Download Identification of the gene responsible for the cblB

# 2002 Oxford University Press
Human Molecular Genetics, 2002, Vol. 11, No. 26
3361–3369
Identification of the gene responsible for the cblB
complementation group of vitamin B12-dependent
methylmalonic aciduria
C. Melissa Dobson1, Timothy Wai2, Daniel Leclerc4, Hakan Kadir1, Monica Narang1, Jordan
P. Lerner-Ellis2, Thomas J. Hudson2,3,5, David S. Rosenblatt2,3,4 and Roy A. Gravel1,*
1
Department of Biochemistry and Molecular Biology, University of Calgary, Canada, 2Department of Human
Genetics and 3Department of Medicine, McGill University, Montreal, Canada, 4McGill University Health Center,
McGill University, Montreal, Canada and 5Montreal Genome Center, Montreal, Canada
Received September 27, 2002; Revised and Accepted October 25, 2002
DDBJ/EMBL/GenBank accession no. AF550396–AF550404
The methylmalonic acidurias are metabolic disorders resulting from deficient methylmalonyl-CoA mutase
activity, a vitamin B12-dependent enzyme. We have cloned the gene for the cblB complementation group
caused by deficient activity of a cob(I)alamin adenosyltransferase. This was accomplished by searching
bacterial genomes for genes in close proximity to the methylmalonyl-CoA mutase gene that might encode a
protein with the properties of an adenosyltransferase. A candidate was identified in the Archaeoglobus
fulgidus genome and was used to probe the human genome database. It yielded a gene on chromosome
12q24 that encodes a predicted protein of 250 amino acids with 45% similarity to PduO in Salmonella
enterica, a characterized cob(I)alamin adenosyltransferase. A northern blot revealed an RNA species of 1.1 kb
predominating in liver and skeletal muscle. The gene was evaluated for deleterious mutations in cblB patient
cell lines. Several mutations were identified including a 5 bp deletion (5del572gggcc576), two splice site
mutations (IVS2–1G>T, IVS3–1G>A), andt several point mutations (A135T, R186W, R191W and E193K). Two
additional amino acid substitutions (R19Q and M239K) were found in several patient cell lines but were found
to be common polymorphisms (36% and 46%) in control alleles. The R186W mutation, which we suggest is
disease-linked, is present in four of the six patient cell lines examined (homoallelic in two) and in 4 of 240
alleles in control samples. These data confirm that the identified gene, MMAB, corresponds to the cblB
complementation group and has the appearance of a cob(I)alamin adenosyltransferase, as predicted from
biochemical data.
INTRODUCTION
In mammals, vitamin B12 (cobalamin, Cbl) functions as a
coenzyme for the enzymes methionine synthase and methylmalonyl CoA mutase (MCM). Methylcobalamin (MeCbl) is the
coenzyme for methionine synthase and functions in methyl
transfer to homocysteine to form methionine. Adenosylcobalamin (AdoCbl) is the coenzyme for MCM and
participates in the rearrangement reaction that converts
methylmalonyl CoA to succinyl CoA. In microbes there are
numerous AdoCbl-dependent adenosyltransferases and they
participate in a variety of intramolecular rearrangements.
In all organisms, whether they synthesize vitamin B12de novo
or acquire it externally, the Cbl must be converted from a
Co(III) oxidation state to Co(I) prior to addition of the
functional ligand. In humans, these reactions are becoming
known through genetic disorders in patients who have blocks in
subcellular processing or enzymatic reactions leading to the
active coenzymes. Eight complementation groups have been
identified among patients with blocks in the cellular metabolism of vitamin B12 (1). Three of these, cblA, cblB and cblH,
are blocked uniquely in the synthesis of AdoCbl. All are
expected to involve mitochondrial functions, since this is the
subcellular location of methylmalonyl-CoA mutase. To date,
genes for three of the eight complementation groups have been
identified. The gene responsible for the cblA complementation
group, MMAA, encodes a protein of unidentified function that
may be involved in vitamin B12 transport into mitochondria (2).
Two other identified genes are involved in the functional
expression of methionine synthase (3). These are the MTR
gene, encoding methionine synthase and defined by the cblG
complementation group (4–6), and MTRR, encoding the
*To whom correspondence should be addressed at: Department of Biochemistry and Molecular Biology, Room 250, Heritage Medical Research
Building, 3330 Hospital Drive NW, Calgary, AB, Canada T2N 4N1. Tel: 403 2202268; Fax: 403 2108115; Email: [email protected]
3362
Human Molecular Genetics, 2002, Vol. 11, No. 26
reactivating enzyme, methionine synthase reductase, and
defined by the cblE complementation group (7). The remaining
groups, cblC, cblD and cblF, affect both MeCbl and AdoCbl
synthesis, likely involving lysosomal efflux of Cbl into the
cytosol (cblF) and initial steps in the reduction of Cbl (cblC and
cblD) (1) (Fig. 1).
This study concerns the identification of the gene responsible
for the cblB complementation group (8). Patients comprising
this group have methylmalonic aciduria and metabolic
ketoacidosis, despite a functional methylmalonyl-CoA mutase
(1). In severe cases, they may present in the newborn period
with lethargy, vomiting and failure to thrive. They have normal
methionine synthesis and normal levels of MeCbl. Studies on
cell extracts from fibroblast cultures from cblB patients
suggested that they were blocked in the mitochondrial synthesis
of AdoCbl, either in the reduction of Cbl or in a cob(I)alamin
adenosyltransferase (9,10). Subsequently, Fenton and
Rosenberg (11) confirmed a deficiency of cob(I)alamin
adenosyltransferase activity.
