanteau C, et al. A functional AQP1
allele producing a Co(a–b–) phenotype revises and extends the
Colton blood group system. Transfusion 2010;50:2106–16.
6.Mathai, JC, Mori S, Smith BL, et al. Functional analysis of
aquaporin-1 deficient red cells. The Colton-null phenotype. J
Biol Chem1996;271:1309–13.
7. King, LS, Nielson S, Agre P, Brown RH. Decreased pulmonary
vascular permeability in aquaporin-1-null humans. Proc Natl
Acad Sci U S A 2002;99:1059–63.
8. Smith BL, Preston GM, Spring FA, Anstee DJ, Agre P. Human
red cell aquaporin CHIP.I. Molecular characterization of ABH
and Colton blood group antigens. J Clin Invest 1994;94:1043–9.
9. Preston GM, Smith BL, Zeidel ML, Moulds JJ, Agre P. Mutations
in aquaporin-1 in phenotypically normal humans without
functional CHIP water channels. Science 1994;265:1585–7.
10. Chrétien S, Catron JP. A single mutation inside the NPA motif
of aquaporin-1 found in a Colton-null phenotype (letter). Blood
1999;93:4021–3.
11. Joshi SR, Wagner FF, Vasantha K, Panjwani SR, Flegel WA.
An AQP1 null allele in an Indian woman with Co (a–b–)
phenotype and high-titer anti-Co3 associated with mild HDN.
Transfusion 2001;41:1273–8.
12. Karpasitout K, Frison S, Longhi E, et al. A silenced allele in the
Colton blood group system. Vox Sang 2010;99:158–62.
13.Savona-Ventura C, Grech ES, Zieba A. Anti-Co3 and severe
hemolytic disease of the newborn. Obstet Gynecol 1989;73
(5 Pt 2):870–2.
14. Larkin MA, Blackshields G, Brown NP, et al. Clustal W and
Clustal X version 2.0. Bioinformatics 2007;23:2947–8.
15. Marsh WL. Scoring of hemagglutination reactions. Transfusion
1972;12:352–3.
16. Saison C, Peyrard T, Landre C, et al. A new AQP1 null allele
identified in a Gypsy woman who developed an anti-CO3
during her first pregnancy. Vox Sang 2012;103:137–44.
Sunitha Vege, MS (corresponding author), Immunohematology
and Genomics Laboratory, New York Blood Center, 45-01 Vernon
Boulevard, Long Island City, NY 11101; Sandra Nance, MS, SBB, and
Donna Kavitsky, SBB, Immunohematology Reference Laboratory,
American Red Cross, Philadelphia, PA; Xiaojin Li, PhD, Department
of Molecular Medicine, Functional Genomics Core, Durate, CA;
Trina Horn, MS, National Molecular Laboratory, American Red
Cross, Philadelphia, PA; Geralyn Meny, MD, University of Texas
Health Science Center at San Antonio, San Antonio, TX; and Connie
M. Westhoff, PhD, Immunohematology and Genomics Laboratory,
New York Blood Center Long Island City, NY.
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Report
Warm autoantibodies: time for a change
J.R. Nobles and C. Wong
Routine adsorption procedures to remove autoantibodies from
patients’ serum often require many hours to perform. This timeconsuming process can create significant delays that affect patient
care. This study modified the current adsorption method to
reduce total adsorption time to 1 hour. A ratio of one part serum
to three parts red blood cells (RBCs; 1:3 method) was maintained
for all samples. The one part serum was split into three tubes.
Each of these three aliquots of serum was mixed with one full part
RBCs, creating three adsorbing tubes. All tubes were incubated
for 1 hour with periodic mixing. Adsorbed serum from the three
tubes was harvested, combined, and tested for reactivity. Fiftyeight samples were evaluated using both the current method
and the 1:3 method. Forty-eight (83%) samples successfully
adsorbed using both methods. Twenty (34.5%) samples contained
underlying alloantibodies. The 1:3 method demonstrated the
same antibody specificities and strengths in all 20 samples.
Eight samples failed to adsorb by either method. The 1:3 method
found previously undetected alloantibodies in three samples. Two
samples successfully autoadsorbed but failed to alloadsorb by
either method. The 1:3 method proved to be efficient and effective
for quick removal of autoantibodies while allowing for the
detection of underlying alloantibodies. Immunohematology
2013;29:5–10.
Key Words: autoantibody, alloantibody, autoadsorption,
alloadsorption
Red blood cell (RBC) autoantibodies, when present in the
serum of a patient, will react with the patient’s RBCs as well as
with all normal RBCs. These autoantibodies have the potential
of masking the presence of underlying clinically significant
alloantibodies. When a patient with warm autoantibodies
in the serum is in urgent need of an RBC transfusion, the
time-intensive adsorption process to remove autoantibodies
can adversely impact patient care. The current published
adsorption procedure1 (current method) used by reference
laboratories and transfusion services can require 4 to 6 hours
to complete and is not guaranteed to successfully remove the
autoantibodies.
A less time-consuming alternative is needed to expedite
the adsorption process and, at the same time, effectively remove
the warm autoantibodies. One method would be to increase
the RBC-to-serum ratio in an attempt to more effectively
remove autoantibodies. Increasing the ratio of RBCs provides
more antigen sites to adsorb the autoantibodies; however, this
method has been reported to cause dilution of the serum.1
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
This study evaluated a modified, less time-consuming
adsorption procedure that could potentially yield results
comparable to those produced by the current method. The
modified adsorption procedure involved adjusting the initial
serum-to-RBC volumes to a 1:3 ratio (1:3 method) and
thus making more antigen sites available to adsorb warm
autoantibodies.
Materials and Methods
Samples
A total of 58 patient samples known to contain warm
autoantibodies were obtained at random. Samples were
required to have exhibited autoantibody reactivity and to have
had either autologous or allogeneic adsorptions performed
using current methods. Three types of samples were used for
comparison testing: (1) those that successfully autoadsorbed or
alloadsorbed and demonstrated no underlying alloantibodies;
(2) those that successfully autoadsorbed or alloadsorbed and
demonstrated underlying alloantibodies; and (3) those that
did not successfully autoadsorb or alloadsorb and required
allogeneic adsorption using 20 percent polyethylene glycol
(PEG) prepared in-house (Sigma-Aldrich, St. Louis, MO).
Ficin Treatment of Adsorbing Cells
Ficin-treated allogeneic RBCs for warm adsorption were
selected to match the patient’s Rh, K, Kidd, and Ss phenotype.
The volume of RBCs was determined accordingly to yield the
required volume; a 3-mL aliquot was generally used. RBCs were
obtained from designated “adsorbing units.” The adsorbing
RBCs were washed once with 0.9 percent normal saline in
a large 16 × 100-mm test tube. The tube was centrifuged to
pack the cells, and as much supernatant saline was removed
as possible. The washed cells were treated with 1 percent ficin
prepared in-house (MP Biomedicals, Solon, OH) in the ratio
of 0.5 mL of ficin to 1 mL of cells. The tube was mixed several
times by inversion and incubated at 37°C for 15 minutes with
periodic mixing. The cells were washed three times with large
volumes of saline. For the last wash, the tube was centrifuged
for 10 minutes without a centrifuge brake to avoid disturbing
the RBC-saline interface. As much supernatant saline as
possible was removed to prevent subsequent dilution of serum.
5
J.R. Nobles and C. Wong
Adsorption Using the Current Published Method
All samples selected for this study had adsorptions
performed using the current method1 (Fig. 1). Equal volumes
of patient serum and ficin-treated adsorbing RBCs were
mixed and incubated at 37°C for 30 minutes to 1 hour with
periodic mixing. The tube was centrifuged for 5 minutes,
and the one-time adsorbed serum was harvested. Testing for
adsorption effectiveness was performed in the same phases for
which neat serum demonstrated reactivity and included the
following: low-ionic-strength saline (LISS)-37°C (ImmuAdd,
Low Ionic Strength Medium; Immucor, Norcross, GA), LISSantihuman globulin (AHG), and PEG-AHG. Tubes were
incubated at 37°C for 15 minutes for PEG and 20 minutes for
LISS-AHG. After washing four times with saline, two drops
of anti-IgG (Immucor) were added to each tube, and the tubes
were centrifuged and read for agglutination. Testing that
showed reactivity was followed with additional adsorptions.
Adsorption was repeated by transferring the one-time
adsorbed serum to another fresh aliquot of ficin-treated RBCs
for a second adsorption. If necessary, a maximum of three
total adsorptions were performed.
30- to 60-minute
incubation
1 part serum is
added to 1 part
red blood cells.
30- to 60-minute
incubation
First tube is spun for
5 minutes and serum
is added to second
tube containing equal
part of red blood cells.
30- to 60-minute
incubation
Second tube is spun for
5 minutes and serum
is added to third tube
containing equal part
of red blood cells.
Third tube is spun for
5 minutes and
adsorbed serum is
tested for adsorption
effectiveness.
Time* per procedure = 105–195 minutes
*Time for tests performed between adsorptions is not included.
Fig. 1 Current adsorption procedure.
Adsorption Using the Modified 1:3 Method
Adsorption using the modified method was similar to that
using the current method except the initial serum-to-cell ratio
was modified to a ratio of one part patient’s serum to three
parts RBCs (1:3 method; Fig. 2). The same adsorbing RBCs
used in the original case workup, if adsorbed with allogeneic
RBCs, were ficin-treated and dispensed into three separate
12 × 75-mm test tubes. Using a plastic Pasteur pipette, for
every three drops of RBCs, one drop of patient’s serum was
added to yield a ratio of one part serum to three parts RBCs in
each tube (1:3 ratio). The cell-serum mixture was mixed and
incubated at 37°C for 1 hour with mixing every 10 minutes.
An hour of incubation was allowed to best mimic the total
adsorption time possible for a routine three-time adsorption.
6
1 part serum is added to 3 parts
red blood cells in 3 tubes at the
same time.
A 60-minute incubation time is allowed.
Tubes are spun and the adsorbed serum
from all the tubes is recombined.
Adsorbed serum is then tested for
adsorption effectiveness.
Time per procedure = 65 minutes
Fig. 2 Modified 1:3 adsorption procedure.
The three tubes were centrifuged for 5 minutes, and the
adsorbed serum from all three tubes was combined into a
single test tube. Three separate adsorbing tubes, as opposed to
only one, were created to best mimic the adsorption conditions
used when performing a three-time adsorption following the
current published method. Adsorptions using the modified 1:3
method were performed within 1 to 9 days after the original
antibody workup (average, 3 days). Samples were stored at 2°
to 4°C if testing was to be performed within 5 days. Samples
were frozen if testing was to be performed longer than 5 days
after the original antibody workup.
Testing of Adsorbed Serum from the 1:3 Method
The adsorbed serum was tested against screening
cells if the original adsorbed patient sample demonstrated
no underlying alloantibodies and against the selected cell
panel used for the original antibody workup if the original
patient sample demonstrated underlying alloantibodies. If
alloantibody reactivity was detected with screening cells, a
full panel and selected cells were tested to make identification.
Testing was performed in the same phases that showed
reactivity in the original case and included the following:
LISS-37°C, LISS-AHG, and PEG-AHG. The effectiveness
of the 1:3 method was then compared with previous results
obtained from standard adsorption testing.
Statistics
Adsorption results of the 1:3 method were compared
with those of the current method. If present, reactivity of each
alloantibody in the adsorbed serum was scored for each method
using the published scoring system.1 Data were statistically
analyzed using the paired t test. The level of significance was
established at a probability value of less than 0.05.
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Warm autoadsorption
Results
Results of the 1:3 method showed 48 of 58 samples
(83%) successfully adsorbed, matching the current method
(Table 1). Of those 48 samples with successful adsorptions,
20 (34.5%) were known from previous testing to contain
alloantibodies. Eight samples failed to be fully adsorbed by
either method. Three samples (26, 27, and 28) demonstrated
underlying alloantibodies (two anti-E, one anti-f) with only
the 1:3 method. Two samples (57 and 58), which previously
were successfully adsorbed using autologous RBCs, failed
to adsorb using allogeneic RBCs with both the current and
1:3 methods on parallel testing. Two samples (30 and 39)
contained underlying IgG antibodies of unknown specificity.
In the 20 samples known to contain underlying alloantibodies,
the 1:3 method demonstrated the same antibody specificities
and comparable reaction strengths as the current method (p
= 0.82), with one sample (38) showing a stronger reaction by
the 1:3 method than by the current method (Table 2). Sample
30 was reactive 1+ LISS-AHG with three of nine panel cells.
Sample 39 was reactive 2+ LISS-AHG and PEG-AHG with
four of eight panel cells.
Discussion
An important component of pretransfusion testing is to
detect clinically significant alloantibodies.2 Patients with warm
autoantibodies in their serum present a unique and challenging
problem because the autoantibodies are broadly reactive,
reacting with almost all RBCs tested. Warm autoantibodies
are the most common cause of autoimmune hemolytic anemia
(AIHA), with the incidence of these antibodies increasing with
patient age.3 Although hemolytic transfusion reactions can
occur when patients with clinically significant alloantibodies
are transfused with RBCs carrying antigens corresponding
to the alloantibodies,4 acute reactions are unlikely when RBC
incompatibility is caused by autoantibody alone. Survival
of transfused RBCs is generally the same as survival of the
patient’s own RBCs, and transfusion can be expected to have
significant temporary benefit.3,5,6
Patients with AIHA can have autoantibodies present
in their serum. Warm autoantibodies can cause serologic
anomalies including spontaneous agglutination that can
result in discrepant ABO and Rh testing. More importantly,
warm-reactive autoantibodies can mask the presence of
clinically significant alloantibodies. Published data indicate
that alloantibodies were detected in 209 of 647 serum samples
(32%) of patients with AIHA.7 Undetected alloantibodies
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
may cause increased hemolysis after transfusion, which can
be falsely attributed to an increase in the severity of AIHA.3,8
Furthermore, although fatalities caused by undetected
clinically significant alloantibodies have declined in recent
years,9 the detection of these alloantibodies is still necessary to
prevent serious outcomes. When blood transfusion is ordered
for a patient with autoantibodies in the serum, specialized
serologic testing including adsorption studies, patient
phenotyping, and eluate testing are helpful.10 A knowledge of
the patient’s complete phenotype is useful to predict which
clinically significant alloantibodies can potentially be present
in the patient’s serum.
One of the most important testing procedures for a
patient with AIHA, especially if the patient has a history
of pregnancy or transfusion, is adsorption testing to
remove autoantibody from the patient’s serum and allow
for the detection and identification of clinically significant
alloantibodies.1 Adsorption using autologous RBCs is the best
procedure to detect clinically significant antibodies. However,
autoadsorption should not be performed on samples from
patients who have been recently transfused because transfused
donor RBCs might adsorb alloantibodies, resulting in a falsely
negative test result.
For patients with recent transfusions, the use of allogeneic
RBCs is helpful in adsorbing autoantibodies, leaving behind
alloantibodies in the adsorbed serum.1 If the patient’s
phenotype is known, one allogeneic adsorbing cell can be
selected to match the patient’s phenotype.1 The selection
of cells is made easier by enzyme treating the allogeneic
absorbing cells to destroy the MNS and Duffy antigens.1 When
the patient’s phenotype is unknown, differential adsorption
can be performed using group O RBCs of three different Rh
phenotypes: R1R1, R2R2, and rr; one cell should lack the Jka
antigen, and another should lack the Jkb antigen.1 Aliquots
from each Rh phenotype are prepared and three separate
adsorptions are performed, one with each Rh phenotype.
Adsorbed serum from each adsorption can only be used to rule
out alloantibodies corresponding to the antigens lacking on
each adsorbing RBC phenotype. For example, R2R2 Jk(a–b+)adsorbing RBCs can be used to rule out alloantibodies specific
for C, e, f, and Jka and not D, E, c, or Jkb.
Adequate testing to detect alloantibodies in the serum of a
patient with autoantibodies may take 4 to 6 hours. Adsorption
testing using the current method1 is time consuming and often
results in delay of patient transfusion. Also, should routine
allogeneic adsorption fail to remove alloantibody reactivity,
a PEG-allogeneic adsorption should be performed.11 PEGallogeneic adsorption is a faster adsorption method involving
7
J.R. Nobles and C. Wong
Table 1. Summary of data from all samples tested
Sample
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
Autologous
adsorption
Allogeneic
adsorption
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X (PEG)
X (PEG)
X (PEG)
X (PEG)
X (PEG)
X (PEG)
X (PEG)
X (PEG)
X
X
Number of
adsorptions
required
Underlying alloantibodies detected by
current method
Underlying alloantibodies
detected by 1:3 adsorption
method
1:3 method successful at removing autoantibody
reactivity?
1
2
2
3
2
1
3
3
1
1
1
2
2
1
3
1
2
1
2
1
2
1
2
3
3
3
3
2
3
3
3
1
2
3
3
3
2
1
3
1
2
1
1
2
1
2
1
2
2
2
2
3
3
3
3
2
2
3
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
Anti-E
Anti-K, unknown IgG
Anti-E
Anti-E
Anti-E
Anti-E
Anti-E
Anti-E
Anti-Jka
Anti-E
Unknown IgG
Anti-S
Anti-K
Anti-E
Anti-E, -Jk b, -S
Anti-E, -C
Anti-E
Anti-E
Anti-C, -E
Anti-C, -K, -S
None
None
None
Unknown IgG
Anti-C, -K, -Jk b, -M, -S
None
None
None
None
Anti-s
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
None
Anti-E
Anti-f
Anti-E
Anti-E
Anti-K, unknown IgG
Anti-E
Anti-E
Anti-E
Anti-E
Anti-E
Anti-E
Anti-Jka
Anti-E
Unknown IgG
Anti-S
Anti-K
Anti-E
Anti-E, -Jk b, -S
Anti-E, -C
Anti-E
Anti-E
Anti-C, -E
Anti-C, -K, -S
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
No - required PEG adsorption
No - required PEG adsorption
No - required PEG adsorption
No - required PEG adsorption
No - required PEG adsorption
No - required PEG adsorption
No - required PEG adsorption
No - required PEG adsorption
No - only autologous adsorption successful
No - only autologous adsorption successful
PEG = polyethylene glycol.