While the evidence has pointed to cob(I)alamin adenosyltransferase as the enzyme responsible for the cblB defect, there
has been little success in characterizing the protein further and
the gene has remained unidentified. Microbes, in contrast,
utilize vitamin B12 in numerous reactions and distinct corrinoid
adenosyltransferases have been identified and shown to
participate in several metabolic pathways. Some bacteria and
archea are able to synthesize vitamin B12 (12–16), which can
proceed by anaerobic or aerobic pathways requiring over 25
enzymes (for review see 17). Others, including E. coli, do not
synthesize vitamin B12 but do utilize it metabolically. Cbl is a
cofactor in a wide variety of reactions, including acetyl-CoA
synthesis, methyl transfer for methane production, ribonucleotide reductase and in the fermentation-dependent utilization of
a variety of molecules, including ethanolamine, glutamate,
glycerol and 1,2-propanediol (17). Methane production and
acetyl-CoA synthesis require MeCbl, while ribonucleotide
reductase and fermentation enzymes require the AdoCbl form.
To produce AdoCbl for a range of metabolic pathways under
different regulatory regimens, bacterial genomes have evolved
several genes encoding distinct corrinoid adenosyltransferases
specific to different enzyme systems (17). Interestingly, the
different groups of adenosyltransferases can be structurally
distinct. Based on amino acid sequence similarity, the
adenosyltransferases required for the synthesis of AdoCbl can
be divided into three main families: CobA-type, EutT-type and
PduO-type. CobA, an ATP:corrinoid adenosyltransferase,
participates in Cbl biosynthesis by the adenosylation of an
intermediate prior to Cbl, but it also acts as a cob(I)alamin
adenosyltransferase with the ability to form AdoCbl directly. It
can generate AdoCbl required by AdoCbl-dependent enzymes,
such as 1,2-propanediol dehydratase, as effectively as authentic
AdoCbl (18). CobA is encoded by the cobA gene in Salmonella
enterica, cobO in Paracoccus denitrificans and btuR in
Salmonella typhimurium. The three-dimensional structure of
CobA has been solved and revealed a unique nucleotide
binding orientation to the P-loop of CobA by comparison with
all other nucleotide hydrolases (19). The unusual orientation of
the nucleotide arises because this enzyme transfers the
adenosyl group rather than the gamma-phosphate to its
acceptor.
However, the two other cob(I)alamin adenosyltransferase
families do not contain a recognizable P loop-nucleotide
binding motif. Their mechanism of ATP binding and adenosyl
release is unknown. One of the adenosyltransferases, EutT,
belongs to an operon of Salmonella typhimurium encoding
proteins involved in the Cbl-dependent degradation of
ethanolamine (20). The other is PduO, an ATP:cob(I)alamin
adenosyltransferase in Salmonella enterica that is integral to
growth on 1,2-propanediol (21). Interestingly, PduO was
proposed to be a bifunctional protein, acting as an adenosyltransferase as well as a reductase that might convert
cob(II)alamin to cob(I)alamin (21).
We set out to identify the cob(I)alamin adenosyltransferase
defective in the cblB complementation group by conducting
homology searches using bacterial adenosyltransferases as
query sequences. The identification of the cblB gene came from
making use of bacterial gene clusters to identify the relevant
bacterial template. It was detected as one of the potential genes
in operons containing bacterial orthologs to the human MCM
gene and to the recently identified human MMAA gene. Several
mutations confirming the authenticity of the gene identification
were found. We propose the gene name, MMAB, to denote
‘methylmalonic aciduria (cobalamin deficiency) type B.’
RESULTS
Our initial efforts to identify genes that might represent a
human cobalamin adenosyltransferase focused on known
bacterial ATP:cob(I)alamin adenosyltransferases. Previous
reports on different Cbl-dependent metabolic pathways allowed
the search to be narrowed to specific families of proteins,
including CobA, EutT and PduO. To further narrow the search
for candidates, we made use of the Clusters of Orthologous
Groups of proteins (COG) database at NCBI (htttp://
www.ncbi.nlm.nih.gov/COG) to search for genes in microbial
organisms that were arranged in clusters with genes encoding
Cbl-dependent enzymes. A search for methylmalonyl-CoA
mutase yielded COG2185, corresponding to the Cbl-binding,
carboxyl-terminal domain/subunit of MCM. Adjacent to it is
COG1703, which proved to be the ortholog of the gene
responsible for the cblA complementation group (MMAA) (2).
Flanking COG1703 is COG2096 in Archaeoglobus fulgidus.
This COG, an open reading frame, is described as an
‘uncharacterized acr’ (ancient conserved region), but it has
sequence similarity to PduO, an ATP:cob(I)alamin adenosyltransferase from Salmonella enterica (21). Several other
genomes, not identified in the COG database, were also found
to contain these three genes in cluster form, including
Sulfolobus solfataricus, Pyrococcus horikoshii, Pyrococcus
abyssi, Thermoplasma volcanium and Thermoplasma
acidophilum.
Identification of the MMAB cDNA
The Archaeoglobus fulgidus sequence (gi:11498888) was used
as the template for a BLASTP search of the NCBI
nonredundant database (www.ncbi.nlm.nih.gov/blast). It
resulted in a 37% similarity (22% identity) with the N-terminal
half of Salmonella enterica PduO (gi:5069458) and 43%
similarity (28% identity) to the full-length of an unknown
Human Molecular Genetics, 2002, Vol. 11, No. 26
3363
Figure 1. Intracellular processing of Cbl. Steps are identified according to complementation group names. Their gene (upper case italics) and predicted functions
are: cblA (MMAA), unknown function, proposed to be an accessory to mitochondrial import of B12; cblB, cob(I)alamin adenosyltransferase (this study, MMAB);
cblC/D, possibly cob(III)alamin reductase; cblE (MTRR), methionine synthase reductase; cblF, lysosomal Cbl efflux; cblG (MTR), methionine synthase; cblH,
possibly a component of cobalamin transport or cob(II)alamin reductase.
protein in humans (gi:15080110). This protein was constructed
from a predicted mRNA and supported by the assembly of
expressed sequence tags (ESTs) found in the dbEST
(www.ncbi.nlm.nih.gov) (22). A Unigene cluster (Hs.12106)
containing 119 ESTs constitutes the candidate MMAB cDNA.
Based on the assembly of these ESTs, the mRNA size was
found to vary at the 30 end, with two sizes of 1128 (BC005054)
and 2361 nucleotides (BC011831) in length, due to the evident
use of alternate polyadenylation sites. Both transcripts would
result in an open reading frame of 250 codons with the same
start and stop codons and differing only in the location of
the polyadenylate track. Based on the ESTs examined in the
database, there was no evidence of variant sequence that would
be generated from alternate splicing (Fig. 2). The coding region
from the cDNA sequence was verified experimentally by
sequencing a 1075 bp RT–PCR product (description of primers
in Table 1) from the transformed human liver cell line Huh-7. It
contains an open reading frame 750 bp in length and predicts a
polypeptide of 250 amino acids with a calculated molecular
mass of 27.3 kDa (Fig. 3).
Orthologous proteins
Sequences corresponding to the candidate MMAB cDNA
were also identified in the mouse and C. elegans database as
complete predicted cDNAs. This allowed us to verify the
reading frame throughout and to enssure that the sequence
is full-length. Further work was done to verify the ESTs
including reconstructing the appropriate length mRNA. The
mouse Unigene cluster Mm.19757 contains 8 ESTs. These
were assembled into a composite cDNA sequence, which
verified the corresponding GenBank entry (gi:18381148).
The mouse cDNA is 86% identical to the human cDNA. The
corresponding proteins are 88% identical, with similarity based
on conserved amino acid properties of 91%. The human,
mouse, C. elegans, Archaeoglobusfulgidus, and Salmonella
enterica sequences were aligned with the proposed human
coding sequence (Fig. 3).
Structure of the MMAB gene and chromosomal location
The MMAB gene was localized to chromosome 12q24 (Fig. 2)
based on the linkage of contig NT_009770 to markers
DS12S172, DS12S234, RH45414 and the mapping of
sequence tagged sites (STS), including WI-14208, A005L23
and STSG2679. To define the structure of the human gene,
the predicted cDNA sequences (longer and shorter versions)
were compared to the whole human genome using BLASTN.
Nine hits were obtained with 100% continuous alignment in
each segment, indicating that the gene contains nine exons
(Fig. 2). Exon 9 ends at two alternative polyadenylation sites,
one at nucleotide 1080 in the mRNA sequence and the second
at nucleotide 2307. The first one shows a consensus
polyadenylation signal, AATAAA, 20 bp upstream of the
polyadenylation site. Interestingly, there is a TG dinucleotide
repeat (23 repeats) beginning 9 bp beyond the first polyadenylation site. In total, the human MMAB gene was found to
encompass 18.87 kb and is oriented towards the telomere.
The coding sequence is flanked by a mevalonate kinase gene on
the 50 side (55 kb away) and Loc160753 encoding a protein
similar to fatty aldehyde dehydrogenase (35 kb away) followed
by an ubiquitin protein ligase (57 kb away) on the 30 side.
Comparison of the human and mouse genes show preservation of all nine exon–intron splice junctions. The mouse and
human chromosomes show a large amount of synteny around
the MMAB gene including the genes for mevalonate kinase,
fatty aldehyde dehydrogenase and ubiquitin protein ligase. This
is in agreement with the human–mouse homology map (http://
www.ncbi.nlm.nih.gov/) that links human 12q24 with chromosome 5 of mouse.
Expression in tissues
A 338 bp probe, amplified from positions 276–613 bp of the
full-length cDNA, hybridized to an RNA species of 1.1 kb on
the human tissue northern blot, with highest levels of
expression in liver and skeletal muscle (Fig. 4). The length of
RNA is consistent with the predicted length of the shortest
composite EST assembly of 1.1 kb. The longer version was not
observed, but this may be in keeping with the presence of a
3364
Human Molecular Genetics, 2002, Vol. 11, No. 26
Figure 2. Structural organization of the human MMAB gene. ‘Genes’ show the flanking genes and map positions surrounding MMAB according to mapviewer at
NCBI (http://www.ncbi.nlm.nih.gov) on chromosome 12q24.1 to 12q24.2. The ‘Exons’ line identifies the location of exons (numbered boxes) and introns (lines)
along the MMAB gene located in Contig NT_009770.12. Our independently confirmed sequences from genomic DNA were deposited in GenBank under the
accession numbers AF550396–AF550404. Introns are drawn to scale. The cDNA (‘cDNA’) is illustrated, showing the splice sites and start/stop codons. The
hatched section is the longer predicted sequence based on EST assembly. The cDNA is illustrated, with splice and start/stop codons indicated, showing that it
was constructed from numerous ESTs belonging to Unigene cluster Hs.12106 (119 ESTs) and verified by RT–PCR sequencing. Only some ESTs are illustrated
here. From top to bottom are BG754143, BI192839, BE250480, AA703387, BM462123, AI691079, A702361, AA340851, BE391487 and AV701242 . The
dotted ESTs are the longer cDNA predicted based on assembly of the ESTs contained within Unigene cluster Hs.12106.