8
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Warm autoadsorption
Table 2. Comparison of reactivity of alloantibodies in adsorbed
serum using current and 1:3 methods
Alloantibodies:
current method
Reaction*
Score
Alloantibodies:
1:3 method
Reaction*
Score
29
Anti-E
1+
5
Anti-E
1+
5
30
Anti-K
Unknown IgG
1+
1+
5
5
Anti-K
Unknown IgG
1+
1+
5
5
31
Anti-E
1+
5
Anti-E
1+
5
32
Anti-E
3+
10
Anti-E
3+
10
33
Anti-E
3+
10
Anti-E
3+
10
34
Anti-E
2+
8
Anti-E
2+
8
35
Anti-E
2+
8
Anti-E
2+
8
36
Anti-E
3+
10
Anti-E
3+
10
37
Anti-Jka
2+
8
Anti-Jka
2+
8
38
Anti-E
1+
5
Anti-E
2+
8
39
Unknown IgG
2+
8
Unknown IgG
2+
8
40
Anti-S
2+
8
Anti-S
2+
8
41
Anti-K
2+
8
Anti-K
2+
8
42
Anti-E
2+
8
Anti-E
2+
8
43
Anti-E
Anti-Jk b
Anti-S
2+
1+
1+
8
5
5
Anti-E
Anti-Jk b
Anti-S
2+
1+
1+
8
5
5
44
Anti-E
Anti-C
2+
1+
8
5
Anti-E
Anti-C
2+
1+
8
5
45
Anti-E
3+
10
Anti-E
3+
10
46
Anti-E
2+
8
Anti-E
2+
8
47
Anti-E
Anti-C
2+
2+
8
8
Anti-E
Anti-C
2+
2+
8
8
Sample
48
Anti-C
2+
8
Anti-C
2+
8
Anti-K
3+
10
Anti-K
3+
10
Anti-S
1+
5
Anti-S
1+
5
*Reaction based on reactivity at the strongest phase (either low-ionicstrength saline [LISS]-antihuman globulin [AHG] or polyethylene glycol
[PEG]-AHG).
adsorption with one part RBCs, one part PEG, and one part
serum for 15 minutes up to a total of three adsorptions. After
adsorption, four to six drops of PEG-adsorbed serum are used
to test with each panel cell originally reactive with neat serum.
Additional enhancement media are not needed because of
the PEG present in the PEG-adsorbed serum. Although
PEG adsorption is a faster procedure than routine allogeneic
adsorption, there is the risk that weak alloantibodies will
not be detected.12 Knowing sooner whether PEG adsorption
is necessary aids in reducing the overall turnaround time of
making blood available for transfusion.
This study showed that the 1:3 method gave results
comparable to those of the current adsorption method, and
in much less time, for those samples that originally required
more than one adsorption. Of the 58 serum samples selected
at random for this study, 48 were successfully adsorbed using
both the current and 1:3 methods. Of these 48 samples,
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
20 (34.5%) contained underlying alloantibodies, which is
consistent with the average of 32 percent from published
data.7 In all 20 samples with underlying alloantibodies, the
1:3 method demonstrated the same antibody specificities and
reaction strengths as the current method, with one sample
yielding stronger alloantibody reactivity in the 1:3 method.
Eight samples that failed to be adsorbed by the current method
also failed with the 1:3 method. The modified 1:3 method
detected underlying alloantibodies in three samples that were
not detected using the current method. Two samples that
successfully adsorbed in previous testing using autologous
RBCs failed to adsorb by the 1:3 method using allogeneic
adsorbing RBCs. Further parallel adsorption testing using
two separate allogeneic adsorbing RBCs showed both samples
failed to adsorb using both the current and 1:3 methods. An
explanation could not be found in either of the two samples
that successfully autoadsorbed, but failed to alloadsorb by
routine methods, as to why only autologous adsorption could
remove autoantibody reactivity.
Other studies13–15 reported that reductions in adsorption
incubation times to as little as 10 minutes are equally effective
as currently accepted standard methods. Possible future studies
could combine this 1:3 method with a shortened incubation
time to evaluate whether autoantibodies could still be effectively
removed without adverse impact on the final results.
Summary
Standard adsorptions can require 4 to 6 hours; the 1:3
method required approximately 1 to 1.5 hours for the entire
adsorption process. In conclusion, this study showed the 1:3
method of using one part patient’s serum to three parts RBCs
to be time efficient as well as effective for quick removal of
autoantibodies while allowing for the detection of underlying
alloantibodies.
References
1. Roback JD, Combs MR, Grossman BJ, Harris T, Hillyer CD.
Technical manual. 17th ed. Bethesda, MD: AABB, 2011.
2.Carson TH, ed. Standards for blood banks and transfusion
services. 27th ed. Bethesda, MD: AABB, 2011.
3. Petz LD, Garratty G. Immune hemolytic anemias. 2nd ed. New
York: Churchill Livingstone, 2004.
4.Jenner PW, Holland PV. Diagnosis and management of
transfusion reactions. In: Petz LD, Swisher SN, Kleinman S,
eds. Clinical practice of transfusion medicine. 3rd ed. New
York: Churchill-Livingstone, 1996:905–29.
5. Garratty G, Petz LD. Transfusing patients with autoimmune
haemolytic anaemia. Lancet 1993;341:1220.
9
J.R. Nobles and C. Wong
6.Salama A, Berghöfer H, Mueller-Eckhardt C. Red blood cell
transfusion in warm-type autoimmune haemolytic anaemia.
Lancet 1992;340:1515–17.
7. Branch DR, Petz LD. Detecting alloantibodies in patients with
autoantibodies. Transfusion 1999;39:6–10.
8.Petz LD. Blood transfusion in acquired hemolytic anemias.
In: Petz LD, Swisher SN, Kleinman S, eds. Clinical practice of
transfusion medicine. 3rd ed. New York: Churchill Livingstone,
1996:469–99.
9.Fatalities reported to FDA following blood collection
and transfusion: annual summary for fiscal year 2010.
Available at http://www.fda.gov/BiologicsBloodVaccines/
SafetyAvailability/ReportaProblem/TransfusionDonation
Fatalities/ucm254802.htm. Accessed February 6, 2012.
10. Blackall DP. How do I approach patients with warm-reactive
autoantibodies? Transfusion 2011;51:14–17.
11. Barron CL, Brown MB. The use of polyethylene glycol (PEG) to
enhance the adsorption of autoantibodies. Immunohematology
1997;13:119–22.
12.Judd WJ, Dake L. PEG adsorption of autoantibodies causes
loss of concomitant alloantibody. Immunohematology 2001;17:
82–5.
Notice to Readers
All articles published, including communications and book
reviews, reflect the opinions of the authors and do not
necessarily reflect the official policy of the American Red
Cross.
J. Ryan Nobles, MT(CM)SBB(CM) (corresponding author),
Consultation Specialist, Training Coordinator, and Clare Wong,
MT(ASCP)SBB,SLS, Manager, SBB School External Education,
Gulf Coast Regional Blood Center, Consultation and Reference
Laboratory, 1400 La Concha Lane, Houston, TX 77054.
Attention:
State Blood Bank Meeting Organizers
If you are planning a state meeting and would like copies
of Immunohematology for distribution, please send request,
4 months in advance, to [email protected]
For information concerning the National Reference
Immunohematology is on the Web!
Laboratory for Blood Group Serology, including the American
www.redcross.org/about-us/publications/
immunohematology
Rare Donor Program, contact Sandra Nance, by phone at
(215) 451-4362, by fax at (215) 451-2538, or by e-mail at
[email protected]
10
13.McConnell G, Kezeor K, Kosanke J, Hinrichs M, Reddy R.
Warm autoantibody adsorption time may be successfully
shortened to 15 minutes (abstract). Transfusion 2008;48:232A.
14.Fueger J, Hamdan Z, Johnson S. Ten-minute autoantibody
adsorptions: they really work! (abstract). Transfusion 2008;48:
230A.
15.Magtoto-Jocom J, Hodam J, Leger RM, Garratty G.
Adsorption to remove autoantibodies using allogeneic red cells
in the presence of low ionic strength saline for detection of
alloantibodies (abstract). Transfusion 2011;51:174A.
For more information, send an e-mail to
[email protected]
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Case R ep ort
Major non-ABO incompatibility caused
by anti-Jka in a patient before allogeneic
hematopoietic stem cell transplantation
M.Y. Kim, P. Chaudhary, I.A. Shulman, and V. Pullarkat
A 49-year-old white man with blood group AB, D+ was found to
have alloanti-Jka and -K when he developed a delayed hemolytic
transfusion reaction before allogeneic hematopoietic stem cell
transplant (HSCT). Given that his stem cell donor was blood group
O, D+, Jk(a+), K–, rituximab was added to his conditioning regimen
of fludarabine and melphalan to prevent hemolysis of engrafting
Jk(a+) donor red blood cells. The patient proceeded to receive a
peripheral blood stem cell transplant from a matched unrelated
donor with no adverse events. To our knowledge, this is the first
case of successful management of major non-ABO incompatibility
caused by anti-Jka in a patient receiving an allogeneic HSCT
reported in the literature. Immunohematology 2013;29:
11–14.
Key Words: anti-Jka, major incompatibility, hematopoietic
stem cell transplantation
ABO mismatch is well characterized in the setting of
hematopoietic stem cell transplant (HSCT). Because of the
disparate genetic locations of HLA and ABO genes, ABO
mismatch occurs in 30 to 50 percent of transplants.1 Red
blood cell (RBC)–incompatible transplantation does not
seem to have an adverse effect on transplant outcomes, such
as engraftment, graft-versus-host disease (GVHD), relapse,
or survival.2 However, it does carry the risk of hemolytic
transfusion reactions (HTR), and it must be managed
appropriately with interventions such as graft processing and
proper blood component support.
RBC incompatibility can be classified into two categories.
Major incompatibility is when the recipient has antibodies
directed against donor RBC antigens. Minor incompatibility
is defined as a donor having antibodies directed against
recipient RBC antigens. Bidirectional incompatibility, usually
in a group A donor with a group B recipient or vice versa, is
when there is both major and minor incompatibility. Major
incompatibility carries the risk of acute HTR and also delayed
RBC recovery after transplant. Minor incompatibility can
result in “passenger lymphocyte syndrome,” in which the
donor B lymphocytes produce antibodies against recipient
RBCs that cause a delayed hemolytic transfusion reaction 7 to
12 days after transplantation.
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Patients undergoing HSCT require frequent RBC
transfusions owing to both the underlying disease and
treatment with chemotherapy or radiation.3 Frequent
transfusions predispose patients to developing alloantibodies
to non-ABO RBC antigens. RBC alloantibodies may become
undetectable over time and with restimulation can cause
a delayed HTR if their past existence is not known before
transfusion.4 Non-ABO antigens such as those in the Rh, Kell,
and Kidd blood group systems have been implicated as targets
for passenger lymphocyte syndrome after transplant.5–8
We present a patient who developed an unusual form
of bidirectional incompatibility in the form of minor ABO
incompatibility, being a group AB recipient with a group O
donor, and major non-ABO incompatibility, with preformed
anti-Jka directed against the donor’s Jk(a+) RBCs.
Case Report
A 49-year-old man was diagnosed with primary
myelofibrosis in 2007. He was treated with hydroxyurea
until May 2011, when he developed worsening anemia and
thrombocytopenia that did not improve after hydroxyurea was
discontinued. Bone marrow biopsy revealed advanced reticulin
fibrosis. The patient had massive splenomegaly of 26 cm. His
blood group was AB, D+, and he had a negative screening test
for RBC alloantibodies. He had received 38 units of group AB,
D+ RBC transfusions over a period of 8 months. Because his
antibody screening test was negative, neither the patient nor
any of the 38 RBC units were phenotyped for antigens beyond
the standard A, B, and D. At this point it was decided that the
patient needed an allogeneic HSCT.
The patient was admitted to our hospital for a matched
unrelated donor HSCT. He received reduced-intensity
conditioning with fludarabine 25 mg/m2/day given
intravenously from Day –9 to Day –5 and melphalan 140 mg/
m2 given intravenously on Day –4. GVHD prophylaxis was
initiated with tacrolimus 0.02 mg/kg/day continuous infusion
starting on Day –3 and sirolimus 12 mg on Day –3 and 4 mg
11
M.Y. Kim et al.
daily thereafter. Peripheral blood stem cells were mobilized
from the donor with granulocyte colony-stimulating factor,
and 8 × 106 CD34+ cells/kg were infused into patient. Patient
and donor were 10 of 10 HLA matched, with minor ABO
incompatibility as the donor was group O, D+.
On admission to our hospital, the patient’s screening
test for unexpected RBC antibodies was positive, but no
specific antibody could be identified. Because of the positive
antibody screen and because the prospective stem cell donor
was group O, RBC units selected for transfusion were group
O, D+ and crossmatched using an indirect antiglobulin test.
On pretransplant Day –8, the patient was transfused with one
RBC unit as his hemoglobin was 7.3 g/dL. On pretransplant
Day –6, the patient received an additional two units of RBCs
as his hemoglobin was again low, 6.8 g/dL. On pretransplant
Day –5, the patient was found to have an anti-Jka. On further
review it was found that one of the RBC units transfused
on Day –6 was Jk(a+). At this point the patient’s direct
antiglobulin test (DAT) was positive with IgG and C3 coating
his RBCs. An eluate prepared from his RBCs contained antiJka. On Day –4, the patient’s hemoglobin dropped from 8.4
g/dL to 6 g/dL, his lactate dehydrogenase (LDH) rose to 942
IU/L, and his total bilirubin rose to 2.8 mg/dL, all consistent
with a delayed HTR (Fig. 1). He required five units of RBCs
to maintain an adequate hemoglobin level over the next 3
days. Given that the donor was Jk(a+), one dose of rituximab
375 mg/m2 intravenously was added on Day –3 to prevent
hemolysis after donor cell engraftment, as well as to reduce
likelihood of passenger lymphocyte engraftment given the
minor ABO incompatibility.
On pretransplant Day –2, the patient was also found
to have an anti-K. No RBC units transfused during this
admission were positive for K and the donor was K–, so this
was not investigated further.
Materials and Methods
The patient’s ABO/D status was verified using
monoclonal anti-A, -B, and -D reagents (BioClone, Ortho
Clinical Diagnostics, Inc., Raritan, NJ). Initial screens for
RBC antibodies were performed using the gel test (MTS
Anti-IgG Card, Micro Typing Systems, Inc., Pompano Beach,
FL). Monoclonal anti-Jka typing reagent (BioClone) was
used to detect circulating Jk(a+) RBCs. Monoclonal anti-IgG,
Fig. 1 Patient’s hemoglobin (Hb), lactate dehydrogenase (LDH), and bilirubin (T-bili) trend during transplant (occurring on Day 0). Each arrow
at the top of the graph represents one transfused unit of red blood cells (RBCs). Solid arrows represent group O, D+, Jk(a–) RBC units;
dashed arrow represents the one group O, D+, Jk(a+) RBC unit the patient received on Day –6. Anti-Jka was detected on Day –5.
12
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Non-ABO incompatibility in transplant by anti-Jka
-C3d, polyspecific AHG (BioClone) were used to perform the
DAT. Monoclonal Anti-AB containing the ES4 clone (antiA,B Murine Monoclonal Blend Series 1, Immucor Gamma,
Norcross, GA) was used to type the patient’s ABO status after
transplant. Both the gel test (MTS, Anti-IgG card, Ortho) and
automated solid-phase capture assay (Galileo Echo; Immucor
Gamma) were used to serially monitor the patient’s anti-Jka.
Results
By the day of transplantation, the patient’s hemoglobin
had stabilized, and LDH and bilirubin were back to baseline.
After transplantation, the patient received daily RBC
transfusions with group O, D+, Jk(a–), K– RBCs from Day +4
to Day +10; during this time there was no increase in markers
of hemolysis, and the DAT remained negative. The patient
achieved neutrophil engraftment on Day +11. On the same
day, the patient first typed macroscopically as group O, D+
Jk(a–), a reflection of the 11 units of matched RBCs transfused
during the preceding 2 weeks. On Day +21, the patient typed
as O+, Jk(a+), indicating successful RBC reconstitution with
donor erythropoiesis. Of note, with standard anti-A and anti-B
typing, the patient forward typed as group O; however, with
anti-A/B from an ES4 clone, the patient continued to show 1+
reactivity.
The patient’s anti-Jka was initially detected at a titer of 2 on
Day –5. On serial monitoring, the titer decreased to 1 on Day
+14 and became undetectable using gel-column assay (MTS
Anti-IgG card, Ortho) on Day +17. Using solid-phase adherence
assay (Capture, Immucor) the antibody was still detected until
Day +40, converted to negative on Day +49, and remained
so thereafter. Despite the persistence of detectable antibody,
the patient required only two additional units of RBCs, one
each on Day +24 and Day +40, and his posttransplant course
remained uneventful otherwise.
Discussion
In this case, we report a patient who developed
alloantibodies to both Jka and K before allogeneic HSCT.
Neither of these antibodies was detectable during the
time leading up to his admission for HSCT, during which
period his transfusion support was provided outside of our
institution. Although we do not know the Jka status of his prior
transfusions, the prevalence of Jka and K suggest that at
least 15 of the 20 units he received in the 3 months before
admission would have been Jk(a+), and 2 units would have
been K+. Unfortunately, the patient had almost completed his
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
conditioning regimen for HSCT when the anti-Jka and -K were
identified. This example of anti-Jka detected in our patient
was clinically significant as evidenced by its ability to cause
a delayed HTR, necessitating aggressive RBC transfusion
support for a short time before transplant. There is scant
literature available about the management of this type of
situation.
The paucity of data regarding this issue likely is
because patients undergoing HSCT have a low incidence of
alloantibodies relative to the number of RBC transfusions
they receive.9 The lack of alloimmunization is thought to be
related to the intense chemotherapy given to patients for their
underlying hematologic disease before transplant. Patients
like ours constitute a minority of HSCT candidates who did
not receive chemotherapy other than hydroxyurea before
transplant, and this may have increased his likelihood of
developing RBC alloantibodies.
Even when patients have alloantibodies, the traditional
conditioning regimen before HSCT with chemotherapy or
radiation will usually prevent these antibodies from being able
to act effectively against donor RBCs. In one study, of 14 patients
who were found to have alloantibodies before transplant, all
but one no longer had detectable antibodies after transplant,9
supporting the hypothesis that RBC alloantibodies can be
eradicated in patients with HSCT.
However, as the indications for HSCT expand to include
nonmalignant diseases such as thalassemia and sickle cell
disease, and the use of reduced-intensity conditioning regimens
continues to increase, non-ABO incompatibility issues may
become a more prevalent problem in the future. For example,
Borge et al.10 reported a patient with sickle cell disease who also
had anti-Jka and received HSCT from a Jk(a+) donor. In this
case the recipient had delayed RBC engraftment that persisted
for more than 180 days after transplant. A nonmyeloablative
conditioning regimen was used, consisting of alemtuzumab
1 mg/kg and a single dose of total body irradiation 300 cGy,
while oral sirolimus was used for prevention of GVHD.11
Although we also used a reduced-intensity conditioning
regimen, we believe that in our patient the immunosuppressive
agents, fludarabine and rituximab, were key in preventing
potential problems. Fludarabine, a purine nucleoside analog,
is a highly immunosuppressive agent that causes myelosuppression and prolonged reduction of CD4+ lymphocytes.12
Rituximab is an anti-CD20 monoclonal antibody that
selectively depletes circulating B cells, thus preventing antibody
production.13 These two agents in combination effectively
target all the immune cells required to generate an HTR.