Table 1. Primers used to amplify the exons and flanking introns of the cblB gene and the splice junctions
Exon
Primer
Sequencea
Primer
Sequence
1
2
3
4
5
6
7
8
9
1F
2F
3F
4F
5F
6F
7F
8F
9F
accaataaaaattgaaacctgagcg
agatgaccatctaagcagtaagg
gcctggatgacagagtgactgtt
gactggaaataatgagcatccga
cacctccaactctggggatcaca
cacgggtgggtcagttagccttgct
atccctcttttcacagtgacaga
ctcaccagccatccttgatccct
cattaagtgcaagatggctgggc
1R
2R
3R
4R
5R
6R
7R
8R
9R
aacagcgtggagacgtcacctgac
cgcgcctggtatattatacttta
ataagggctgacaacctccgagg
taactggtggctggatgctgagt
tgggatcccagatggtgacccta
ttggggaactggaggacagcgtct
gtctgttgatgtgtggctggatg
acactaagggaatgaaggagggg
tccttctcattgcagcaatcact
RNA
RNAF
gcacgagggtcaagcagcctg
RNAR
gcacagctccttctcattgcag
PCR
size
365
304
338
357
339
386
483
430
561
exon
size
>153
62
94
58
73
98
65
60
436 to
polyA
50 spliceb
tagGCCA . . .
cagGGTT . . .
tagGTTT . . .
cagATCC . . .
cagAGTA . . .
cagGCAA . . .
tagTGTG . . .
cagACTC . . .
30 splice
Exon
boundaries
. . .ACAGgtg
. . .AAAGgta
. . .TTGGgta
. . .GAAAgtg
. . .TTAAgta
. . .GTAGgta
. . .GACGgta
. . .ACAGgta
>–18–134
135–196
197–290
291–348
349–421
422–519
520–584
585–644
645–1080
1080
a
The primer sequences are listed 50 to 30 .
The upper case letters designate exon sequence and the lower case letters designate the intron sequences.
b
very small proportion of 30 ESTs containing the longer
sequence. The presence of an efficient polyadenylation signal
at the first polyadenylation site (not shown), but not at the
second, may be the explanation for it not being detected.
Mutations in the cblB complementation group
Fibroblast lines from patients from the cblB complementation
group were analysed for mutations by PCR-heteroduplex
analysis to detect multibase changes and by DNA sequencing
of PCR-amplified exons and flanking sequences to detect point
mutations. In each case, a PCR-dependent diagnostic test was
developed using restriction enzyme digestion to distinguish
normal and mutant sequences. The primers used for sequencing
are listed in Table 1. The diagnostics used to verify the
mutation and test the normal population are listed in Table 2. If
the mutation did not result in the loss or addition of a restriction
site, one was created with modified primers. Otherwise the
same primers were used as with sequencing. Mutant cell lines
and their mutations are listed in Table 3.
Human Molecular Genetics, 2002, Vol. 11, No. 26
3365
Figure 3. Alignment of amino acid sequences similar to that of human (Hsa) MMAB, including mouse (Mmu) (gi:12860826), Caenorhabditis elegans (Cel)
(gi:532812), Archaeoglobus fulgidus (Aful) (gi:2649297) and Salmonella enterica (Sent) (gi: 5069458). The arrow denotes the predicted mitochondrial leader
sequence cleavage site. Amino acids that are similar in all species are shaded with progressively increasing grey background. Of note is the highly conserved region
(underlined). The letters (amino acid designations) above the human (Has) sequence correpond to amino acid mutations in patient cell lines; R19Q and M239K are
polymorphisms.
Table 2. Mutation detection including diagnostic tests and expected banding patterns
Mutation
Diagnostic
enzyme
Forward
primer useda
Reverse
primer
Normal
fragments (bp)b
Mutant
fragments (bp)b
556C>T (R186W)
MspIa
98, 22
HindIII
130
107, 23
56–57GC>AA (R19Q)
716 T>A (M238K)
403 G>A (A135T)
571C>T (R191W)
IVS2–1G>T
575G>A (E193K)
HhaI
NlaIII
TaqI
MspI
NlaIII
HaeI
7Rshort:
ctccagccctcttaccgtct
IVS3R:
tctgtgactaattccagagcaag
1R
9R
5R
7R
3R
7E193KR:
gtctgttgatgtgtggctggatg
83, 15, 22
IVS3–1 G>A
7Fshort:
cacacctttcccaccctgct
IVS3F:
gctaaattaactaaatggcctgcc
1F
9F
5F
7F
3F
7E193KF:
tttctgccgggccgtgtgccgcctgg
186,
202,
339
190,
304,
213
134, 31, 14
122, 73, 29
132, 63, 44, 39, 15
34
186,
202,
217,
205,
103,
186,
148,
122,
122
132,
201,
27
31
102
63, 44, 39, 15
34
a
The primer sequences are listed 50 to 30 when given or refer to the primers used in Table 1.
The bold segments are the ones observed on Figure 7.
b
Heteroduplex analysis revealed a single multibase deletion in
cell line WG2633 in a PCR of exon 7 and flanking sequences.