Eventually, with achievement of complete donor chimerism,
13
M.Y. Kim et al.
the donor immune cells would be expected to completely
eliminate any residual alloantibody-producing cells.
For ABO-incompatible HSCT, delayed RBC engraftment
has been associated with the length of time for the
isohemagglutinin titers to decrease to clinically insignificant
levels (1+ or lower in strength).14 In our case, the initial
anti-Jka titer was 2 and became 1+ on Day +14, while donor
erythropoiesis was established on Day +21. Thus, it may be
useful to monitor antibody titers in the non-ABO–incompatible
HSCT setting as an early indicator of whether successful donor
erythropoiesis may be achieved. Whether high initial titers or
persistent antibody detection warrants further intervention
has yet to be determined.
Of note, the increased sensitivity of laboratory methods
used in the detection of RBC antigens and antibodies may
also cause RBC compatibility issues in HSCT to become more
prevalent in the future. For instance, the anti-Jka in our patient
could be detected on solid-phase capture assay up to 32 days
after the gel-column assay became negative. Also, although the
patient first typed as blood group O on Day +11, he continued
to have detectable A and B on his RBCs when using the more
sensitive assay with the ES4 clone.
In conclusion, we present the case of a patient with minor
ABO and major non-ABO mismatch who successfully received
matched unrelated donor HSCT. We believe that major nonABO mismatch is an underreported phenomenon that
usually does not lead to clinically significant consequences,
and clinicians should not be discouraged from using a major
non-ABO–incompatible donor if such an incompatibility
is discovered before HSCT. However, close monitoring of
the recipients with markers for serum hemolysis should be
performed during HSCT because severe hemolysis can occur
in such situations. Monitoring antibody titers may also be
helpful in predicting its clinical relevance. Depending on the
level of concern, rituximab may be an additional strategy to
use in this situation to avoid hemolysis and ensure successful
RBC engraftment. We feel that this is a clinical situation that
may become more common in the future given changing
patterns of HSCT and the increased sensitivity of assays used
to detect RBC antigens and antibodies.
References
1.Mielcarek M, Leisenring W, Torok-Storb B, Storb R. Graftversus-host disease and donor-directed hemagglutinin
titers after ABO-mismatched related and unrelated marrow
allografts: evidence for a graft-versus-plasma cell effect. Blood
2000;96:1150–6.
14
2.Rowley SD, Donato ML, Bhattacharyya P. Red blood cellincompatible allogeneic hematopoietic progenitor cell
transplantation. Bone Marrow Transplant 2011;46:1167–85.
3. Schonewille H, Haak HL, van Zijl AM. Alloimmunization after
blood transfusion in patients with hematologic and oncologic
diseases. Transfusion 1999;39:763–71.
4. Ramsey G, Larson P. Loss of red cell alloantibodies over time.
Transfusion 1988;28:162–5.
5.Leo A, Mytilineos J, Voso MT, et al. Passenger lymphocyte
syndrome with severe hemolytic anemia due to an anti-Jka after
allogeneic PBPC transplantation. Transfusion 2000;40:632–6.
6. Young PP, Goodnough LT, Westervelt P, Diersio JF. Immune
hemolysis involving non-ABO/RhD alloantibodies following
hematopoietic stem cell transplantation. Bone Marrow
Transplant 2001;27:1305–10.
7.Adams BR, Miller AN, Costa LJ. Self-limited hemolysis due
to anti-D passenger lymphocyte syndrome in allogeneic
hematopoietic stem cell transplantation. Bone Marrow
Transplant 2009;45:772–3.
8.López A, de la Rubia J, Arriaga F, et al. Severe hemolytic
anemia due to multiple red cell alloantibodies after an ABOincompatible allogeneic bone marrow transplant. Transfusion
1998;38:247–51.
9.Perseghin P, Balduzzi A, Galimberti S, et al. Red blood cell
support and alloimmunization rate against erythrocyte
antigens in patients undergoing hematopoietic stem cell
transplantation. Bone Marrow Transplant 2003;32:231–6.
10.Borge PD, Stroka-Lee AH, Hsieh MM, et al. Delayed red
blood cell chimerism in an HSC transplant for sickle cell
disease associated with a non-ABO alloantibody (abstract).
Transfusion 2010;50(Suppl 2):155A.
11.Hsieh MM, Kang EM, Fitzhugh CD, et al. Allogeneic
hematopoietic stem-cell transplantation for sickle cell disease.
N Engl J Med 2009;361:2309–17.
12. Fenchel K, Bergmann L, Wijermans P, et al. Clinical experience
with fludarabine and its immunosuppressive effects in
pretreated chronic lymphocytic leukemias and low-grade
lymphomas. Leuk Lymphoma 1995;18:485–92.
13.Zecca M, Nobili B, Ramenghi U, et al. Rituximab for the
treatment of refractory autoimmune hemolytic anemia in
children. Blood 2003;101:3857–61.
14.Bolan CD, Leitman SF, Griffith LM, et al. Delayed donor
red cell chimerism and pure red cell aplasia following major
ABO-incompatible nonmyeloablative hematopoietic stem cell
transplantation. Blood 2001;98:1687–94.
Miriam Y. Kim, MD (corresponding author), Hematology/Oncology
Fellow, and Preeti Chaudhary, MD, Hematology/Oncology Fellow,
Jane Anne Nohl Division of Hematology, Keck School of Medicine,
University of Southern California, 1441 Eastlake Ave, NOR 3461, Los
Angeles, CA 90033; Ira A. Shulman, MD, Director of Laboratories,
Department of Pathology, Los Angeles County-University of
Southern California Medical Center, Los Angeles, CA; and Vinod
Pullarkat, MD, Associate Professor of Clinical Medicine, Jane Anne
Nohl Division of Hematology, Keck School of Medicine, University of
Southern California, Los Angeles, CA.
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Case R ep ort
A case of autoimmune hemolytic anemia with
anti-D specificity in a 1-year-old child
R.S. Bercovitz, M. Macy, and D.R. Ambruso
Although antibodies to antigens in the Rh blood group system
are common causes of warm autoimmune hemolytic anemia,
specificity for only the D antigen is rare in autoimmune hemolysis
in pediatric patients. This case reports an anti-D associated
with severe hemolytic anemia (Hb = 2.1 g/dL) in a previously
healthy 14-month-old child who presented with a 3-day history
of low-grade fevers and vomiting. Because of his severe anemia,
on admission to the hospital he was found to have altered
mental status, metabolic acidosis, abnormal liver function tests,
and a severe coagulopathy. He was successfully resuscitated
with uncrossmatched units of group O, D– blood, and after
corticosteroid therapy he had complete resolution of his anti-Dmediated hemolysis. Immunohematology 2013;29:15-18.
Key Words: autoimmune hemolytic anemia, pediatrics,
anti-D
Autoimmune hemolytic anemia (AIHA) is the pathological
destruction of red blood cells (RBCs) by antibodies produced
against self-erythrocyte surface antigens. Its prevalence is
estimated to be approximately 1 to 3 per 100,000 per year,
although it may be lower in pediatric patients.1–4 Warm AIHA
is usually caused by immunoglobulin G (IgG) antibodies that
bind to RBC antigens and result in erythrophagocytosis by
splenic macrophages or hepatic Kupffer cells. In many cases,
antigen specificity cannot be determined, or patients express
pan-reactivity across antigen groups. However, there have
been reports of specificity to as many as 50 RBC antigens
with anti-e being one of the most common specificities cited
in reviews.4–6
AIHA can be either a primary or a secondary disease,
usually as a result of an underlying autoimmune disease,
primary immunodeficiency, or lymphoid malignancy; it can
present in a known primary process or as part of its initial
presentation.4,7,8 In adult patients primary AIHA represents
approximately 60 percent of cases.9 In case series of pediatric
patients, the proportion of patients with primary AIHA
has ranged from 7 to 64 percent.4,5,10 This case of AIHA is
unusual because of the D specificity of the autoantibody and
its occurrence in a 14-month-old child without an underlying
immune or autoimmune disorder and with no long-term
sequelae.
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Case Report
A previously healthy 14-month-old white male born
after a term pregnancy without perinatal problems and
with no prior history of blood transfusion presented to the
emergency department with lethargy and jaundice. He had
a history of low-grade fevers, vomiting, and fatigue for 3
days before presentation. On the day of admission he was
noted to have occasional episodes of shallow breathing with
decreased responsiveness. His vital signs showed he was
tachycardic, normotensive, and not hypoxic. He was noted to
be pale, jaundiced, and responsive to painful stimulus only.
In addition, he was found to have an intermittent gallop and
hepatosplenomegaly.
His initial blood work showed he was severely anemic
with a hemoglobin (Hb) of 2.1 g/dL, hematocrit (Hct) of 7.1
percent, and an elevated reticulocyte count of 32 percent. His
white blood cell count was elevated, and his platelet count was
normal. The pertinent laboratory evaluations are summarized
in Table 1. In addition to his severe anemia, the patient had
a bilirubin that was greater than 3 times the upper limit of
normal and a lactate dehydrogenase, which is a marker for
rapid cell turnover, that was almost 6 times the upper limit of
normal. The results were consistent with the diagnosis of an
acute hemolytic anemia.
Further laboratory testing demonstrated significant
end-organ ischemia secondary to his severe anemia. He was
acidotic on admission, with a pH of 7.19. He had evidence of
prerenal insufficiency and hepatic dysfunction with elevated
hepatocellular enzymes. Although he did not have any
clinical signs of bleeding, he had a prolonged prothrombin
time, but a normal partial thromboplastin time. Further
evaluation of coagulation factors demonstrated a deficiency
in factors II, V, and VII, an elevated factor VIII, and normal
fibrinogen. His D dimer was 1390 ng/mL. Although there
was evidence of activation of coagulation, the patient did not
have severe consumption, and his coagulopathy was most
likely attributable to decreased hepatic synthesis. Vitamin K
deficiency could not be documented.
15
R.S. Bercovitz et al.
Table 1. Selected abnormal laboratory values in this patient consistent with a
brisk hemolytic process and end-organ ischemia caused by severe anemia
Laboratory test
Patient’s results
Normal range
39.4 × 103/µL
5–13 × 103/µL
2.1 g/dL
9.5–14 g/dL
Complete blood count
White blood cells (WBC)
Hemoglobin (Hb)
Hematocrit (Hct)
Platelet count
Reticulocyte count
7.1%
30–41%
376 × 103/µL
150–500 × 103/µL
32%
0.56–2.72%
Blood chemistries
Venous blood gas
pH
7.19
7.32–7.42
19 mm Hg
40–50 mm Hg
7 mEq/L
22–25 mEq/L
Glucose
36 mg/dL
60–105 mg/dL
Blood urea nitrogen (BUN)
50 mg/dL
6–17 mg/dL
Creatinine
0.7 mg/dL
0.2–0.6 mg/dL
Lactate dehydrogenase (LDH)
2042 U/L
150–360 U/L
Bilirubin (total)
3.7 mg/dL
0.2–1.2 mg/dL
Aspartate transaminase (AST, SGOT)
1388 U/L
20–60 U/L
Alanine transaminase (ALT, SGPT)
689 U/L
0–33 U/L
Prothrombin time (PT)
49 seconds
10.8–13.8 seconds
Partial thromboplastin time (PTT)
PCO2
Bicarbonate (HCO3)
Liver function tests
Coagulation tests
27 seconds
25.4–35 seconds
Factor II
38%
50–150%
PIVKA II
0 U/dL
0 U/dL
Factor V
14%
63–116%
Factor VII
4%
52–120%
Factor VIII
363%
58–132%
Fibrinogen
276 mg/dL
202–404 mg/dL
D dimer
1390 ng/mL
>255 ng/mL
PIVKA II =protein-induced by vitamin K absence or antagonist II.
He was resuscitated with both crystalloid fluids and
emergency units of unmatched, group O, D– packed RBCs.
After this resuscitation the patient’s mental status and
cardiovascular status improved. His renal and liver function
tests improved, and he had prompt resolution of his metabolic
acidosis.
Further testing showed that the patient was group B, D+
with warm-reacting autoantibodies. His direct antiglobulin
test (DAT) was 2+ positive for IgG, and an eluate from the cells
demonstrated anti-D specificity and no reactivity with D+
LW– RBCs. Extended Rh phenotype by serology indicated that
the patient was D+, C–/c+, E+/e– (likely R2R2); however DNA
testing revealed that the patient’s genotype was D heterozygote,
C–/c+, and E+/e+ (likely R2r). There was no evidence of antiC/c or anti-E/e alloantibodies or autoantibodies. Sequencing
16
of his RHD gene showed he was negative for the
RHD-inactivating pseudogene and had none of
the 18 most common partial D genotypes. The
discrepancy between his positive e genotype and
negative phenotype for e is likely caused by an
altered RHCE gene, although complete sequencing
could not be performed.
After his initial resuscitation, the patient’s
hemoglobin remained stable with no additional
evidence of hemolysis, and he did not require
any additional RBC transfusions. On the day of
admission, he was started on a 10-day course
of prednisone (2 mg/kg per day) and was
successfully tapered off the medication without
recrudescence of his hemolysis. Infectious disease
testing was performed, including a respiratory
virus direct stain for adenovirus, influenza A and
B, parainfluenza 1 through 3, and respiratory
syncytial virus, which was negative. There was
no evidence of current or prior infection with
Epstein-Barr virus. The patient had no underlying
conditions such as another autoimmune disorder
(negative antinuclear antibody), immunodeficiency
(normal serum immunoglobulins), or malignancy,
making this a primary AIHA.
Samples from the patient exhibited a weakly
positive DAT for 2 to 3 months after his initial
presentation. Subsequently, the DAT became
negative, and he had complete resolution of his
hemolysis 1 year after his initial presentation
without evidence of any autoimmune or immune
disorders.
Discussion
AIHA is caused by antibodies to a specific antigen
on the patient’s own erythrocytes, resulting in either
intravascular or extravascular hemolysis. Warm AIHA is
caused by IgG antibodies and results in antibody-mediated
erythrophagocytosis by splenic macrophages. Cold AIHA is
caused by IgM antibodies and results in intravascular hemolysis
secondary to complement fixation on the RBC surface. The
thermal amplitude of the antibodies determines their clinical
significance; cold agglutinins that are reactive at temperatures
lower than body temperature are generally of little clinical
significance. Biphasic IgG antibodies that bind RBCs at colder
temperatures and then fix complement in warmer temperatures
cause paroxysmal cold hemoglobinuria (PCH).
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
AIHA with anti-D specificity
The incidence of both warm and cold AIHA increases
with patient age. But in pediatric patients the highest incidence
of cold AIHA, including cold agglutinin syndrome and PCH,
is in patients younger than the age of 4, likely because of their
association with common childhood infections such as viral
respiratory infections and Mycoplasma pneumoniae.9 In most
case series, warm AIHA constitutes about 60 percent of the
cases in pediatric patients.10 Some series report that primary
AIHA is more common, whereas others demonstrate that
secondary AIHA is more common in pediatric patients.5,9,10
One of the largest series showed that the majority of
cases of AIHA are caused by warm antibodies, 64 percent,
versus 26 percent attributable to cold antibody and 10 percent
attributable to mixed antibodies (n = 100).10 This series also
demonstrated that approximately half of the patients (54%) had
an underlying disease process such as autoimmune disease,
idiopathic thrombocytopenia, neoplasia, or hemoglobinopathy,
whereas the remaining 46 percent of patients had primary
(idiopathic) AIHA. The most common autoimmune disorders
associated with AIHA include lupus, Evan’s syndrome,
autoimmune lymphoproliferative syndrome (ALPS), and
other immunodeficiencies. The majority of patients with warm
antibody disease, 59 percent (38/64), had primary AIHA,10
similar to a series of 26 children in India that showed that 65
percent had primary AIHA.11 Children with primary AIHA
are more likely than adults to have a self-resolving, relatively
short course (less than 6 months). Patients who present at
younger than 2 years and older than 12 years are at risk for a
chronic course.12
The discrepancy between the patient’s e negative
phenotype and e positive genotype likely represents an altered
RHCE gene. This altered gene may place the patient at a higher
risk of developing alloantibodies to the e antigen; however, it
should not play a role in the development of autoantibodies
to D. D is the most immunogenic antigen when development
of alloantibodies occurs after an exposure; however, it is
not commonly associated with autoantibody development.
Antibodies against antigens in the Rh system, such as anti-e,
anti-E, and anti-c, are most commonly implicated in warm
AIHA.2–5,10,11,13,14 Patients frequently have multiple anti-Rh
antibodies or panreactive Rh antibodies, but having only
anti-D is rare in AIHA.15
There are case reports of patients developing anti-D
after solid-organ transplant, although these are not true
autoantibodies as they were passively transferred by donor
lymphocytes.16 Autoantibodies to D have been found in the
setting of myelodysplasia17 and as a paraneoplastic syndrome
associated with breast carcinoma and ovarian teratoma.18,19
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
There was an additional case report of IgM anti-D in the
setting of non-Hodgkin lymphoma.20 To date, there is only one
case of primary AIHA caused by anti-D in an adult patient.15
To our knowledge, the case presented here is a unique case of
primary AIHA with an IgG antibody toward the D antigen in
a pediatric patient.
Acknowledgments
The authors wish to acknowledge the staff of the Reference
Laboratory at Bonfils Blood Center and Karen Evans,
MT(ASCP)SBB, for their work in performing the serologic
studies on the patient, and Christian Snyder for his help in
manuscript preparation.
References
1.Laski B, Wake EJ, Bain HW, Gunson HH. Autohemolytic
anemia in young infants. J Pediatr 1961;59:42–6.
2.Gross S, Newman AJ. Auto-immune anti-D specificity in
infancy. Am J Dis Child 1964;108:181–3.
3. Gehrs BC, Friedberg RC. Autoimmune hemolytic anemia. Am
J Hematol 2002;69:258–71.
4.Blackall DP. Warm-reactive autoantibodies in pediatric
patients: clinical and serologic correlations. J Pediatr Hematol
Oncol 2007;29:792–6.
5.Petz LD, Garratty G. Immune hemolytic anemias. 2nd ed.
Philadelphia: Churchill Livingstone, 2004:231–44, 341–4.
6.Leddy JP, Falany JL, Kissel GE, Passador ST, Rosenfeld SI.
Erythrocyte membrane proteins reactive with human (warmreacting) anti-red cell autoantibodies. J Clin Invest 1993;
91:1672–80.
7.
Notarangelo LD. Primary immunodeficiencies (PIDs)
presenting with cytopenias. Hematology Am Soc Hematol
Educ Program 2009:139–43.
8.Aladjidi N, Leverger G, Leblanc T, et al. New insights
into childhood autoimmune hemolytic anemia: a French
national observational study of 265 children. Haematologica
2011;96:655–63.
9. Sokol RJ, Booker DJ, Stamps R. The pathology of autoimmune
haemolytic anaemia. J Clin Pathol 1992;45:1047–52.
10. Vaglio S, Arista MC, Perrone MP, et al. Autoimmune hemolytic
anemia in childhood: serologic features in 100 cases.
Transfusion 2007;47:50–4.
11.Naithani R, Agrawal N, Mahapatra M, Kumar R, Pati HP,
Choudhry VP. Autoimmune hemolytic anemia in children.
Pediatr Hematol Oncol 2007;24:309–15.
12.Sackey K. Hemolytic anemia: part 1. Pediatr Rev 1999;20:
152–9.
13. Packman CH. Hemolytic anemia due to warm autoantibodies.
Blood Rev 2008;22:17–31.
14. Garratty G. Specificity of autoantibodies reacting optimally at
37 degrees C. Immunohematology 1999;15:24–40.
15. Adams J, Moore VK, Issitt PD. Autoimmune hemolytic anemia
caused by anti-D. Transfusion 1973;13:214–18.
17
R.S. Bercovitz et al.
16. Schwartz D, Götzinger P. Immune-haemolytic anaemia (IHA)
after solid organ transplantation due to rhesus antibodies
of donor origin: report of 5 cases. Beitr Infusionsther 1992;
30:367–9.
17. Yermiahu T, Dvilansky A, Avinoam I, Benharroch D. Acquired
auto-anti D in a patient with myelodysplastic syndrome.
Sangre (Barc) 1991;36:47–9.
18.Adorno G, Girelli G, Perrone MP, et al. A metastatic breast
carcinoma presenting as autoimmune hemolytic anemia.
Tumori 1991;77:447–8.
19. Schönitzer D, Kilga-Nogler S. Apparent ‘auto’-anti-DE of the
IgA and IgG classes in a 16-year-old girl with a mature cystic
ovarian teratoma. Vox Sang 1987;53:102–4.
20.Longster GH, Johnson E. IgM anti-D as auto-antibody in a
case of ‘cold’ auto-immune haemolytic anaemia. Vox Sang
1988;54:174–6.
Rachel S. Bercovitz, MD, Transfusion Medicine Fellow, Bonfils
Blood Center, Denver, CO, University of Colorado Denver, Anschutz
Medical Campus, and the Center for Cancer and Blood Disorders,
Children’s Hospital Colorado, Aurora, CO;. Margaret Macy, MD,
Assistant Professor of Pediatrics, University of Colorado Denver,
Anschutz Medical Campus, and Pediatric Oncologist, Center for
Cancer and Blood Disorders, Children’s Hospital Colorado, Aurora,
CO; and Daniel R. Ambruso, MD (corresponding author), Medical
Director for Research and Education, Bonfils Blood Center, 717
Yosemite Street, Denver, CO, 80230, Professor of Pediatrics,
University of Colorado Denver, Anschutz Medical Campus, and
Pediatric Hematologist, Center for Cancer and Blood Disorders,
Children’s Hospital Colorado, Aurora, CO.
Attention: SBB and BB Students
You are eligible for a free 1-year subscription to
Immunohematology.
Important Notice About Manuscripts for
Immunohematology
Please e-mail all manuscripts to [email protected]
Notice to Readers
Immunohematology is printed on acid-free paper.
18
Ask your education supervisor to submit the name and
complete address for each student and the inclusive dates
of the training period to [email protected]
For information concerning Immunohematology or the
Immunohematology Methods and Procedures manual,
contact us by e-mail at [email protected]
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Review
An update on the GLOB blood group system
and collection
Å. Hellberg, J.S. Westman, and M.L. Olsson
The P blood group antigen of the GLOB system is a glycolipid
structure, also known as globoside, on the red blood cells (RBCs)
of almost all individuals worldwide. The P antigen is intimately
related to the Pk and NOR antigens discussed in the review
about the P1PK blood group system. Naturally occurring anti-P
is present in the serum of individuals with the rare globosidedeficient phenotypes p, P1k, and P2k and has been implicated in
hemolytic transfusion reactions as well as unfavorable outcomes
of pregnancy. The molecular genetic basis of globoside deficiency
is absence of functional P synthase as a result of mutations
at the B3GALNT1 locus. Other related glycolipid structures,
the LKE and PX2 antigens, remain in the GLOB blood group
collection pending further evidence about the genes and gene
products responsible for their synthesis. Immunohematology
2013;29:19–24.
History
Reading the early literature about what are currently
known as the P1PK and GLOB blood group systems is a bit
complicated because of evolving name changes based on
increasing knowledge that has improved previously drawn
conclusions. The P antigen is also known as globoside, a name
given because it was discovered and characterized first on red
blood cells (RBCs) (globule rouge is French for red blood cell).
The antibody now referred to as anti-P1 was originally called
anti-P and was initially recognized in 1955 as a component
of anti-Tja (now designated anti-PP1Pk), the mix of naturally
occurring antibodies in sera of people with the p phenotype.1
The first globoside-deficient individual described had the
rare P1k phenotype and was reported in 1959 by Matson et
al.2 However, the first paper highlighting the relationship
between the P1, Pk, and P antigens, as well as determining the
biochemical structure of these glycolipids, was published by
Naiki et al.3 15 years later.
Terminology and Nomenclature
The P antigen is so far the only member of the GLOB
blood group system acknowledged by the International
Society of Blood Transfusion (ISBT) Working Party for Red
Cell Immunogenetics and Blood Group Terminology as system
number 028. The antigen was first assigned to the P blood
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
group system (as antigen no. 003002), which is the former
name of what is now known as the P1PK system (ISBT no.
003), today housing the P1, Pk, and NOR antigens. Thereafter,
P was moved to the GLOB blood group collection (ISBT no.
209, antigen no. 209001) when it was clear that P1 and P
were only distant relatives. Finally, it was promoted to form
a blood group system of its own when the molecular genetic
basis for P antigen synthesis was established in 2002 (antigen
no. 028001).4 Other names sometimes used instead of P,
especially in the biochemical and glycobiological literature,
include globoside, globotetraosylceramide, and Gb4. It should
be noted that P was the name formerly used for what is now
known as the P1 antigen. The LKE antigen remains in the
GLOB collection (ISBT no. 209), together with the newly
added PX2 antigen.5 The current terminology of the GLOB
blood group system and collection is summarized in Table 1.
Table 1. The GLOB blood group system and collection*
Antigen
P
ISBT system no.
ISBT collection no.
GLOB 028
ISBT antigen no.
028001
LKE
GLOB 209
209003
PX2
GLOB 209
209004
*209001 and 209002 are obsolete (previously used for P and Pk).
Molecular Genetic Basis of P Antigen
A gene, first cloned in 1998 as a member of the
3-β-galactosyltransferase family6 but later shown to be a
3-β-N-acetylgalactosaminyltransferase, was suggested as the
globoside (Gb4, P) synthase.7 This gene (B3GALNT1, formerly
known as B3GALT3) is located on the long arm of chromosome
3 (3q26.1) and has at least five exons with the entire coding
region in the last exon (Fig. 1). The gene encodes the enzyme
that synthesizes the P antigen. So far, 12 mutations have been
found to abolish P synthase activity (Table 2).4,8,9 Only one
noncritical polymorphism has been described in the exons of
this gene, in contrast to the Pk synthase gene (A4GALT), which
varies more in the population.
19
Å. Hellberg et al.
B3GALNT1
331 aa
ATG
5ʹ
1
2
3
4
90
88
91
95
TAA
5
ORF
3ʹ
2906
Fig. 1 The genomic organization of the P (B3GALNT1) gene, not drawn to scale. The numbers in the boxes represent the exon number and
numbers below boxes represent the number of base pairs in the exon. The black box shows the open reading frame (ORF).
Table 2. A summary of all mutations found to date in the B3GALNT1 gene4,8,9
nt. position
202
203
292–293
433
449
456
537–538
598
648
797
811
959
Consensus
C
G
A
C
A
T
A
T
A
A
G
G
ISBT allele name
Origin
GLOB*01N.01
Finland
GLOB*01N.09
Mahgreb
GLOB*01N.02
Italy
GLOB*01N.03
USA
GLOB*01N.12
Turkish
GLOB*01N.11
Saudi Arabian
GLOB*01N.04
Arabic
GLOB*01N.10
French Caucasian
GLOB*01N.05
Canada
GLOB*01N.06
France
GLOB*01N.07
Europe
GLOB*01N.08
Switzerland
Acc. no.
T
AF494103
delG
FR871173
insA
AY505344
T
AY505345
G
FR871174
G
FR871176
insA
AF494104
delT*
FR871175
C
AY505346
C
AF494106
A
AF494105
A
aa position
68
68
98
145
150
152
180
200
216
266
271
Consensus
R
R
R
R
D
Y
D
S
R
E
G
W
Change
stop
fs
fs
stop
G
stop
fs
fs
S
A
R
stop
AY505347
320
nt = nucleotide, Acc. no. = accession number, aa = amino acid, fs = frameshift.
*Additional mutation present in allele 376G>A (D126N).
Antigens and Antibodies in the System
The P antigen is present on RBCs of all individuals except
ones with the rare phenotypes p, P1k, or P2k. The P1k phenotype
lacks the P antigen on the cell surface, whereas the P2k phenotype
lacks both the P and P1 antigens. The p phenotype, on the
other hand, lacks Pk, P, and P1 antigens. Additional phenotypes
might exist as Kundu et al. described individuals with either a
weak P or weak Pk antigen,10,11 but the genetic basis of this is not
known and such individuals appear to be rare.
The P1k and P2k phenotypes are even rarer than the p
phenotype but appear to be more common in Japan.12 The
first individual described with the Pk phenotype was of
Finnish origin, and it also appears that Finland has a higher
prevalence of the rare P1k and P2k phenotypes than do other
populations.13,14
The antigen is well developed at birth13 and is the most
abundant neutral glycolipid in the RBC membrane with
approximately 15 × 106 antigens per cell,15 probably the
20
highest antigen site density for any blood group antigen.
None of the enzymes or chemicals used to treat test RBCs for
antigen modification can abolish its expression, but many,
including papain and trypsin, markedly enhance it. RBCs
from P1 individuals express more Pk antigen compared with
P2 individuals, but the amount of P antigen is similar for both
phenotypes.15 However, because the Pk antigen constitutes the
precursor for P synthase, it is possible that the P antigen site
density is somewhat lower on P2 individuals, but substantial
interindividual variation exists.
Naturally occurring antibodies of IgM or IgG classes are
formed when the P antigen is missing. In analogy with ABO
antibodies, anti-P can cause hemolytic transfusion reactions of
the acute intravascular type, although no clinically significant
hemolytic disease of the fetus and newborn has been reported.
Nevertheless, early spontaneous abortions occur with a higher
frequency among women with p and P1k or P2k phenotype; this
is a phenomenon most likely attributable to the IgG component
of anti-P attacking certain cells in the placenta, where globoside
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
GLOB blood group system review
is highly expressed.16,17 Plasmapheresis to reduce the maternal
antibody titer has been successfully used in selected cases.18
Autoanti-P can be formed after viral infections (see Disease
Associations).
Biochemistry
P antigen belongs to the globoseries of glycolipids. Its
structure was first elucidated by Naiki et al., and it was later
shown by Yang et al. that glycolipids are the sole carriers
of P antigen on RBCs.3,19 The P antigen is made with the
addition of N-acetylgalactosamine (GalNAc) by a 3-β-Nacetylgalactosaminyltransferase (β3GalNAc-T1 classified as
EC 2.4.1.79 but also known as P or Gb4 synthase) using
Pk (Gb3) as a precursor (Fig. 2). This enzyme is a type II
transmembrane glycoprotein with 331 amino acids and
five potential N-glycosylation sites. Similar to other glycosyltransferases, it resides in the Golgi apparatus, where it is
part of the glycosylation machinery of the cell. The crystal
structure of this enzyme has not yet been solved, and regulation
of its transcription is not well understood either.
Fig. 2 Schematic summary of the synthesis of P antigen. The a- or
β-linkages are shown along with the informative numbers in the 1,3
or 1,4 glycosidic bonds.
Glucose (Glc)
Galactose (Gal)
N-acetylgalactosamine (GalNAc)
Tissue Distribution
Expression of the P antigen has been studied in several
species.20–22 Studies of mouse tissues show expression
patterns similar to those of humans, although there are some
differences.21
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
The P antigen is expressed on a number of other cells in
addition to RBCs, but various studies using different antibodies
or methods have come to different conclusions about where
it is expressed. Soluble P substance has also been detected in
plasma.23,24 Small amounts of Pk, together with higher amounts
of P, are present on intestinal epithelial cells.25 P antigen
expression is also seen on megakaryocytes and fibroblasts but
not on lymphocytes and granulocytes according to von dem
Borne et al.,26 whereas Shevinsky et al.27 could not detect P
on fibroblasts. In another study, P was detected in 11 of 16
investigated tissues, especially those of mesodermal origin.28
Placenta and fetal heart and kidney are other tissues where P is
present.17 The P antigen is expressed on embryonal carcinoma
cells and, according to Song et al.,29 is a possible initiator of
signal transduction through AP-1 and CREB, associated with
cell adhesion. High expression of the B3GALNT1 gene has
been demonstrated in brain and heart, moderate expression in
lung, placenta, and testis, and low expression in kidney, liver,
spleen, and stomach.7
Disease Associations
Parvovirus B19, which causes the so-called fifth disease,
uses erythroid precursor cells expressing high levels of P
antigen for its replication.30,31 Infection during pregnancy
with B19 can give rise to fetal anemia and, in some cases, fetal
loss as a result of inhibition of hematopoiesis.32 Paroxysmal
cold hemoglobinuria, which can be seen in children after
a viral infection, can be caused by an autoanti-P. This
complement-fixing and cold-reactive antibody, also called
Donath-Landsteiner antibody, lyses autologous P-positive
erythrocytes.33 P-fimbriated uropathogenic Escherichia
coli that express Pap-encoded adhesins bind to glycolipid
structures containing the Gal4Gal motif and can cause
urinary tract infections such as cystitis and pyelonephritis.
This includes the P antigen and other globoseries antigens like
Pk, as well as the neolactoseries P1 antigen.34,35
Related Antigens in the GLOB Collection
The LKE (Luke) Antigen
The Luke (LKE, also known as SSEA-4 or
monosialogalactosylgloboside, MSGG) antigen was found in
196536 and named LKE in 1986 after the first patient with
anti-LKE. Since 1990, LKE belongs to the GLOB collection
(ISBT no. 209). The antigen, which was given number 209003,
is formed by sequential addition of a galactose (Gal) moiety
and thereafter sialic acid (NeuAc) to the P antigen to form
21
Å. Hellberg et al.
galactosylgloboside (Gb5) and LKE, respectively. Although
the enzyme responsible for Gb5 synthesis is thought to be
encoded by B3GALT5, Gb5 is not known to elicit an antibody
response and is therefore not classified as a blood group
antigen. On the other hand, anti-LKE is found in LKEnegative individuals, but the enzyme responsible for synthesis
of LKE has not yet been identified, which means LKE remains
in the GLOB collection. Anti-LKE is a rare finding, and no
clinically significant reactions have been reported. There are
three different LKE phenotypes: strongly positive (80–90% of
individuals), weakly positive (10–20%), and negative (1–2%).
In addition to RBCs, LKE is expressed on endothelial cells,
smooth muscle cells, kidney cells, platelets, and mesenchymal
stem cells.37–39 Individuals with the LKE-negative phenotype
express more Pk antigen compared with individuals with LKEpositive phenotype.40
The PX2 Antigen
The PX2 antigen, a high-prevalence antigen originally
designated as the x2 glycolipid, was first mentioned by Kannagi
et al.,41 and the structure was later characterized further
by Thorn et al.,42 who also found it elevated on RBCs with
the p phenotype. It is formed by addition of a β3GalNAc to
paragloboside, the same precursor used by the FUT1 enzyme
to make H antigen or P1 synthase to make P1. There are also
sialylated variants of x2 described.42
In individuals with the P1k phenotype only anti-P is
expected in plasma according to textbooks, but it was recently
reported that another naturally occurring antibody specificity
could give rise to a weak or variable crossmatch reactivity
with p phenotype RBCs owing to their elevated amounts
of x2 glycolipid.5 At the same time, all P1k and P2k RBCs
were compatible. In the absence of a functional β3GalNAc
transferase because of B3GALNT1 mutations in P1k and P2k
phenotype individuals, it is hypothesized that paragloboside
can no longer be extended to form PX2 but this has yet to be
proved. In the meantime, the PX2 antigen has been assigned
to the GLOB collection (ISBT no. 209).43
The biochemical and genetic relationship between the
GLOB system and collection antigens discussed in this review
is summarized in Figure 3.
Summary
The GLOB blood group system currently consists of only
one antigen, P, or globoside, but is closely associated with the
antigens in the P1PK blood group system as well as the GLOB
collection antigens. The P antigen can act as a receptor for
22
Ceramide
ß-Glucosylceramide
Lactosylceramide
Lactotriaosylceramide
3-ß-N-acetylgalactosaminyltransferase
P, Gb4
(B3GALNT1)
Paragloboside
P1
H
A
PX2
B
Pk, Gb3
NOR
Gb5
Globo-H
Globo-A
FORS
LKE
Globo-B
Fig. 3 The biochemical and genetic relationship between the
antigens discussed in this review and other related carbohydrate
antigens.
various pathogens and anti-P can cause hemolytic transfusion
reactions, spontaneous recurrent abortions, and autoimmune
anemia as a result of lysis of erythroid progenitors.
References
1. Sanger R. An association between the P and Jay systems of
blood groups. Nature 1955;176:1163–4.
2. Matson GA, Swanson J, Noades J, Sanger R, Race RR. A new
antigen and antibody belonging to the P blood group system.
Amer J Hum Genet 1959;11:26–34.
3.Naiki M, Marcus DM. Human erythrocyte P and Pk blood
group antigens: identification as glycosphingolipids. Biochem
Biophys Res Commun 1974;60:1105–11.