DNA sequencing revealed a 5 bp deletion, 572–
576delGGGCC, which disrupts the reading frame after R190
(Fig. 5A). The heteroduplex test was used as the diagnostic. It
was not observed in any other mutant line. The second
mutation in WG2633 is a point mutation, 556C>T, which
generates an amino acid substitution, R186W. This mutation
3366
Human Molecular Genetics, 2002, Vol. 11, No. 26
IVS2 –1G > T. It was validated in a PCR test using restriction
enzyme NlaIII (Fig. 5H). The second mutation is 575G>A
(E193K). This mutation was detected by PCR using an artificial
restriction site, MscI (Fig. 5I). The mutation was not observed
in any other mutant line or in 48 control alleles.
DISCUSSION
Figure 4. Northern blot analysis of MMAB mRNA. A northern blot of poly(A)þ
RNA from the indicated human tissues. The membrane was hybridized with a
[32P]-labeled 338 bp probe from MMAB mRNA (A) or a b-actin probe (B). A
molecular size marker positions is indicated on the right.
was identified in four of six cell lines (six of 12 alleles) during
the DNA sequencing survey (Fig. 5B). WG1185 and WG2186
are both homoallelic for this mutation, while WG2027 and
WG2633 are heteroallelic. One hundred and twenty non-cblB
cell lines were tested for 556C>T and four were found to
contain this genetic variation in heterozygous fashion. This
gave an allele frequency of 1/60. It remains uncertain as a
disease-causing mutation.
The second mutation in WG2027 is at the acceptor splice site
of intron 3, IVS3–1G>A, which would be expected to disrupt
splicing. The mutation was confirmed by testing for the
generation of an artificially created HindIII site in a 130 bp
PCR product (Fig. 5C). The mutation was not observed in any
other mutant line or in 194 control alleles.
WG2492 and WG2523 were found to contain a 2 bp
substitution, 56–57GC>AA (R19Q). However, this change is
also observed in 6 of 27 ESTs included in Hs.12106. A
diagnostic test was generated which tests for the mutation by
digestion with HhaI (Fig. 5D). Based on the examination of 97
normal cell lines, 36% of the alleles contained the mutation.
Figure 5D illustrates two normal cell lines, one homozygous for
GC (lane 1) and one homozygous for AA (lane 4). As a result, we
surmise that R19Q is a frequent polymorphism that is unlikely to
be contributing to disease. Another amino acid substitution,
716T>A (M239K) was also observed in WG2523 (Fig. 5E). This
is also recorded as a polymorphism in the dbSNP as rs9593
(www.ncbi.nlm.nih.gov/SNP) with heterozygosity reported at
48% by Ensembl (www.ensembl.org). In keeping with this, we
found a frequency of 46% in 72 normal alleles tested.
As expected, two additional mutations were identified in
WG2492. Both are point mutations, 403 G>A (A135T) and
571C>T (R191W). The A135T mutation results in the creation
of a TaqI site (Fig. 5F). The R191W mutation can be observed
in conjunction with digestion with MspI (Fig. 5G). These
mutations were not observed in any other patient cell line or in
72 alleles tested in control samples.
Along with R19Q and M239K, WG2523 also contains
two additional point mutations. One is a splice mutation,
We have combined the analysis of prokaryotic gene arrangements and specific protein function reported in bacteria
to identify the disease-causing gene in patients from the cblB
complementation group. The key finding confirming
the identity of the MMAB gene was the detection of null-type
mutations, including a 5 bp deletion frameshift and two splice
junction mutations (Table 3). In addition, the deduced MMAB
protein aligns with PduO from Salmonella enterica (Fig. 4), as
enzyme that is biochemically confirmed as a cob(I)alamin
adenosyltransferase (21).
Early studies pointed to a mitochondrial defect in the human
disorder since the block in AdoCbl synthesis was localized to
mitochondria (11). As anticipated, MMAB has a predicted
leader sequence and signal cleavage site (P ¼ 0.9755, http://
www.mips.biochem.mpg.de/cgi-bin/proj/medgen/mitofilter) at
residue 33 (Fig. 4). Examination of amino acid sequence
patterns in the MMAB protein did not reveal any known
functional domains. Instead, the sequence was found to contain
the DUF80 domain (domain of unknown function) defined by
pfam01923 (http://pfam.wustl.edu). Significantly, this pfam
domain can also be found in the EutT adenosyltransferase in
addition to PduO; yet, none of these proteins contains a P loop
as described for CobA. We anticipate that this conserved
domain will be important for Cbl binding or the adenosylation
function. This sequence is conserved in a variety of MMAB
orthologs (including those listed in Fig. 3) and the DUF80
consensus sequence in this region is R-[AT]-[LIVQ]-x-R-R[ALS]-E-R. Interestingly, a large number of mutations
(R186W, R191W and E193K) focus on this sequence in the
human protein, which reads 186RAVCRRAERR195.
In PduO from Salmonella, the protein was proposed to have
two functions, the adenosyltransferase and a Co(II) to Co(I)
reductase (21). As well, these functions were proposed to be
localized to the N- and C-terminal halves of the protein,
respectively. The human ortholog aligns only with the Nterminal half of PduO, suggesting that it does not contain a
function corresponding to its C-terminal half. In this regard,
previous studies showed that cblB cells have a functional
cob(II)alamin reductase (23). This suggests that another protein
may have evolved in humans to account for the cob(II)alamin
reductase function.