4.Hellberg Å, Poole J, Olsson ML. Molecular basis of
the globoside-deficient P(k) blood group phenotype.
Identification of four inactivating mutations in the UDPN-acetylgalactosamine: globotriaosylceramide 3-beta-Nacetylgalactosaminyltransferase gene. J Biol Chem 2002;277:
29455–9.
5. Olsson ML, Peyrard T, Hult AK, et al. PX2: a new blood group
antigen with implications for transfusion recommendations
in P1k and P2k individuals (abstract). Vox Sang 2011;101
(Suppl 1):53.
6. Amado M, Almeida R, Carneiro F, et al. A family of human
beta3-galactosyltransferases. Characterization of four
members of a UDP-galactose:beta-N-acetyl-glucosamine/
beta-N-acetyl-galactosamine beta-1,3-galactosyltransferase
family. J Biol Chem 1998;273:12770–8.
7.Okajima T, Nakamura Y, Uchikawa M, et al. Expression
cloning of human globoside synthase cDNAs. Identification
of beta3Gal-T3 as UDP-N-acetylgalactosamine:globotriaosylceramide beta1,3-N-acetylgalactosaminyltransferase. J Biol
Chem 2000;275:40498–503.
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
GLOB blood group system review
8. Hellberg Å, Ringressi A, Yahalom V, Säfwenberg J, Reid ME,
Olsson ML. Genetic heterogeneity at the glycosyltransferase
loci underlying the GLOB blood group system and collection.
Br J Haematol 2004;125:528–36.
9.Westman JS, Hellberg Å, Peyrard T, Hustinx H, Thuresson
B, Olsson ML. Molecular dissection of rare phenotypes in the
P1PK and GLOB histo-blood group systems with novel genetic
markers (abstract). Transfusion 2011;51(Suppl 3):24A.
10.Kundu SK, Steane SM, Bloom JE, Marcus DM. Abnormal
glycolipid composition of erythrocytes with a weak P antigen.
Vox Sang 1978;35:160–7.
11. Kundu SK, Evans A, Rizvi J, Glidden H, Marcus DM. A new
Pk phenotype in the P blood group system. J Immunogenet
1980;7:431–9.
12.Nakajima H, Yokota T. Two Japanese families with Pk
members. Vox Sang 1977;32:56–8.
13.Race RR, Sanger R. Blood groups in man. Oxford, UK:
Blackwell Scientific Publications, 1975.
14.Kortekangas AE, Kaarsalo E, Melartin L, et al. The red cell
antigen Pk and its relationship to the P system: the evidence of
three more Pk families. Vox Sang 1965;10:385–404.
15.Fletcher KS, Bremer EG, Schwarting GA. P blood group
regulation of glycosphingolipid levels in human erythrocytes.
J Biol Chem 1979;254:11196–8.
16.Cantin G, Lyonnais J. Anti-PP1Pk and early abortion.
Transfusion 1983;23:350–1.
17.Lindström K, Von Dem Borne AE, Breimer ME, et al.
Glycosphingolipid expression in spontaneously aborted fetuses
and placenta from blood group p women. Evidence for placenta
being the primary target for anti-Tja-antibodies. Glycoconj J
1992;9:325–9.
18.Fernández-Jiménez MC, Jiménez-Marco MT, Hernández
D, González A, Omeñaca F, de la Cámara C. Treatment
with plasmapheresis and intravenous immunoglobulin
in pregnancies complicated with anti-PP1Pk or anti-K
immunization: a report of two patients. Vox Sang 2001;80:
117–20.
19.Yang Z, Bergström J, Karlsson KA. Glycoproteins with Gal
alpha 4Gal are absent from human erythrocyte membranes,
indicating that glycolipids are the sole carriers of blood group P
activities. J Biol Chem 1994;269:14620–4.
20.Keusch JJ, Manzella SM, Nyame KA, Cummings RD,
Baenziger JU. Cloning of Gb3 synthase, the key enzyme in
globo-series glycosphingolipid synthesis, predicts a family of
alpha 1, 4-glycosyltransferases conserved in plants, insects,
and mammals. J Biol Chem 2000;275:25315–21.
21.
Fujii Y, Numata S, Nakamura Y, et al. Murine
glycosyltransferases responsible for the expression of globoseries glycolipids: cDNA structures, mRNA expression, and
distribution of their products. Glycobiology 2005;15:1257–67.
22. Zoja C, Corna D, Farina C, et al. Verotoxin glycolipid receptors
determine the localization of microangiopathic process in
rabbits given verotoxin-1. J Lab Clin Med 1992;120:229–38.
23.Issitt PD, Anstee DJ. Applied blood group serology. 4th ed.
Miami, FL: Montgomery Scientific Publications, 1998.
24.Svennerholm E, Svennerholm L. The separation of neutral
blood-serum glycolipids by thin-layer chromatography.
Biochim Biophys Acta 1963;70:432–41.
25. Zumbrun SD, Hanson L, Sinclair JF, et al. Human intestinal
tissue and cultured colonic cells contain globotriaosylceramide
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
synthase mRNA and the alternate Shiga toxin receptor
globotetraosylceramide. Infect Immun 2010;78:4488–99.
26. von dem Borne AE, Bos MJ, Joustra-Maas N, et al. A murine
monoclonal IgM antibody specific for blood group P antigen
(globoside). Br J Haematol 1986;63:35–46.
27. Shevinsky LH, Knowles BB, Damjanov I, Solter D. Monoclonal
antibody to murine embryos defines a stage-specific
embryonic antigen expressed on mouse embryos and human
teratocarcinoma cells. Cell 1982;30:697–705.
28. Cooling LL, Koerner TA, Naides SJ. Multiple glycosphingolipids
determine the tissue tropism of parvovirus B19. J Infect Dis
1995;172:1198–205.
29.Song Y, Withers DA, Hakomori S. Globoside-dependent
adhesion of human embryonal carcinoma cells, based on
carbohydrate-carbohydrate interaction, initiates signal
transduction and induces enhanced activity of transcription
factors AP1 and CREB. J Biol Chem 1998;273:2517–25.
30.Brown KE, Hibbs JR, Gallinella G, et al. Resistance to
parvovirus B19 infection due to lack of virus receptor
(erythrocyte P antigen). N Engl J Med 1994;330:1192–6.
31. Young NS, Brown KE. Parvovirus B19. N Engl J Med 2004;
350:586–97.
32. de Jong EP, Walther FJ, Kroes AC, Oepkes D. Parvovirus B19
infection in pregnancy: new insights and management. Prenat
Diagn 2011;31:419–25.
33. Heddle NM. Acute paroxysmal cold hemoglobinuria. Transfus
Med Rev 1989;3:219–29.
34. Moulds JM, Moulds JJ. Blood group associations with parasites,
bacteria, and viruses. Transfus Med Rev 2000;14:302–11.
35.Ziegler T, Jacobsohn N, Fünfstück R. Correlation between
blood group phenotype and virulence properties of Escherichia
coli in patients with chronic urinary tract infection. Int J
Antimicrob Agents 2004;24(Suppl 1):S70–5.
36.Tippett P, Sanger R, Race RR, Swanson J, Busch S. An
agglutinin associated with the P and the ABO blood group
systems. Vox Sang 1965;10:269–80.
37.Gillard BK, Jones MA, Marcus DM. Glycosphingolipids of
human umbilical vein endothelial cells and smooth muscle
cells. Arch Biochem Biophys 1987;256:435–45.
38. Stroud MR, Stapleton AE, Levery SB. The P histo-blood grouprelated glycosphingolipid sialosyl galactosyl globoside as a
preferred binding receptor for uropathogenic Escherichia coli:
isolation and structural characterization from human kidney.
Biochemistry 1998;37:17420–8.
39. Cooling LL, Zhang D, Koerner TA. Human platelets express
gangliosides with LKE activity and ABH blood group activity.
Transfusion 2001;41:504–16.
40.Cooling LL, Kelly K. Inverse expression of P(k) and Luke
blood group antigens on human RBCs. Transfusion 2001;41:
898–907.
41. Kannagi R, Fukuda MN, Hakomori S. A new glycolipid antigen
isolated from human erythrocyte membranes reacting with
antibodies directed to globo-N-tetraosylceramide (globoside).
J Biol Chem 1982;257:4438–42.
42.Thorn JJ, Levery SB, Salyan ME, et al. Structural
characterization of x2 glycosphingolipid, its extended form,
and its sialosyl derivatives: accumulation associated with the
rare blood group p phenotype. Biochemistry 1992;31:6509–17.
43. Storry JR, Castilho L, Daniels G, et al. International Society of
Blood Transfusion Working Party on red cell immunogenetics
23
Å. Hellberg et al.
and blood group terminology: Berlin report. Vox Sang
2011;101:77–82.
Åsa Hellberg, PhD (corresponding author), Coordinator at the
Nordic Reference Laboratory for Genomic Blood Group Typing,
Department of Clinical Immunology and Transfusion Medicine,
University and Regional Laboratories, SE-221 85 Lund, Sweden,
and Division of Hematology and Transfusion Medicine, Department
of Laboratory Medicine, Lund University, SE-221 00 Lund, Sweden,
Julia S. Westman, MSc, PhD student, Division of Hematology and
24
Transfusion Medicine, Department of Laboratory Medicine, Lund
University, and Martin L. Olsson, MD, PhD, Medical Director
of the Nordic Reference Laboratory for Genomic Blood Group
Typing, Professor and Senior Consultant at the Department of
Clinical Immunology and Transfusion Medicine, University and
Regional Laboratories, and Division of Hematology and Transfusion
Medicine, Department of Laboratory Medicine, Lund University,
Lund, Sweden.
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Review
P1PK: The blood group system that changed
its name and expanded
Å. Hellberg, J.S. Westman, B. Thuresson, and M.L. Olsson
The antigens in the P1PK blood group system are carried on
glycosphingolipids. The system currently includes three different
antigens, P1, Pk, and NOR. The P1 antigen was disovered in 1927
by Landsteiner and Levine, and Pk and NOR were described in
1951 and 1982, respectively. As in the ABO system, naturally
occurring antibodies of the immunoglobulin (Ig) M or IgG class,
against the missing carbohydrate structures, can be present in
the sera of people lacking the corresponding antigen. Anti-P1 is
generally a weak and cold-reactive antibody not implicated in
hemolytic transfusion reaction (HTR) or hemolytic disease of
the fetus and newborn while Pk antibodies can cause HTR, and
anti-NOR is regarded as a polyagglutinin. A higher frequency of
miscarriage is seen in women with the rare phenotypes p, P1k,
and P2k. Furthermore, the Pk and P1 antigens have wide tissue
distributions and can act as host receptors for various pathogens
and toxins. Why p individuals lack not only Pk and P expression
but also P1 has been a longstanding enigma. Recently, it was
shown that the same A4GALT-encoded galactosyltransferase
synthesizes both the P1 and Pk antigens and that a polymorphism
in a new exon in this gene predicts the P1 and P2 phenotypes.
Immunohematology 2013;29:25–33.
Historical Aspects
In 1927, Landsteiner and Levine1 found antibodies to an
antigen they called P (now known as the P1 antigen). In 1951,
the Jay blood group “system” was discovered, containing one
antigen, Tja, and its corresponding antibody, anti-Tja.2 Four
years later, Sanger3 found a relationship between the P (P1)
and the Jay systems. The P (P1) antigen was absent from all
red blood cells (RBCs) with the rare Tj(a–) phenotype. The
antigen P was then renamed to P1 and the Tj(a–) phenotype
became the p (or PP1Pknull) phenotype.3 Anti-P was originally
recognized in 1955 as a component of anti-Tja (now designated
anti-PP1Pk), the mix of naturally occurring antibodies in sera
of people with the p phenotype.3 The first individual lacking
the P antigen was described in 1959 by Matson et al.,4 and in
the same paper the Pk antigen and anti-Pk were first mentioned.
The authors also noted the association with the P blood group
system.4
Nevertheless, the relationship between the different
antigens was not fully understood at that time. In the fifth
edition of Blood Groups in Man,5 the authors declare “we began
to feel lost in amazement at the complexity of the P system.”
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Indeed, this feeling has lingered (and still does) among many
of us who work with these questions. However, the first paper
explaining the relationship between the P1, Pk, and P antigens,
as well as determining the biochemical structure of these
glycolipids, was published in 1974 by Naiki et al.6 See Figure
1 for a schematic representation of the antigens discussed in
this review.
P1
Pk
P
Gal
NOR
Gal
Gal
Gal
NAc
Gal
NAc
Glc
NAc
Gal
Gal
Gal
Gal
Gal
Gal
Gal
Glc
Glc
Glc
Glc
Cer
Cer
Cer
Cer
Fig. 1 The antigens in the P1PK blood group system, together with
the related P antigen.
Nomenclature
The history of nomenclature for the P1 and Pk antigens
is complicated and sometimes confusing. The P1 antigen,
originally called P, used to belong to the P blood group system
and the Pk antigen to the GLOB collection (ISBT no. 209).
However, the P antigen (globoside, Gb4) did not belong to the
original P system, but has now been made the only antigen in
the GLOB blood group system (ISBT no. 028).7,8 Now that it
is clear that the A4GALT gene is responsible for both the P1
and Pk antigens (see later section), the Pk antigen has joined
the P1 antigen and the system name has been changed to the
P1PK blood group system (ISBT no. 003) to reflect the two
25
Å. Hellberg et al.
major antigens in it (Table 1).9 The NOR antigen was assigned
to the P1PK system by the ISBT Working Party on Red Cell
Immunogenetics and Blood Group Terminology at the 2012
annual meeting in Cancun (Table 1).10 The related antigens
LKE and PX2, as well as P, are discussed in the GLOB blood
group system review also published in this issue.11
Table 1. The P1PK blood group system
Antigen
Blood group system
ISBT number
P1
P1PK
003001
P
P1PK
003003
P1PK
003004
k
NOR
extract P1 glycolipids from RBCs. In 1974, the Pk structure
was identified as CTH by Naiki and Marcus.6
The 4-α-galactosyltransferase (α4Gal-T/P1Pk synthase)
catalyzes the transfer of galactose to the galactose residue on
LacCer, producing the Pk antigen. In another pathway, the P1
antigen is formed by three sequential glycosylation reactions,
the last one performed by the P1Pk synthase. Furthermore,
other glycosyltransferases form additional blood group
antigens associated with the P1PK/GLOB systems and
collection, such as Forssman (FORS1), globo-H, and globo-A
(Fig. 2).18–20
Ceramide
003002 is obsolete.
The Pk antigen is also known as the Burkitt lymphoma
antigen and has been classified as CD77.12 Yet another name,
Gb3, is often used when the Pk structure is expressed on
cells other than RBCs. This is in analogy with Gb4 being an
alternative and more biochemically useful name for P.
ß-Glucosylceramide
Lactosylceramide
Lactotriaosylceramide
26
4-α-galactosylP1
transferase
(A4GALT exon 2a 42C>T)
H
A
PX2
B
Pk, Gb3
4-α-galactosyltransferase
(A4GALT with Gln211Glu)
Paragloboside
Biochemistry
The P1PK and GLOB antigens are related and are
structurally of a glycan nature. Depending on which
carbohydrate residues are added to lactosylceramide
(LacCer), different series of glycosphingolipids are formed.
Glycosphingolipids were first described by Thudichum in
1884, and he named them after the inscrutable Egyptian
Sphinx, as both the structure and the function were unknown
at the time.13 These molecules consist of a sugar moiety with
a lipid ceramide tail; they make up the outer leaflet of cell
membranes together with phospholipids, cholesterol, and
glycerolipids. Lipids are organised in microdomains such as
glycosynapses and lipid rafts.14
The P1PK antigens, as well as the GLOB system and
collection antigens, are formed on the same precursor, LacCer,
which is the most common precursor for glycosphingolipids
in mammals and birds.15 Pk (other names include
globotriaosylceramide, Gb3, ceramide trihexoside, and CTH)
belongs to the globo-series, and P1 (also known as nLc5) to
the neolacto/paraglobo-series.
The biochemistry of the P1 blood group antigen was
partially elucidated by Morgan and Watkins16 in the 1960s by a
series of experiments on hydatid cyst fluid from sheep infected
by the tapeworm Echinococcus granulosus. They purified
P1-specific components and showed that a glycoprotein
containing the Galα1-4Galβ1-4GlcNAc trisaccharide reacted
as a P1 determinant. Some years later, Marcus17 managed to
4-α-galactosyltransferase
(A4GALT)
P, Gb4
NOR
Gb5
Globo-H
Globo-A
FORS
LKE
Globo-B
Fig. 2 The biochemical and genetic relationship between the
antigens (black boxes) of the P1PK blood group system and other
related carbohydrate antigens.
It has been debated whether the Pk and P1 antigens exist
on glycoproteins in the human RBC membrane, but according
to Yang et al.21 glycolipids are the sole carriers of these antigens
on RBCs.
Antigens and Antibodies in the System
Different combinations of the P1, P, and Pk antigens give
rise to the following phenotypes: P1, P2, P1k, P2k, and p (Table
2). The prevalence of the P1 phenotype varies among different
ethnic groups, ranging from 90 percent among Africans to 80
percent in whites down to 20 percent in Asians.10,23 On RBCs,
P1 expression changes during fetal development. The antigen
is found as early as week 12 but weakens during gestation.24 At
birth the expression is low, and it takes up to 7 years before full
expression is reached.25 The strength of the antigen expression
can differ from one person to another, and it was proposed
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
P1PK blood group system review
as early as 1953 to be dependent on dosage.26 The discovery
of a P 1/P 2-predictive single-nucleotide polymorphism (SNP)
did indeed prove this proposal to be correct, and it could be
confirmed with traditional serology, antigen site density
measurement by flow cytometry, and quantification of
transcription levels by real-time polymerase chain reaction.27
Table 2. A summary of phenotypes and possible antibodies for the
P1PK/GLOB blood groups
Phenotype
Prevalence
Antigens present on RBC
Antibodies in serum
P1
20–90%
P1, Pk, P
—
P2
10–80%
P,P
Anti-P1*
p
rare
—
Anti-PP1Pk
P1k
rare
P1, Pk
Anti-P**
P2
rare
Pk
Anti-P and P1**
k
k
*Not always present, detectable, or both.
**Anti-PX2 can be present.22
Individuals with the In(Lu) phenotype express lower
amounts of P1 antigen.28 In 2008 Singleton et al.29 found that
the majority (21 of 24) of such individuals are heterozygous for
mutations in their EKLF gene. This suggests that expression
of Pk and P1 on RBCs may depend on binding of the erythroid
transcription factor EKLF to the A4GALT promoter.