The presence of mutations in the patients belonging to the
cblB complementation group verifies this hypothesis. Several
confirmatory mutations were identified, including one deletion
of 5 bp (del572–576gggcc) and two splice mutations, IVS2–1
G>T and IVS3–1G>A, at obligatory 1 positions. In addition,
four missense mutations, A135T, R186W, R191W and E193K,
were found among the six cblB cell lines examined. Based on
our analysis, we conclude that the sequence variant R186W is a
rare polymorphism (4 out of 240 alleles) in the general
population. However, the significantly increased frequency of
Human Molecular Genetics, 2002, Vol. 11, No. 26
3367
Figure 5. PCR-based diagnostic assay. (A) Heteroduplex test for 572–576delgggcc: lane 1, normal cells; lane 2, WG2633 (deletion on one allele). (B) Test for
R186W: lane 1, normal; lane 2, WG2523; lane 3, WG2186, all following digestion with MspI using 7Fshort and 7Rshort primers. (C) Test for IVS3–1 G>A: lane
1, normal undigested; lane 2: normal; lane 3: WG2186, all digestions with HindIII using IVS3F and IVS3R primers. (D) Test for R19Q: lane 1, normal; lane 2,
WG2492; lane 3, WG2523; lane 4, normal #2; lane 5, normal #3, all following digestion with HlaI. (E) Test for M239K: lane 1, normal undigested; lane 2: normal;
lane 3, WG2523; lane 4, normal, all digestions completed with NlaIII. (F) Test for A135T: lane 1, normal undigested; lane 2, normal; lane 3, WG2186; lane 4,
WG2492, all digestions performed using Taq1. (G) Test for R191W: lane 1, normal undigested; lane 2, normal; lane 3, WG2492 all digestion performed with MspI.
(H) Test for IVS2–1G>T: lane 1, normal undigested; lane 2, normal; lane 3, WG2523, all digestions performed with NlaIII. (I) Test for E193K: lane 1, normal
undigested; lane 2, normal; lane 3, WG2523, all digestion performed with MscI using E193KF and E193KR specific primers. Asterisks denote diagnostic bands.
Note throughout, small fragments not included in gel patterns (ran off the gel).
Table 3. Summary of mutations listed
Cell lines
Mutation 1
Mutation 2
Propionate uptakea Basal/ þ B12
AdoCbl levelb
Ethnic origin
Age at onset
WG1185
WG2027
WG2186
WG2492
WG2523
WG2633
R186W
IVS3–1G>A
R186W
A135T
IVS2–1G>T
572-576delgggcc
R186W
R186W
R186W
R191W
E193K
R186W
—
0.89/0.91
0.99/1.1
2.0/3.6
0.22/0.45
0.47/0.50
4.29%
13.1%
2.5%
6.5%
1.8%
0.8%
—
Caucasian
—
Black
Saudi
Caucasian
—
3 days
<7 days
3 years
<1 years
7days
a
C-propionate uptake into fibroblasts: Controls: Basal (no added vitamin B12 to culture medium) ¼ 10.8 3.2 nmol/mg protein/18 h þ B12 (vitamin B12 added to
medium) ¼ 10.9 3.5 nmol/mg protein/18 h (24).
b
As percent of total Cbl (control values, 15.29 4.2%) (25).
this variant in cblB patient cell lines (6 out of 12 alleles)
remains intriguing since there is no evidence of consanguinity
in the two individuals who are homozygous for the mutation. It
will be important to study the prevalence of the R186W
mutation on a larger scale to determine if unaffected
homozygotes are identified and to determine if harmful
catabolic products are elevated in such individuals. Analysis
of the protein with this site mutated will also be required to
shed light on the importance of this amino acid residue.
Significantly, the other nearby mutations (R191W, E193K),
which are clustered in this highly conserved region, adds
weight to the importance of this area to enzyme function. This
heterogeneity of mutations and their clustering in a very tight
region may address the relationship between genotype and the
response to high levels of OH-Cbl. This relationship is not clear
from our initial studies and it is evident that expression
experiments will be required to assess the impact of the
different mutations. For example, WG2633, with the 5 bp
deletion in exon 7 and R186W, had a decreased AdoCbl level
(0.8%) compared with a normal value of 15% of total Cbl. In
contrast, WG2027, which has a splice mutation and R186W,
had 13% AdoCbl (comparable to normal limits) but the patient
was sick within three days of birth. Interestingly, these data
bracket the values for WG1185 and WG2186, which are
3368
Human Molecular Genetics, 2002, Vol. 11, No. 26
homozygous for R186W. They had levels of 4.28% and 2.5%
AdoCbl.
In summary, we conclude that the MMAB gene encodes the
ATP:cob(I)alamin adenosyltransferase as predicted by mutation
studies and sequence similarity to PduO (gi: 5069458).
Sequences in prokaryotes such as Archaeoglobus fulgidus,
which contain orthologs of MCM, MMAA and MMAB in
contiguous arrangement, add compelling weight to this
enzyme playing a valuable role in the MCM pathway and
demonstrate the enormous power of prokaryotic gene arrangements for the identification of human genes.
MATERIALS AND METHODS
Patient cell lines
Fibroblast lines from six patients classified as members of the
cblB complementation group were used in this study: WG1185,
WG2027, WG2186, WG2492, WG2523 and WG2633. Some
of the cell lines were characterized by 14C-propionate uptake
(24) and AdoCbl content as percent of total Cbl following
incubation of cells for 96 h in medium containing [57Co]
OH-Cbl (25). Values for cell lines and controls are given in
Table 3. The table also shows ethnic origins and age of onset of
disease where known. WG1185 has been reported previously
(11). WG2186 presented with respiratory distress and metabolic acidosis, hypocalcemia, thrombocytopenia, neuropenia
and moderate hyperammonenia. WG2523 is of Saudi descent
whose parents are said to be second cousins (note, distinct
alleles were identified in this patient).