The Pk antigen was first thought to be a low-prevalence
antigen, but later it was understood that nearly all the antigens
are masked by addition of β3GalNAc to form globoside, the P
antigen.30 RBCs from P1 individuals express more Pk antigen
compared with those from P2 individuals.27,31 The rare null
phenotype, p, lacks the Pk, P, and P1 antigens (Table 2).
However, additional phenotypes might exist: Kundu et al.32,33
described individuals with either a weak P or a weak Pk antigen.
The frequency of the p phenotype has been estimated at
5.8 per million in Europeans,34 but for Swedes in Västerbotten
county in Northern Sweden the number of p individuals
is significantly higher (141 per million).35 The phenotype
also seems to be more common in Japan and among Amish
people.36,37 The frequency of p in the donor population in Israel
is comparable to that in other populations, but among Jews
who immigrated to Israel from North Africa the p phenotype
prevalence is 10 times as high.38
Naturally occurring antibodies of the IgM, IgG, or both
classes are formed against the missing P1/Pk carbohydrate
structures (Table 2), in the same way as they are against the
A/B carbohydrate structures in the ABO blood group system.
Anti-P1 is usually a weak and cold-reactive antibody
not implicated in hemolytic transfusion reaction (HTR)
or hemolytic disease of the fetus and newborn (HDFN).
However, some antibodies against P1 have been reported to
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
react at 37˚C, bind complement, and cause both immediate
and delayed HTRs.39–41
Anti-PP1Pk can cause HTR, but HDFN has not been
reported. Instead, some of the women with anti-PP1Pk, or
with anti-P in the globoside-deficient null phenotypes of the
GLOB blood group system, suffer from recurrent spontaneous
abortions.42,43 The fetus as well as the newborn express low
amounts of the P1, P, and Pk antigens, but the placenta shows
high expression and is therefore a possible target of the
antibodies that may be the cause of the miscarriages.43 It has been
suggested that it is mainly the IgG anti-P component in women
with the p phenotype that attacks the fetally derived cells in the
placenta.42,43 In a group of 17 female Swedish p individuals, 11
had experienced at least one spontaneous abortion.44
The anti-PP1Pk found in individuals with the p phenotype
was previously called anti-Tja, named after Mrs. J in whose
serum this antibody specificity was first found in association
with a tumor.2
NOR antigen expression, a low-prevalence polyagglutinable state, was first described in 1982 in a patient living in
Norton, Virginia, hence the name.45 So far, it has only been
found in two families, one in the United States and one in
Poland.45,46 The RBCs of the initial patient were agglutinated
by 75 percent of tested ABO-compatible sera but were not
agglutinated by any lectin known to react with other types of
polyagglutinable RBCs. The polyagglutination was inhibited
by avian P1 substance, and a possible relation to the P1PK
blood group system was suggested.45 Family studies showed
that the antigen was inherited and that anti-NOR is present
in most adult human sera; it has therefore been called a
polyagglutinin. It is unknown whether this kind of antibody
is clinically significant, because transfusion of NOR+ blood is
such a rare event.10
Genetics and Molecular Basis
The P1PK (A4GALT) Gene
The gene encoding the implicated 4-α-galactosyltransferase (α4Gal-T, EC 2.4.1.228) was cloned in 2000 by
three independent research groups47–49 and was originally
only found to give rise to the Pk antigen. The gene is located
on the long arm of chromosome 22 and consists of four exons
with the whole coding region in the last exon (Fig. 3). This
gene encodes a type II transmembrane glycoprotein with
353 amino acids and is highly conserved among different
species.48,50 The protein sequence contains a characteristic
DXD motif (amino acids 192–194), which is a conserved
motif existing in nearly all glycosyltransferases.51 It has been
27
Å. Hellberg et al.
A4GALT
353 aa
ATG
1
2a
2
30/60
347
145
5ʹ
TGA
3
ORF
3ʹ
1876
Fig. 3 The genomic organization of the A4GALT gene (not drawn to scale). The numbers in the boxes represent the exon number and
numbers below the boxes represent the number of base pairs in the exon. The black box shows the open reading frame (ORF).
proposed that this motif participates in the coordination of the
metal ion and therefore also in the binding of the nucleotide
part of the uridine diphosphate donor sugar.51 The crystal
x-ray structure of the enzyme has not been solved yet, and
the type of cation A4GALT required for its function has not
been clarified. The promoter region of the gene has binding
sequences for the transcription factor AP-1 (TGAGTCA), 160
bp upstream of the transcription start according to a computer
search done by Hughes et al.52 In another study, it was shown
that the promoter contains three binding sites for Sp1, four GC
boxes, but no TATA or CCAAT boxes.53 However, a specific
reason why this gene is expressed in erythroid tissues has not
been reported.
A major enigma has been why the P1 antigen is always
absent in the p phenotype. Different theories have been
proposed. One model suggested that the same enzyme,
α4Gal-T, is able to transfer galactosyl residues to both LacCer
and paragloboside, but to use the latter as the acceptor, a
regulatory protein is required.54 Another hypothesis suggested
that two different enzymes exist, both of which must be
inactivated to cause the p phenotype.54 This model was
supposedly supported by a study showing that microsomal
enzymes from P1 kidneys could synthesize both P1 and Pk,
whereas enzymes from P2 kidneys could only produce Pk.55 A
third model proposed a single gene with three alleles, one allele
coding for a α4Gal-T using LacCer and paragloboside as the
possible acceptors, one allele using LacCer only, and the third
allele coding for an inactive form of the transferase.56 However,
no polymorphisms in the coding region of the A4GALT gene
appeared to explain the P1/P2 phenotypes. Hence the theory
with one gene encoding for both P1 and Pk was temporarily
abandoned.47 Iwamura et al.57 proposed that transcriptional
regulation, caused by two different polymorphisms in
the 5´-regulatory region of A4GALT, might instead be the
underlying reason for the P1/P2 phenotypes. However, these
findings could not be verified in their own transcription assay
or in two other independent studies.58,59
In 2010, it was demonstrated that the A4GALT product
could also synthesize P1 antigen.60 A genetic marker with
which prediction of P1 versus P2 phenotype could be achieved
was reported when a novel A4GALT transcript, containing
28
exon 1 and a new exon, designated exon 2a, was discovered.27
This exon contains a P1- versus P2-associated polymorphism
(42C/T), which also opens a short potential reading frame in P2
alleles. However, the mechanism by which this SNP operates is
still unknown, even if 42T was shown to be correlated to lower
A4GALT-mRNA levels.27 The authors hypothesize that either
the new transcript, the hypothetical P2-related peptide, or the
SNP in the genomic sequence itself may downregulate the
transcription of A4GALT in P2 individuals. Alternatively, yet
other polymorphisms closely linked in cis with this SNP could
be involved. Several candidate SNPs occur in close proximity to
exon 2a and 42C/T, as do potential binding sites for erythroid
transcription factors. No matter which mechanism is active,
typing for the 42C/T polymorphism correctly predicted the P1/
P2 phenotype in 207 of 208 common Swedish blood donors,
and full concordance was recently obtained also in 200 Asian
donors (100 P1 and 100 P2).27,61
To date, 29 mutations in 33 alleles of the A4GALT gene
have been found to cause the p phenotype.44,62,63 For a complete
list of these mutations and alleles, see the homepage of the
International Society of Blood Transfusion (ISBT; www.
isbtweb.org). Two silent polymorphisms, 903G>C (P301P)
and 987G>A (T329T), as well as one missense mutation,
109A>G (M37V), with no apparent effect on the α4Gal-T,
have also been documented.47 These polymorphisms were
found to be organized into different haplotypes and linked to
upstream and downstream SNPs.58 In addition, a few other
noncritical polymorphisms have been found in combination
with enzyme-crippling, p-associated mutations.
A missense mutation in the A4GALT gene causing an
amino acid change, Gln211Glu, was found in individuals
positive for the rare NOR antigen.64 This is believed to make
the A4GALT-encoded enzyme add a galactose to the P antigen,
thereby forming NOR. Thus, in addition to making P1 and Pk
antigen, the Gln211Glu form of α4Gal-T also makes NOR. We
sequenced the A4GALT genes of NOR+ family members and
found that the NOR-specific SNP (631C>G) was linked to the
P1-associated exon 2a SNP 42C.64 Further elongation of the
NOR antigen (also called NOR1) can give rise to NORint and
NOR2,65 two glycolipid structures not yet given blood group
status by the ISBT.
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
P1PK blood group system review
Tissue Distribution
The expression of glycosphingolipids often shows a wide
histological distribution but varies among tissues and species.
Expression of the A4GALT-derived Pk and P1 antigens has
been studied in several species.48,66,67 Studies on mouse tissues
show expression patterns similar to those found in humans,
although some differences have been noted.66
The P1 structure is found as glycolipids, glycoproteins, or
both in many organisms such as the nematode (Ascaris suum),
tapeworm (Echinococcus granulosus), earthworm (Lumbricus
terrestris), liver fluke (Fasciola hepatica), bacterium (Neisseira
gonorrhoe), and pigeon.68 The Pk antigen is also expressed in
several strains of bacteria.69
In humans, glycosphingolipids can be useful as surface
markers of normal erythrocyte differentiation and of
erythroleukemias.70 The Pk and P1 antigens are expressed on a
number of other cells in addition to RBCs, but various studies
using different antibodies or methods have come to different
conclusions about where they are expressed. Pk has been
detected in plasma,41,71 but no such reports about P1 in plasma
or about Pk and P1 in secretions are available.
The P1 antigen is expressed on B lymphocytes,
granulocytes, and monocytes.72 The Pk antigen has been found
on all leucocytes (except NK cells),72 fibroblasts,30 platelets,
and smooth muscle cells of the digestive tract and urogenital
system73 and is a differentiation antigen expressed on a subset
of tonsillar B cells in the germinal center.74 High expression
of Pk in the kidney has been implicated in susceptibility to
hemolytic uremic syndrome (HUS), further discussed in the
section on disease associations. The mechanism behind the
high renal expression might be related to enhanced A4GALT
gene transcription and reduced α-galactosidase gene activity.52
Recently, it has also been shown that small amounts of Pk
together with higher amounts of P are present on intestinal
epithelial cells.75
Northern blot studies of human organs showed high
expression of the A4GALT gene in kidney and heart in one
study,47 while another report described high expression in
spleen, liver, testis, and placenta, in addition to kidney and
heart.49
Disease Associations
The Pk and P1 antigens can act as membrane receptors for
several pathogens and toxins, summarized in Table 3.
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Table 3. A selection of pathogens and toxins with a relationship to
the Pk and P1 antigens
Pathogen/toxin
Disease
Antigen
involved
Reference
Pk
76,77
HIV
AIDS
Uropathogenic Escherichia coli
UTI
P , P1
78,79
Streptococcus suis
Meningitis
P , P1
80
k
k
Shigella dysenteriae (Shiga toxin) Dysentery
P
Escherichia coli O157 (Stx 1/2)
Pk
81,82
Pk, P1
83
HUS, hemorrhagic
colitis
Pseudomonas aeruginosa (PA-IL Opportunistic
lectin)
human pathogen
k
81
HIV = human immunodeficiency virus; AIDS = acquired immune deficiency
syndrome; UTI = urinary tract infection; HUS = hemolytic uremic syndrome.
Viruses
Although initial studies implied a facilitating role for Pk in
human immunodeficiency virus (HIV) infection, recent work
has suggested that Pk is protective when accumulated owing
to reduced activity of α-galactosidase A in Fabry disease, an
X-linked lysosomal storage disorder.84 In addition, a soluble
analogue of Pk prevents HIV infection in vitro.77,85 Another
study showed that peripheral blood mononuclear cells (PBMCs)
with P1k phenotype were highly resistant to infection, whereas
PBMCs with the p phenotype showed increased susceptibility
to infection.76 Furthermore, Pk-liposome fusion into the Pkdeficient Jurkat T-cell line reduced productive X4 HIV-1
infection, as did overexpression of Pk synthase. Accordingly,
siRNA silencing of the Pk synthase gene increased the cells’
HIV susceptibility.76
Bacteria
Uropathogenic Escherichia coli expressing pap-encoded
PapG adhesins bind to Pk and P1,78,79 and both the Streptococcus
suis adhesin and the PA-IL lectin from Pseudomonas
aeruginosa use Pk (Gb3) and P1 as receptors.79,80,83,86
Furthermore, Pk is the receptor for Shiga toxin from Shigella
dysenteriae (Stx) or certain E. coli strains (Stx1 and Stx2) on
renal epithelium, platelets, and endothelium.81,82
A disease connected to the Pk antigen is Fabry disease, in
which deficiency of the lysosomal enzyme α-galactosidase A
causes accumulation of sphingolipids, mainly Pk, in some cell
types and body fluids.87 It has been shown that mice with Fabry
disease are protected against Stx from enterohemorrhagic
E. coli (EHEC).88 These data are surprising because Pk is the
cellular receptor for Stx and therefore a higher sensitivity
would be expected. The authors hypothesize that the excess
Pk can work as a toxin sink, which allows the toxin to bind
to Pk in tissues that normally do not have high expression
29
Å. Hellberg et al.
and cannot be affected by the toxin. EHEC infection can
induce HUS, which leads to hemolytic anemia, renal failure,
and thrombocytopenia.89 According to Furukawa et al.,90 the
mechanism behind the thrombocytopenia might be that Stx
binds to Pk in immature megakaryoblasts and induces their
apoptosis, leading to the restraint of platelet production in
the bone marrow. The Pk antigen has been shown to mediate
apoptotic signals after the binding of both Stx and anti-Pk
(CD77 monoclonal antibody). These ligands trigger two
completely different apoptotic pathways, one caspase- and
mitochondria-dependent and one reactive oxygen species–
dependent.91 It has also been shown that patients with HUS
have lower levels of Pk glycolipid in their sera compared with a
healthy control group.92 These authors propose that circulating
Stx could bind to Pk glycolipids in sera during infection, which
may reduce the amount of Stx binding to the target cells.
Consequently, patients with low serum levels of Pk would have a
higher susceptibility to EHEC infections. Another study states
that only Pk and not P1, as earlier believed, is the receptor for
Stx, and mice without Pk lose sensitivity to Stx.93
Cancer
Altered glycosylation patterns of glycosphingolipids
such as neoexpression, underexpression, or overexpression
are characteristic of cancer cells.94 One example is the first
described p individual (lacking Pk, P, and P1 antigens), who had
a gastric tumor that expressed P1 antigen. Levine95 proposed
that the antibodies made against the Pk, P, and P1 antigens
prevented further growth of the tumor. Altered expression
of Pk antigen has also been described in ovarian carcinomas,
colon cancer, breast cancer, and B-cell lymphomas.96 It has
even been suggested that Stx, which specifically binds to Pk,
could be used as a targeted cancer therapy.96
Summary
The history of the P1PK blood group system is complex
and not easy to grasp because of several changes of
nomenclature. In addition, the biochemical background and
genetic basis have caused long debates, and even today many
basic questions remain to be solved. However, step by step
the biochemical and genetic basis underlying the antigens
expressed in this system has been revealed. The most recent
but certainly not the final step came when it was clarified that
the A4GALT gene is responsible not only for Pk expression but
also for P1 and even NOR expression. As a result, the Pk and
later the NOR antigen joined the P1 antigen, and the system
name was changed to P1PK.
30
References
1. Landsteiner K, Levine P. Further observations on individual
differences of human blood. Proc Soc Exp Biol 1927;24:941–2.
2. Levine P, Bobbitt OB, Waller RK, Kuhmichel A. Isoimmunization
by a new blood factor in tumor cells. Proc Soc Exp Biol Med
1951;77:403–5.
3. Sanger R. An association between the P and Jay systems of
blood groups. Nature 1955;176:1163–4.
4. Matson GA, Swanson J, Noades J, Sanger R, Race RR. A “new”
antigen and antibody belonging to the P blood group system.
Amer J Hum Genet 1959;11:26–34.
5.Race RR, Sanger R. Blood groups in man. 5th ed. Oxford,
Edinburgh: Blackwell Scientific, 1968.
6.Naiki M, Marcus DM. Human erythrocyte P and Pk blood
group antigens: identification as glycosphingolipids. Biochem
Biophys Res Commun 1974;60:1105–11.
7.Hellberg Å, Poole J, Olsson ML. Molecular basis of the
globoside-deficient Pk blood group phenotype. Identification of
four inactivating mutations in the UDP-N-acetylgalactosamine:
globotriaosylceramide 3-beta-N-acetylgalactosaminyltransferase gene. J Biol Chem 2002;277:29455–9.
8.Daniels GL, Fletcher A, Garratty G, et al. Blood group
terminology 2004: from the International Society of Blood
Transfusion committee on terminology for red cell surface
antigens. Vox Sang 2004;87:304–16.
9. Storry JR, Castilho L, Daniels G, et al. International Society of
Blood Transfusion Working Party on red cell immunogenetics
and blood group terminology: Berlin report. Vox Sang 2011;
101:77–82.
10.Reid ME, Lomas-Francis C, Olsson ML. The blood group
antigen factsbook. 3rd ed. London: Academic Press, 2012.
11. Hellberg Å, Westman JS, Olsson ML. An update on the GLOB
blood group system and collection. Immunohematology
2013;29:19–24.
12. Knapp W, Dorken B, Rieber P, Schmidt RE, Stein H, Von Dem
Borne AE. CD antigens 1989. Blood 1989;74:1448–50.
13.Thudichum JLW. A treatise on the chemical constituents of
the brain (a facsimile edition of the original, 1962), London:
Baillière, Tindall and Cox, 1884.
14.Hakomori S. Structure, organization, and function of
glycosphingolipids in membrane. Curr Opin Hematol 2003;
10:16–24.
15.Sandhoff K, Kolter T. Biosynthesis and degradation of
mammalian glycosphingolipids. Philos Trans R. Soc Lond B
Biol Sci 2003;358:847–61.
16.Morgan WT, Watkins WM. Blood group P1 substance. I.
Chemical properties. Bibl Haematol 1964;19:225–9.
17.Marcus DM. Isolation of a substance with blood-group P1
activity for human erythrocyte stroma. Transfusion 1971;
11:16–8.
18. Siddiqui B, Hakomori S. A revised structure for the Forssman
glycolipid hapten. J Biol Chem 971;246: 5766–9.
19.Svensson L, Hult AK, Stamps R, Angstrom J, Teneberg S,
Storry JR, Jorgensen R, Rydberg L, Henry SM, Olsson ML.
Forssman expression on human erythrocytes: biochemical
and genetic evidence of a new histo-blood group system. Blood
2013;121:1459–68.
20. Rydberg L, Cedergren B, Breimer ME, Lindstrom K, Nyholm
PG, Samuelsson BE. Serological and immunochemical
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
P1PK blood group system review
characterization of anti-PP1Pk (anti-Tja) antibodies in blood
group little p individuals. Blood group A type 4 recognition due
to internal binding. Mol Immunol 1992;29:1273–86.
21.Yang Z, Bergström J, Karlsson KA. Glycoproteins with Gal
alpha 4Gal are absent from human erythrocyte membranes,
indicating that glycolipids are the sole carriers of blood group P
activities. J Biol Chem 1994;269:14620–4.
22. Olsson ML, Peyrard T, Hult AK, et al. PX2: A new blood group
antigen with implications for transfusion recommendations in
P1k and P2k individuals. Vox Sang 2011;101:1–79.
23.Mourant AE, Kopec AC, Domaniewska-Sobczak K. The
distribution of human blood groups and other polymorphisms:
(monographs on medical genetics). 2nd ed. London: Oxford
University Press, 1976.
24. Ikin EW, Kay HEM, Playfair JHL, Mourant AE. P1 antigen in
the human fetus. Nature 1961;192:883–4.
25. Heiken A. Observations on the blood group receptor P1 and its
development in children. Hereditas 1966;56:83–98.
26.Fisher R. The variation in the strength of the human blood
group P. Heredity 1953;7:81–9.
27.Thuresson B, Westman JS, Olsson ML. Identification of a
novel A4GALT exon reveals the genetic basis of the P1/P2
histo-blood groups. Blood 2011;117:678–87.
28.Crawford MN, Tippett P, Sanger R. Antigens Aua, i and P1
of cells of the dominant type of Lu(a–b–). Vox Sang 1974;
26:283–7.
29.Singleton BK, Burton NM, Green C, Brady RL, Anstee DJ.
Mutations in EKLF/KLF1 form the molecular basis of the rare
blood group In(Lu) phenotype. Blood 2008;112:2081–8.
30. Fellous M, Gerbal A, Tessier C, Frezal J, Dausset J, Salmon C.
Studies on the biosynthetic pathway of human P erythrocyte
antigens using somatic cells in culture. Vox Sang 1974;
26:518–36.
31.Fletcher KS, Bremer EG, Schwarting GA. P blood group
regulation of glycosphingolipid levels in human erythrocytes.
J Biol Chem 1979;254:11196–8.
32.Kundu SK, Steane SM, Bloom JE, Marcus DM. Abnormal
glycolipid composition of erythrocytes with a weak P antigen.
Vox Sang 1978;35:160–7.
33. Kundu SK, Evans A, Rizvi J, Glidden H, Marcus DM. A new
Pk phenotype in the P blood group system. J Immunogenet
1980;7:431–9.
34.Race RR, Sanger R. Blood Groups in Man. Oxford, UK:
Blackwell Scientific Publications, 1975.
35.Cedergren B. Population studies in northern Sweden. IV.
Frequency of the blood type p. Hereditas 1973;73:27–30.
36. Miwa S, Matuhasi T, Yasuda J. p phenotype in two successive
generations of a Japanese family. Vox Sang 1974;26:565–7.
37. Obregon E, McKeever BG. Studies on offspring of pp mothers
(abstract). Transfusion 1980;20:621–2.
38. Levene C, Shinar E, Yahalom V. Rare blood group p Tj(a–) in
Israel 1975–1999 (abstract). Vox Sang 2000;78S1:P010.
39.Arndt PA, Garratty G, Marfoe RA, Zeger GD. An acute
hemolytic transfusion reaction caused by an anti-P1 that
reacted at 37 degrees C. Transfusion 1998;38:373–7.
40. Chandeysson PL, Flye MW, Simpkins SM, Holland PV. Delayed
hemolytic transfusion reaction caused by anti-P1 antibody.
Transfusion 1981;21:77–82.
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
41. Issitt PD, Anstee DJ. Applied Blood Group Serology. Miami,
FL, USA: Montgomery Scientific Publications, 1998.
42.Cantin G, Lyonnais J. Anti-PP1Pk and early abortion.
Transfusion 1983;23:350–1.
43. Lindstrom K, Von Dem Borne AE, Breimer ME, et al. Glycosphingolipid expression in spontaneously aborted fetuses and
placenta from blood group p women. Evidence for placenta
being the primary target for anti-Tja-antibodies. Glycoconj
1992;9:325–9.
44. Hellberg Å, Steffensen R, Yahalom V, et al. Additional molecular
bases of the clinically important p blood group phenotype.
Transfusion 2003;43:899–907.
45.Harris PA, Roman GK, Moulds JJ, Bird GW, Shah NG. An
inherited RBC characteristic, NOR, resulting in erythrocyte
polyagglutination. Vox Sang 1982;42:134–40.
46.Kusnierz-Alejska G, Duk M, Storry JR, et al. NOR
polyagglutination and Sta glycophorin in one family: relation
of NOR polyagglutination to terminal alpha-galactose residues
and abnormal glycolipids. Transfusion 1999;39:32–8.
47. Steffensen R, Carlier K, Wiels J, et al. Cloning and expression
of the histo-blood group Pk UDP-galactose: Gal-beta1-4Glcbeta1-Cer alpha1,4-galactosyltransferase. Molecular genetic
basis of the p phenotype. J Biol Chem 2000;275:16723–9.
48.Keusch JJ, Manzella SM, Nyame KA, Cummings RD,
Baenziger JU. Cloning of Gb3 synthase, the key enzyme in
globo-series glycosphingolipid synthesis, predicts a family of
alpha 1, 4-glycosyltransferases conserved in plants, insects,
and mammals. J Biol Chem 2000;275:25315–21.
49. Kojima Y, Fukumoto S, Furukawa K, et al. Molecular cloning of
globotriaosylceramide/CD77 synthase, a glycosyltransferase
that initiates the synthesis of globo series glycosphingolipids.
J Biol Chem 2000;275:15152–6.
50.Paulson JC, Colley KJ. Glycosyltransferases. Structure,
localization, and control of cell type-specific glycosylation. J
Biol Chem 1989;264:17615–18.
51.
Breton C, Imberty A. Structure/function studies of
glycosyltransferases. Curr Opin Struct Biol 1999;9:563–71.
52.Hughes AK, Ergonul Z, Stricklett PK, Kohan DE. Molecular
basis for high renal cell sensitivity to the cytotoxic effects
of shigatoxin-1: upregulation of globotriaosylceramide
expression. J Am Soc Nephrol 2002;13:2239–45.
53. Okuda T, Nakayama K. Identification and characterization of
the human Gb3/CD77 synthase gene promoter. Glycobiology
2008;18:1028–35.
54.Naiki M, Marcus DM. An immunochemical study of the
human blood group P1, P, and PK glycosphingolipid antigens.
Biochemistry 1975;14:4837–41.
55. Bailly P, Piller F, Gillard B, Veyrières A, Marcus D, Cartron JP.
Biosynthesis of the blood group Pk and P1 antigens by human
kidney microsomes. Carbohyd Res 1992;228:277–87.
56. Graham HA, Williams AN. A genetic model for the inheritance
of the P, P1 and Pk antigens. Immunol Commun 1980;9:
191–201.
57. Iwamura K, Furukawa K, Uchikawa M, et al. The blood group
P1 synthase gene is identical to the Gb3/CD77 synthase gene.
A clue to the solution of the P1/P2/p puzzle. J Biol Chem 2003;
278:44429–38.
31
Å. Hellberg et al.
58. Hellberg Å, Chester MA, Olsson ML. Two previously proposed
P1/P2-differentiating and nine novel polymorphisms at the
A4GALT (Pk) locus do not correlate with the presence of the P1
blood group antigen. BMC Genet 2005;6:49.
59.Tilley L, Green C, Daniels G. Sequence variation in the 5ʹ
untranslated region of the human A4GALT gene is associated
with, but does not define, the P1 blood-group polymorphism.
Vox Sang 2006;90:198–203.
60.Suzuki N, Yamamoto K. Molecular cloning of pigeon UDPgalactose:beta-D-galactoside alpha1,4-galactosyltransferase
and UDP-galactose:beta-D-galactoside beta1,4-galactosyltransferase, two novel enzymes catalyzing the formation of
Gal alpha1-4Gal beta1-4Gal beta1-4GlcNAc sequence. J Biol
Chem 2010;285:5178–87.
61.Wang Y, Lin K, Lin K, Hung C, Lin T. P1/P2 Genotype
Screening in Southern Taiwan (abstract). Transfusion 2012;52
(Suppl):161A.
62. Hellberg Å, Ringressi A, Yahalom V, Säfwenberg J, Reid ME,
Olsson ML. Genetic heterogeneity at the glycosyltransferase
loci underlying the GLOB blood group system and collection.
Br J Haematol 2004;125:528–36.
63.Hellberg Å, Schmidt-Melbye AC, Reid ME, Olsson ML.
Expression of a novel missense mutation found in the A4GALT
gene of Amish individuals with the p phenotype. Transfusion
2008;48:479–87.
64. Suchanowska A, Kaczmarek R, Duk M, et al. A single point
mutation in the gene encoding Gb3/CD77 synthase causes
a rare inherited polyagglutination syndrome. J Biol Chem
2012;287:38220–30.
65.Duk M, Singh S, Reinhold VN, Krotkiewski H, Kurowska
E, Lisowska E. Structures of unique globoside elongation
products present in erythrocytes with a rare NOR phenotype.
Glycobiology 2007;17:304–12.
66.Fujii Y, Numata S, Nakamura Y, et al. Murine glycosyltransferases responsible for the expression of globo-series
glycolipids: cDNA structures, mRNA expression, and
distribution of their products. Glycobiology 2005;15:1257–67.
67. Zoja C, Corna D, Farina C, et al. Verotoxin glycolipid receptors
determine the localization of microangiopathic process in
rabbits given verotoxin-1. J Lab Clin Med 1992;120:229–38.
68.Daniels G. Human blood groups. Oxford, UK: Blackwell
Scientific, 2002.
69.Mandrell RE. Further antigenic similarities of Neisseria
gonorrhoeae lipooligosaccharides and human glycosphingolipids. Infection Immun 1992;60:3017–20.
70. Suzuki A, Karol RA, Kundu SK, Marcus DM. Glycosphingolipids
of K562 cells: a chemical and immunological analysis. Int J
Cancer 1981;28:271–6.
71.Svennerholm E, Svennerholm L. The separation of neutral
blood-serum glycolipids by thin-layer chromatography.
Biochim Biophys Acta 1963;70:432–41.
72.Ingolfsdottir R, Hult A, Olsson ML. Flow cytometric
assessment of carbohydrate histo-blood group expression on
leucocyte subpopulations (abstract). Vox Sang 2010;99:394.
73.Kasai K, Galton J, Terasaki PI, et al. Tissue distribution of
the Pk antigen as determined by a monoclonal antibody. J
Immunogenet 1985;12:213–20.
74. Mangeney M, Richard Y, Coulaud D, Tursz T, Wiels J. CD77:
an antigen of germinal center B cells entering apoptosis. Eur J
Immunol 1991;21:1131–40.
32
75. Zumbrun SD, Hanson L, Sinclair JF, et al. Human intestinal
tissue and cultured colonic cells contain globotriaosylceramide
synthase mRNA and the alternate Shiga toxin receptor
globotetraosylceramide. Infect Immun 2010;78:4488–99.
76.Lund N, Olsson ML, Ramkumar S, Sakac D, Yahalom V,
Levene C, Hellberg Å, Ma XZ, Binnington B, Jung D, Lingwood
CA, Branch DR. The human P(k) histo-blood group antigen
provides protection against HIV-1 infection. Blood 2009;
113:4980–91.
77.Harrison AL, Olsson ML, Jones RB, et al. A synthetic
globotriaosylceramide analogue inhibits HIV-1 infection in
vitro by two mechanisms. Glycoconj J 2010;27:515–24.
78.Moulds JM, Moulds JJ. Blood group associations with
parasites, bacteria, and viruses. Transfus Med Rev 2000;14:
302–11.
79.Ziegler T, Jacobsohn N, Funfstuck R. Correlation between
blood group phenotype and virulence properties of Escherichia
coli in patients with chronic urinary tract infection. Int J
Antimicrob Agents 2004;24(Suppl 1):S70–5.
80. Haataja S, Tikkanen K, Liukkonen J, Francois-Gerard C, Finne
J. Characterization of a novel bacterial adhesion specificity
of Streptococcus suis recognizing blood group P receptor
oligosaccharides. J Biol Chem 1993;268:4311–7.
81.Johannes L, Romer W. Shiga toxins—from cell biology to
biomedical applications. Nat Rev Microbiol 2010;8:105–16.
82. Lingwood CA, Law H, Richardson S, Petric M, Brunton JL,
De Grandis S, Karmali M. Glycolipid binding of purified and
recombinant Escherichia coli produced verotoxin in vitro. J
Biol Chem 1987;262:8834–9.
83. Blanchard B, Nurisso A, Hollville E, Tetaud C, Wiels J, Pokorna
M, Wimmerova M, Varrot A, Imberty A. Structural basis of
the preferential binding for globo-series glycosphingolipids
displayed by Pseudomonas aeruginosa lectin I. J Mol Biol
2008;383:837–53.
84.Lund N, Branch DR, Sakac D, Lingwood CA, Siatskas C,
Robinson CJ, Brady RO, Medin JA. Lack of susceptibility of cells
from patients with Fabry disease to productive infection with
R5 human immunodeficiency virus. AIDS 2005;19:1543–6.
85. Lund N, Branch DR, Mylvaganam M, Chark D, Ma XZ, Sakac
D, Binnington B, Fantini J, Puri A, Blumenthal R, Lingwood
CA. A novel soluble mimic of the glycolipid, globotriaosyl
ceramide inhibits HIV infection. AIDS 2006;20:333–43.
86.Imberty A, Wimmerova M, Mitchell EP, Gilboa-Garber N.
Structures of the lectins from Pseudomonas aeruginosa:
insight into the molecular basis for host glycan recognition.
Microbes Infect 2004;6:221–8.
87. Bekri S, Lidove O, Jaussaud R, Knebelmann B, Barbey F. The
role of ceramide trihexoside (globotriaosylceramide) in the
diagnosis and follow-up of the efficacy of treatment of Fabry
disease: a review of the literature. Cardiovasc Hematol Agents
Med Chem 2006;4:289–97.
88. Cilmi SA, Karalius BJ, Choy W, Smith RN, Butterton JR. Fabry
disease in mice protects against lethal disease caused by Shiga
toxin-expressing enterohemorrhagic Escherichia coli. J Infect
Dis 2006;194:1135–40.
89.Proulx F, Seidman EG, Karpman D. Pathogenesis of Shiga
toxin-associated hemolytic uremic syndrome. Pediatric
Research 2001;50:163–71.
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
P1PK blood group system review
90.Furukawa K, Yokoyama K, Sato T, Wiels J, Hirayama Y,
Ohta M. Expression of the Gb3/CD77 synthase gene in
megakaryoblastic leukemia cells: implication in the sensitivity
to verotoxins. J Biol Chem 2002;277:11247–54.
91.Tétaud C, Falguieres T, Carlier K, et al. Two distinct Gb3/
CD77 signaling pathways leading to apoptosis are triggered
by anti-Gb3/CD77 mAb and verotoxin-1. J Biol Chem
2003;278:45200–8.
92. Watarai S, Yokota K, Tana, Kishimoto T, Kanadani T, Taketa
K, Oguma K. Relationship between susceptibility to hemolyticuremic syndrome and levels of globotriaosylceramide in
human sera. J Clin Microbiol 2001;39:798–800.
93. Okuda T, Tokuda N, Numata S, et al. Targeted disruption of
Gb3/CD77 synthase gene resulted in the complete deletion
of globo-series glycosphingolipids and loss of sensitivity to
verotoxins. J Biol Chem 2006;281:10230–5.
94.Dwek MV, Brooks SA. Harnessing changes in cellular
glycosylation in new cancer treatment strategies. Curr Cancer
Drug Targets 2004;4:425–42.
95. Levine P. Illegitimate blood group antigens P1, A, and MN (T)
in malignancy—a possible therapeutic approach with anti-Tja,
anti-A, and anti-T. Ann Aca Sci 1976;277:428–35.
96. Engedal N, Skotland T, Torgersen ML, Sandvig K. Shiga toxin
and its use in targeted cancer therapy and imaging. Microb
Biotechnol 2011;4:32–46.
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Åsa Hellberg, PhD (corresponding author), Coordinator at the
Nordic Reference Laboratory for Genomic Blood Group Typing,
Department of Clinical Immunology and Transfusion Medicine,
University and Regional Laboratories, SE-221 85 Lund, Sweden,
and Division of Hematology and Transfusion Medicine, Department
of Laboratory Medicine, Lund University, SE-221 00 Lund, Sweden,
Julia S. Westman, MSc, PhD student, Division of Hematology and
Transfusion Medicine, Department of Laboratory Medicine, Lund
University, Britt Thuresson, PhD, Postdoc, Department of Clinical
Immunology and Transfusion Medicine, University and Regional
Laboratories, SE-221 85 Lund, Sweden, and Division of Hematology
and Transfusion Medicine, Department of Laboratory Medicine,
Lund University, SE-221 00 Lund, Sweden, and Martin L. Olsson,
MD, PhD, Medical Director of the Nordic Reference Laboratory for
Genomic Blood Group Typing, Professor and Senior Consultant at
the Department of Clinical Immunology and Transfusion Medicine,
University and Regional Laboratories, and Division of Hematology
and Transfusion Medicine, Department of Laboratory Medicine,
Lund University, Lund, Sweden.
33
C o m m u n i c at i o n
Letter to the Readers
In this issue of Immunohematology, we introduce the New Blood Group Allele Report. This is a mechanism for
describing a blood group allele that has not been described in a peer-reviewed publication. Genetic variation in blood
groups is extensive, and although the Human Genome Project and HapMap Projects have been completed, there continue
to be new discoveries of blood group alleles associated with a serologic phenotype and, in some cases, found in individuals
with an antibody to the associated antigen. Oftentimes, these alleles are shared with the blood banking and molecular
immunohematology community through abstracts at scientific meetings. However, in many cases the discovery of these
alleles is not subjected to peer review nor published in a journal, where it can be found via a literature search (PubMed).
Another avenue to communicate the new finding is through the International Society of Blood Transfusion (ISBT) Working
Party on Blood Group Allele Terminology (http://www.isbtweb.org/working-parties/red-cell-immunogenetics-and-bloodgroup-terminology/blood-group-terminology/blood-group-allele-terminology/), where new alleles can be assigned an allele
number, using a standard nomenclature format, and posted on a Web site for easy reference. However, this venue does not
capture important supporting information about the allele, such as in what ethnic group it was discovered, what methods
were used to identify it, and any references that include more detail.