Materials
Oligonucleotide primers were synthesized by Qiagen
(Mississauga, Ontario). Taq polymerase and Trizol were
purchased from Invitrogen (Burlington, Ontario). Restriction
enzymes were purchased from New England Biolabs
(Mississauga, Ontario) and Invitrogen. Genomic-tip columns,
QIAquick DNA purification kit and Ominiscript amplification
kit were purchased from Qiagen (Mississauga, Ontario). PGEM
cloning vector was purchased from Promega (Madison, WI).
Big Dye terminator version 2 and 3 were purchased from
Applied Biosystems and were cycle-sequencing products were
characterized on ABI 3700 and 3100 Genetic Analyzers (Foster
City, CA). The multiple tissue RNA blot was purchased from
Clontech (Palo Alto, CA).
QIAquick PCR purification kit and cloned into pGEM
according to the supplier’s instructions.
Heteroduplex analysis, DNA sequencing and restriction
analysis
Initial examination of PCR products was performed by
heteroduplex analysis, as described previously (7).
Heteroduplexes were obtained by mixing, melting and
reannealing equivalent concentrations of PCR products of
mutant and control DNA prior to electrophoresis. Positive cell
lines also underwent the same procedure without mixing with
control to determine if the mutation was on one or both
alleles. The observation of a heteroduplex, with implication of
a multibase mutation, was taken as indication that the correct
gene was identified. DNA sequencing was accomplished in
96-well plates in 10 ml reactions made up of 2 ml of purified
PCR product, 1 ml of BigDye Terminator Cycle Sequencing
version 2.0 and 3.0 and analysed with an ABI 3700 and 3100
system.
Confirmation of mutations
Restriction analysis was used to verify the mutations in
genomic DNA by PCR-dependent amplification and restriction
analysis. The primers used were the same as for the PCR
amplification (Table 1) where the mutations resulted in the
creation or loss of a particular restriction site. If the mutation
did not result in a change, one was created through the use of
an oligonucleotide that generated a restriction site by altering
one of the 30 nucleotides (Table 2). This altered oligonucleotide
along with a primer binding to the reverse strand was used to
PCR amplify a fragment of genomic DNA. Digestions
were carried out using 10–15 mL of the PCR product with
the appropriate restriction enzyme and buffers for 2 h at the
approved temperature before undergoing electrophoresis using
8% acrylamide.
Northern blot
A multiple human tissue northern blot was used for
determining the level and size of mRNA species. A probe
was generated from a 338 bp cDNA segment amplifying
regions 276–613 bp of the full-length cDNA, using the Huh-1
cell line as the source of RNA. Detection of b-actin mRNA was
used as control. All procedures followed the protocol supplied
by Clontech.
DNA or RNA extraction and PCR amplification
ACKNOWLEDGEMENTS
Genomic DNA was isolated as described previously (26) or
using Genomic-tip as described in the manufacturer’s
protocol. PCR reactions were performed on genomic DNA
with primers designed to amplify exons of the coding
sequence and portions of the flanking introns (Table 1).
Total cellular RNA was purified from a human liver
hybridoma cell line (Huh-7) using Trizol. The total cDNA
was amplified using oligo-dT as described by the Omniscript
protocol followed by PCR amplification with RNA specific
primers (Table 1). The PCR products were purified with the
We acknowledge the contributions of Nora Matiaszuk (Royal
Victoria Hospital) and Gail Dunbar (Royal Victoria Hospital)
for growing cell cultures and David Watkins (Royal Victoria
Hospital) for helpful discussions. These studies were supported
by grants from the Canadian Institute for Health Research
(CIHR), NIH-National Heart and Lung Institute (NHLBI) and
March of Dimes. Scholarship support to C.M.D. was provided
by the CIHR and Alberta Heritage Foundation for Medical
Research. A thank you is extended to Genome Quebec for its
support of the sequencing core facilities.
Human Molecular Genetics, 2002, Vol. 11, No. 26
REFERENCES
1. Rosenblatt, D.S. and Fenton, W.A. (2001) In Scriver, C.R., Beaudet, A.L.,
Sly, W.S. and Valle, D. (eds), The Metabolic and Molecular Bases of
Inherited Disease. McGraw-Hill, New York, pp. 3897–3933.
2. Dobson, D.M., Wai, T., Leclerc, D., Wilson, A., Wu, X., Dore, C.,
Hudson, T.J., Rosenblatt, D.S. and Gravel, R.A. (2002) Identification of the
gene responsible for the cblA complementation group of vitamin B12responsive methylmalonic acidemia based on analysis of prokaryotic
gene arrangements. Proc. Natl. Acad. Sci. USA, in press.
3. Watkins, D. and Rosenblatt, D.S. (1988) Genetic heterogeneity among
patients with methylcobalamin deficiency. Definition of two complementation groups, cblE and cblG. J. Clin. Invest., 81, 1690–1694.
4. Li, Y.N., Gulati, S., Baker, P.J., Brody, L.C., Banerjee, R. and Kruger, W.D.
(1996) Cloning, mapping and RNA analysis of the human methionine
synthase gene. Hum. Mol. Genet., 5, 1851–1858.
5. Leclerc, D., Campeau, E., Goyette, P., Adjalla, C.E., Christensen, B.,
Ross, M., Eydoux, P., Rosenblatt, D.S., Rozen, R. and Gravel, R.A. (1996)
Human methionine synthase: cDNA cloning and identification of mutations
in patients of the cblG complementation group of folate/cobalamin
disorders. Hum. Mol. Genet., 5, 1867–1874.