With the New Blood Group Allele Report, Immunohematology is filling a need to communicate these new alleles to the
community. The format for these submissions is designed to be straightforward, capturing parameters about the new allele that
are pertinent, and to allow the information to be shared efficiently. Refer to the Instructions for Authors page. We hope our readers
will use this forum to share their discoveries.
34
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Announcements
University of Southern California Keck School of Medicine
Transfusion Medicine | Clinical Track—Open Rank
The Department of Pathology and Laboratory Medicine of the Keck School of Medicine at the University of Southern California
invites applicants for a faculty position in the Division of Transfusion Medicine in the clinical professorial series, open rank.
Candidates for appointment must hold an M.D. degree and a California Medical license, be certified in Clinical Pathology, and
be board eligible or certified in Transfusion Medicine. Candidates should have a demonstrated commitment to teaching and
clinical service with expertise in Blood Banking and Transfusion Medicine. Additional experience/expertise in coagulation and
hemostasis is highly desirable. The University of Southern California is an Affirmative Action/Equal Opportunity Employer.
Academic rank and salary are commensurate with qualifications. Interested candidates should apply on line at http://jobs.usc.
edu/applicants/Central?quickFind=68370 and submit their curriculum vitae, four academic references, and a synopsis of recent
activities.
Manuscripts
The editorial staff of Immunohematology welcomes manuscripts
pertaining to blood group serology and education for consideration
for publication. We are especially interested in case reports, papers
on platelet and white cell serology, scientific articles covering
original investigations, and papers on new methods for use in the
blood bank. For instructions for scientific articles, case reports,
and review articles, see Instructions for Authors in every issue of
Immunohematology or e-mail a request to [email protected].
Include fax and phone numbers and e-mail address with
all manuscripts and correspondence. E-mail all manuscripts
to [email protected]
Free Classified Ads and Announcements
Immunohematology will publish classified ads and announcements (SBB schools, meetings, symposia, etc.) without charge.
E-mail information to [email protected] or fax to (215) 451-2538
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
35
Announcements, cont.
36
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Announcements, cont.
Masters (MSc) in Transfusion and Transplantation Sciences
at
The University of Bristol, England
Applications are invited from medical or science graduates for the Master of Science (MSc) degree in
Transfusion and Transplantation Sciences at the University of Bristol. The course starts in October
2013 and will last for 1 year. A part-time option lasting 2 or 3 years is also available. There may also
be opportunities to continue studies for PhD or MD following the MSc. The syllabus is organized
jointly by The Bristol Institute for Transfusion Sciences and the University of Bristol, Department of
Pathology and Microbiology. It includes:
• Scientific principles of transfusion and transplantation
• Clinical applications of these principles
• Practical techniques in transfusion and transplantation
• Principles of study design and biostatistics
• An original research project
Application can also be made for Diploma in Transfusion and Transplantation Science or a Certificate
in Transfusion and Transplantation Science.
The course is accredited by the Institute of Biomedical Sciences.
Further information can be obtained from the Web site:
http://ibgrl.blood.co.uk/MSc/MscHome.htm
For further details and application forms please contact:
Dr Patricia Denning-Kendall
University of Bristol
Paul O’Gorman Lifeline Centre
Department of Pathology and Microbiology
Southmead Hospital
Westbury-on-Trym, Bristol BS10 5NB, England
Fax +44 1179 595 342, Telephone +44 1779 595 455, e-mail: [email protected].
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
37
A dv e rtise m e nts
Reference and Consultation Services
Antibody identification and problem resolution
HLA-A, B, C, and DR typing
HLA-disease association typing
Paternity testing/DNA
IgA/Anti-IgA Testing
IgA and anti-IgA testing are available to do the
following:
• Identify IgA-deficient patients
• Investigate anaphylactic reactions
• Confirm IgA-deficient donors
F or
infor mation , c ontac t :
Mehdizadeh Kashi
at (503) 280-0210
Our ELISA for IgA detects protein to 0.05 mg/dL.
F or
additional infor mation c ontac t :
Janet Demcoe at (215) 451-4914,
or e-mail:
or write to:
[email protected]
Tissue Typing Laboratory
or write to:
American Red Cross Biomedical Services
American Red Cross Biomedical Services
Pacific Northwest Region
Musser Blood Center
700 Spring Garden Street
3131 North Vancouver
Portland, OR 97227
Philadelphia, PA 19123-3594
ATTN: Janet Demcoe
CLIA licensed, ASHI accredited
CLIA licensed
Donor IgA Screening
National Reference Laboratory
for Blood Group Serology
• Effective tool for screening large volumes of donors
Immunohematology Reference Laboratory
AABB, ARC, New York State, and CLIA licensed
24-hour phone number:
(215) 451-4901
Fax: (215) 451-2538
American Rare Donor Program
24-hour phone number:
(215) 451-4900
Fax: (215) 451-2538
[email protected]
Immunohematology
Phone, business hours:
(215) 451-4902
Fax: (215) 451-2538
[email protected]
Quality Control of Cryoprecipitated–AHF
Phone, business hours:
(215) 451-4903
Fax: (215) 451-2538
• Gel diffusion test that has a 15-year proven track record:
Approximately 90 percent of all donors identified as
IgA deficient by this method are confirmed by the more
sensitive testing methods
F or
additional infor mation :
Kathy Kaherl
at (860) 678-2764
e-mail:
[email protected]
or write to:
Reference Laboratory
American Red Cross Biomedical Services
Connecticut Region
209 Farmington Ave.
Farmington, CT 06032
CLIA licensed
38
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Advertisements, cont.
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
39
Advertisements, cont.
National Platelet Serology Reference Laboratory
Diagnostic testing for:
•
•
•
•
•
Neonatal alloimmune thrombocytopenia (NAIT)
Posttransfusion purpura (PTP)
Refractoriness to platelet transfusion
Heparin-induced thrombocytopenia (HIT)
Alloimmune idiopathic thrombocytopenia purpura (AITP)
Medical consultation available
Test methods:
•
•
•
•
•
GTI systems tests
— detection of glycoprotein-specific platelet antibodies
— detection of heparin-induced antibodies (PF4 ELISA)
Platelet suspension immunofluorescence test (PSIFT)
Solid phase red cell adherence (SPRCA) assay
Monoclonal immobilization of platelet antigens (MAIPA)
Molecular analysis for HPA-1a/1b
For
further information, contact:
Platelet Serology Laboratory (215) 451-4205
Our laboratory specializes in granulocyte antibody detection
and granulocyte antigen typing.
Indications for granulocyte serology testing
include:
• Alloimmune neonatal neutropenia (ANN)
• Autoimmune neutropenia (AIN)
• Transfusion-related acute lung injury (TRALI)
Methodologies employed:
• Granulocyte agglutination (GA)
• Granulocyte immunofluorescence by flow cytometry (GIF)
• Monoclonal antibody immobilization of neutrophil antigens
(MAINA)
TRALI investigations also include:
• HLA (PRA) Class I and Class II antibody detection
For
further information, contact:
Janet Demcoe (215) 451-4914
[email protected]
Neutrophil Serology Laboratory (651) 291-6797
Sandra Nance (215) 451-4362
[email protected]
Randy Schuller (651) 291-6758
[email protected]
American Red Cross Biomedical Services
Musser Blood Center
700 Spring Garden Street
Philadelphia, PA 19123-3594
CLIA licensed
40
National Neutrophil Serology Reference Laboratory
American Red Cross Biomedical Services
Neutrophil Serology Laboratory
100 South Robert Street
St. Paul, MN 55107
CLIA licensed
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Advertisements, cont.
Becoming a Specialist in Blood Banking (SBB)
What is a certified Specialist in Blood Banking (SBB)?
• Someone with educational and work experience qualifications who successfully passes the American Society for Clinical Pathology
(ASCP) Board of Certification (BOC) examination for the Specialist in Blood Banking.
• This person will have advanced knowledge, skills, and abilities in the field of transfusion medicine and blood banking.
Individuals who have an SBB certification serve in many areas of transfusion medicine:
• Serve as regulatory, technical, procedural, and research advisors
• Perform and direct administrative functions
• Develop, validate, implement, and perform laboratory procedures
• Analyze quality issues preparing and implementing corrective actions to prevent and document nonconformances
• Design and present educational programs
• Provide technical and scientific training in transfusion medicine
• Conduct research in transfusion medicine
Who are SBBs?
Supervisors of Transfusion Services
Supervisors of Reference Laboratories
Quality Assurance Officers
Why become an SBB?
Professional growth
Executives and Managers of Blood Centers
Research Scientists
Technical Representatives
Job placement
LIS Coordinators
Consumer Safety Officers
Reference Lab Specialists
Job satisfaction
Educators
Career advancement
How does one become an SBB?
CAAHEP-accredited SBB Technology program or grandfather the exam based on ASCP education and experience criteria.
Fact: In recent years, a greater percentage of individuals who graduate from CAAHEP-accredited programs pass the SBB exam compared
to individuals who grandfather the exam. The BEST route for obtaining an SBB certification is to attend a CAAHEP-accredited Specialist in
Blood Bank Technology Program.
Which approach are you more compatible with?
Contact the following programs for more information:
Additional information can be found by visiting the following Web sites: www.ascp.org, www.caahep.org, and www.aabb.org
 Onsite or
: Online
Program
Contact Name
Phone Contact
E-mail Contact
Web Site
Blood Systems Laboratories
Marie P. Holub
602-996-2396
[email protected]
www.bloodsystemslaboratories.org
Program
Walter Reed Army Medical Center
William Turcan
301-295-8605
[email protected]
[email protected]
www.militaryblood.dod.mil/Fellow/default.aspx
American Red Cross, Southern California Region
Catherine Hernandez
909-859-7496
[email protected] www.redcrossblood.org/socal/communityeducation
ARC-Central OH Region
Joanne Kosanke
614-253-2740 ext. 2270
[email protected]
none
Blood Center of Wisconsin
Phyllis Kirchner
414-937-6271
[email protected]
www.bcw.edu
Community Blood Center/CTS Dayton, Ohio
Nancy Lang
937-461-3293
[email protected]
www.cbccts.org/education/sbb.htm
Gulf Coast Regional Blood Center
Clare Wong
713-791-6201
[email protected]
www.giveblood.org/services/education/sbb-distance-program
Hoxworth Blood Center, University of Cincinnati
Medical Center
Pamela Inglish
513-558-1275
[email protected]
www.grad.uc.edu
Indiana Blood Center
Jayanna Slayten
317-916-5186
[email protected]
www.indianablood.org
Johns Hopkins Hospital
Lorraine N. Blagg
410-502-9584
[email protected]
http://pathology.jhu.edu/department/divisions/transfusion/sbb.cfm
Medical Center of Louisiana
Karen Kirkley
504-903-3954
[email protected]
www.mclno.org/webresources/index.html
NIH Clinical Center Blood Bank
Karen Byrne
301-496-8335
[email protected]
www.cc.nih.gov/dtm
Rush University
Yolanda Sanchez
312-942-2402
[email protected]
www.rushu.rush.edu/cls
Transfusion Medicine Center at Florida Blood Services
Marjorie Doty
727-568-5433 ext. 1514
[email protected]
www.fbsblood.org
Univ. of Texas Health Science Center at San Antonio
Linda Myers
210-731-5526
[email protected]
www.sbbofsa.org
University of Texas Medical Branch at Galveston
Janet Vincent
409-772-3055
[email protected]
www.utmb.edu/sbb
University of Texas SW Medical Center
Lesley Lee
214-648-1785
[email protected]
www.utsouthwestern.edu/education/school-of-health-professions/
programs/certificate-programs/medical-laboratory-sciences/index.html
:




:
:

:



:
:

:
:
Revised May 2012
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
41
Immunohematology
Instructions for Authors
I. GENERAL INSTRUCTIONS
Before submitting a manuscript, consult current issues of Immunohematology for style.
Number the pages consecutively, beginning with the title page.
II. SCIENTIFIC ARTICLE, REVIEW, OR CASE REPORT WITH
LITERATURE REVIEW
A. Each component of the manuscript must start on a new page in the following
order:
1. Title page
2.Abstract
3.Text
4.Acknowledgments
5.References
6. Author information
7.Tables
8.Figures
B. Preparation of manuscript
1. Title page
a. Full title of manuscript with only first letter of first word capitalized (bold
title)
b. Initials and last name of each author (no degrees; all CAPS), e.g., M.T. JONES,
J.H. BROWN, AND S.R. SMITH
c. Running title of ≤40 characters, including spaces
d. Three to ten key words
2.Abstract
a. One paragraph, no longer than 300 words
b. Purpose, methods, findings, and conclusion of study
3. Key words
a. List under abstract
4. Text (serial pages): Most manuscripts can usually, but not necessarily, be divided
into sections (as described below). Survey results and review papers may need
individualized sections
a. Introduction — Purpose and rationale for study, including pertinent
background references
b. Case Report (if indicated by study) — Clinical and/or hematologic data and
background serology/molecular
c. Materials and Methods — Selection and number of subjects, samples, items,
etc. studied and description of appropriate controls, procedures, methods,
equipment, reagents, etc. Equipment and reagents should be identified in
parentheses by model or lot and manufacturer’s name, city, and state. Do not
use patient’s names or hospital numbers.
d. Results — Presentation of concise and sequential results, referring to
pertinent tables and/or figures, if applicable
e. Discussion — Implication and limitations of the study, links to other studies; if
appropriate, link conclusions to purpose of study as stated in introduction
5. Acknowledgments: Acknowledge those who have made substantial contributions
to the study, including secretarial assistance; list any grants.
6.References
a. In text, use superscript, Arabic numbers.
b. Number references consecutively in the order they occur in the text.
7.Tables
a. Head each with a brief title; capitalize the first letter of first word (e.g., Table
1. Results of…) use no punctuation at the end of the title.
42
b. Use short headings for each column needed and capitalize first letter of first
word. Omit vertical lines.
c. Place explanation in footnotes (sequence: *, †, ‡, §, ¶, **, ††).
8.Figures
a. Figures can be submitted either by e-mail or as photographs (5 ×7ʺ glossy).
b. Place caption for a figure on a separate page (e.g. Fig. 1 Results of…), ending
with a period. If figure is submitted as a glossy, place first author’s name and
figure number on back of each glossy submitted.
c. When plotting points on a figure, use the following symbols if possible:
l l s s n n.
9. Author information
a. List first name, middle initial, last name, highest degree, position held,
institution and department, and complete address (including ZIP code) for all
authors. List country when applicable. Provide e-mail addresses of all authors.
III. EDUCATIONAL FORUM
A. All submitted manuscripts should be approximately 2000 to 2500 words with
pertinent references. Submissions may include:
1. An immunohematologic case that illustrates a sound investigative approach with
clinical correlation, reflecting appropriate collaboration to sharpen problem solving
skills
2. Annotated conference proceedings
B. Preparation of manuscript
1. Title page
a. Capitalize first word of title.
b. Initials and last name of each author (no degrees; all CAPs)
2.Text
a. Case should be written as progressive disclosure and may include the
following headings, as appropriate
i. Clinical Case Presentation: Clinical information and differential diagnosis
ii. Immunohematologic Evaluation and Results: Serology and molecular
testing
iii. Interpretation: Include interpretation of laboratory results, correlating
with clinical findings
iv. Recommended Therapy: Include both transfusion and nontransfusionbased therapies
v. Discussion: Brief review of literature with unique features of this case
vi. Reference: Limited to those directly pertinent
vii. Author information (see II.B.9.)
viii. Tables (see II.B.7.)
IV. LETTER TO THE EDITOR
A.Preparation
1. Heading (To the Editor)
2. Title (first word capitalized)
3. Text (written in letter [paragraph] format)
4. Author(s) (type flush right; for first author: name, degree, institution, address
[including city, state, Zip code and country]; for other authors: name, degree,
institution, city and state)
5. References (limited to ten)
6. Table or figure (limited to one)
Send all manuscripts by e-mail to [email protected]
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
Immunohematology
Instructions for Authors | New Blood Group Allele Reports
A. For describing an allele which has not been described in a peer-reviewed publication and for which an allele name or provisional allele name has been assigned by the
ISBT Working Party on Blood Group Allele Terminology (http://www.isbtweb.org/working-parties/red-cell-immunogenetics-and-blood-group-terminology/blood-groupterminology/blood-group-allele-terminology/)
B.Preparation
1. Title: Allele Name (Allele Detail)
ex. RHCE*01.01 (RHCE*ce48C)
2. Author Names (initials and last name of each (no degrees, ALL CAPS)
C.Text
1. Case Report
i. Clinical and immunohematologic data
ii. Race/ethnicity and country of origin of proband, if known
2. Materials and Methods
Description of appropriate controls, procedures, methods, equipment, reagents, etc. Equipment and reagents should be identified in parentheses by model or lot and
manufacturer’s name, city, and state. Do not use patient names or hospital numbers.
3.Results
Complete the Table Below:
Phenotype
Allele Name
Nucleotide(s)
Exon(s)
Amino Acid(s)
Allele Detail
References
e weak
RHCE*01.01
48G>C
1
Trp16Cys
RHCE*ce48C
1
Column 1: Describe the immunohematologic phenotype (ex. weak or negative for an antigen).
Column 2: List the allele name or provisional allele name.
Column 3: List the nucleotide number and the change, using the reference sequence (see ISBT Blood Group Allele Terminology Pages for reference sequence ID).
Column 4: List the exons where changes in nucleotide sequence were detected.
Column 5: List the amino acids that are predicted to be changed, using the three-letter amino acid code.
Column 6: List the non-consensus nucleotides after the gene name and asterisk.
Column 7: If this allele was described in a meeting abstract, please assign a reference number and list in the Reference section.
4. Additional Information
i. Indicate whether the variant is listed in the dbSNP database (http://www.ncbi.nlm.nih.gov/snp/); if so, provide rs number and any population frequency information, if available.
ii. Indicate whether the authors performed any population screening and if so, what the allele and genotype frequencies were.
iii. Indicate whether the authors developed a genotyping assay to screen for this variant and if so, describe in detail here.
iv. Indicate whether this variant was found associated with other variants already reported (ex. RHCE*ce48C,1025T is often linked to RHD*DIVa-2)
D.Acknowledgments
E.References
F. Author Information
List first name, middle initial, last name, highest degree, position held, institution and department, and complete address (including ZIP code) for all authors. List country when
applicable.
I M M U N O H E M ATO LO GY, Vo l u m e 2 9, N u m b e r 1, 2 013
43
NON PROFIT
U.S. POSTAGE
PAID
Musser Blood Center
700 Spring Garden Street
Philadelphia, PA 19123-3594
AMERICAN
RED CROSS
(Place Label Here)