6. Chen, L.H., Liu, M.L., Hwang, H.Y., Chen, L.S., Korenberg, J. and
Shane, B. (1997) Human methionine synthase. cDNA cloning, gene
localization, and expression. J. Biol. Chem., 272, 3628–3634.
7. Leclerc, D., Wilson, A., Dumas, R., Gafuik, C., Song, D., Watkins, D.,
Heng, H.H., Rommens, J.M., Scherer, S.W., Rosenblatt, D.S. and Gravel,
R.A. (1998) Cloning and mapping of a cDNA for methionine synthase
reductase, a flavoprotein defective in patients with homocystinuria. Proc.
Natl. Acad. Sci. USA, 95, 3059–3064.
8. Gravel, R.A., Mahoney, M.J., Ruddle, F.H. and Rosenberg, L.E. (1975)
Genetic complementation in heterokaryons of human fibroblasts defective
in cobalamin metabolism. Proc. Natl. Acad. Sci. USA, 72, 3181–3185.
9. Mahoney, M.J., Hart, A.C., Steen, V.D. and Rosenberg L.E. (1975)
Methylmalonicacidemia: biochemical heterogeneity in defects of
50 -deoxyadenosylcobalamin synthesis. Proc. Natl. Acad. Sci. USA, 72,
2799–2803.
10. Kerwar, S.S., Spears, C., McAuslan, B. and Weissbach, H. (1971) Studies
on vitamin B12 metabolism in HeLa cells. Arch. Biochem. Biophys., 142,
231–237.
11. Fenton, W.A. and Rosenberg, L.E. (1981) The defect in the cbl B class
of human methylmalonic acidemia: deficiency of cob(I)alamin
adenosyltransferase activity in extracts of cultured fibroblasts. Biochem.
Biophys. Res. Commun., 98, 283–289.
12. Battersby, A.R. (1994) New intermediates in the B12 pathway. Ciba Found.
Symp., 180, 267–279.
3369
13. Roessner, C.A., Santander, P.J. and Scott, A.I. (2001) Multiple biosynthetic
pathways for vitamin B12: variations on a central theme. Vitam. Horm., 61,
267–297.
14. Scott, A.I. (1994) Recent studies of enzymically controlled steps in B12
biosynthesis. Ciba Found. Symp., 180, 285–303.
15. Raux, E., Schubert, H.L. and Warren, M.J. (2000) Biosynthesis of
cobalamin (vitamin B12): a bacterial conundrum. Cell. Mol. Life Sci., 57,
1880–1893.
16. Santander, P.J., Roessner, C.A., Stolowich, N.J., Holderman, M.T. and
Scott, A.I. (1997) How corrinoids are synthesized without oxygen: nature’s
first pathway to vitamin B12. Chem. Biol., 4, 659–666.
17. Roth, J.R., Lawrence, J.G. and Bobik, T.A. (1996) Cobalamin (coenzyme
B12): synthesis and biological significance. Annu. Rev. Microbiol., 50,
137–181.
18. Fonseca, M.V. and Escalante-Semerena, J.C. (2001) An in vitro reducing
system for the enzymic conversion of cobalamin to adenosylcobalamin.
J. Biol. Chem., 276, 32101–32108.
19. Bauer, C.B., Fonseca, M.V., Holden, H.M., Thoden, J.B., Thompson, T.B.,
Escalante-Semerena, J.C. and Rayment, I. (2001) Three-dimensional
structure of ATP:corrinoid adenosyltransferase from Salmonella
typhimurium in its free state, complexed with MgATP, or complexed
with hydroxycobalamin and MgATP. Biochemistry, 40, 361–374.
20. Kofoid, E., Rappleye, C., Stojiljkovic, I. and Roth, J. (1999) The 17-gene
ethanolamine (eut) operon of Salmonella typhimurium encodes five
homologues of carboxysome shell proteins. J. Bacteriol., 181, 5317–5329.
21. Johnson, C.L., Pechonick, E., Park, S.D., Havemann, G.D., Leal, N.A. and
Bobik, T.A. (2001) Functional genomic, biochemical, and genetic
characterization of the Salmonella pduO gene, an ATP:cob(I)alamin
adenosyltransferase gene. J. Bacteriol., 183, 1577–1584.
22. Schuler, G.D. (1997) Pieces of the puzzle: expressed sequence tags and the
catalog of human genes. J. Mol. Med., 75, 694–698.
23. Fenton, W.A. and Rosenberg, L.E. (1978) Genetic and biochemical analysis
of human cobalamin mutants in cell culture. Annu. Rev. Genet., 12,
223–248.
24. Mellman, I., Willard, H.F. and Rosenberg, L.E. (1978) Cobalamin binding
and cobalamin-dependent enzyme activity in normal and mutant human
fibroblasts. J. Clin. Invest., 62, 952–960.
25. Rosenblatt, D.S., Cooper, B.A., Pottier, A., Lue-Shing, H., Matiaszuk, N.
and Grauer, K. (1984) Altered vitamin B12 metabolism in fibroblasts from
a patient with megaloblastic anemia and homocystinuria due to a new
defect in methionine biosynthesis. J. Clin. Invest., 74, 2149–2156.
26. Wilson, A., Leclerc, D., Rosenblatt, D.S. and Gravel, R.A. (1999)
Molecular basis for methionine synthase reductase deficiency in
patients belonging to the cblE complementation group of disorders in
folate/cobalamin metabolism. Hum. Mol. Genet., 8, 2009–2016.