Download Functional Equivalence of Translation Factor eIF5B from Candida

Mol. Cells, Vol. 25, No. 2, pp. 172-177
Molecules
and
Cells
©KSMCB 2008
Functional Equivalence of Translation Factor eIF5B from
Candida albicans and Saccharomyces cerevisiae
Kyung Ok Jun, Eun Ji Yang1, Byeong Jeong Lee, Jeong Ro Park1, Joon H. Lee2, and Sang Ki Choi*
Department of Biological Sciences, Sunchon National University, Sunchon 540-742, Korea;
1
Department of Food and Nutrition, Sunchon National University, Sunchon 540-742, Korea;
2
Myung-Gok Eye Research Institute, Kim’s Eye Hospital, Konyang University College of Medicine, Nonsan 320-711, Korea.
(Received May 7, 2007; Accepted December 3, 2007)
Eukaryotic translation initiation factor 5B (eIF5B)
plays a role in recognition of the AUG codon in conjunction with translation factor eIF2, and promotes
joining of the 60S ribosomal subunit. To see whether
the eIF5B proteins of other organisms function in Saccharomyces cerevisiae, we cloned the corresponding
genes from Oryza sativa, Arabidopsis thaliana, Aspergillus nidulans and Candida albican and expressed them
under the control of the galactose-inducible GAL promoter in the fun12Δ strain of Saccharomyces cerevisiae.
Expression of Candida albicans eIF5B complemented
the slow-growth phenotype of the fun12Δ strain, but
that of Aspergillus nidulance did not, despite the fact
that its protein was expressed better than that of Candida albicans. The Arabidopsis thaliana protein was
also not functional in Saccharomyces. These results
reveal that the eIF5B in Candida albicans has a close
functional relationship with that of Sacharomyces cerevisiae, as also shown by a phylogenetic analysis based
on the amino acid sequences of the eIF5Bs.
Keywords: Candida albicans; eIF5B; Evolution; FUN12;
Phylogeny; Saccharomyces cerevisiae; Translation.
Introduction
The initiation of protein synthesis in eukaryotic cells is
dependent on multiple eukaryotic initiation factors (eIFs)
that stimulate binding of mRNA and methionyl-initiator
tRNA (Met-tRNAiMet) to the 40S ribosome (Hershey and
Merrick, 2006). In eukaryotes, a stable eIF2·GTP·MettRNA ternary complex associates with the 40S subunit
* To whom correspondence should be addressed.
Tel: 82-61-750-3619; Fax: 82-61-750-3608
E-mail: [email protected]
along with additional factors, and the resulting 43S complex then binds mRNA at its 5′ end, forming a 48S complex that scans to locate the AUG start codon. Basepairing between the Met-tRNA in the ribosomal complex
and the AUG codon triggers GTP hydrolysis.
The 48S complex joins with the large 60S ribosomal
subunit forming a functional 80S ribosome. This reaction
is catalyzed by eIF5B, which is a eukaryotic ortholog of
the bacterial translation initiation factor IF2 (Pestova et
al., 2000). The FUN12 gene in yeast encodes a protein
now called eIF5B. Deletion of the FUN12 gene caused a
severe slow growth phenotype due to impaired translation
initiation (Choi et al., 1998). In vitro reconstitution experiments have demonstrated the role of eIF5B in promoting subunit joining (Algire et al., 2002; Pestova et al.,
2000; Shin et al., 2002).
eIF5B physically and functionally interacts with eIF1A,
a eukaryotic ortholog of the bacterial translation initiation
factor IF1 (Choi et al., 2000; Fekete et al., 2005;
Marintchev et al., 2003; Olson et al., 2003; Pestova and
Kolupaeva, 2002), and promotes AUG start codon recognition, subunit joining, GTP hydrolysis by eIF5B and
subsequent release of the factor from the 80S ribosome
(Shin et al, 2002). eIF5Bs from archaea and humans can
substitute for their yeast ortholog both in vivo and in vitro
(Lee et al., 1999).
In this study we examined whether the eIF5Bs of various organisms were functionally interchangeable with that
of Saccharomyces cerevisiae. We cloned eIF5B orthologs
from Oryza sativa, Arabidopsis thaliana, Aspergillus
nidulans and Candida albicans. The genes were expressed under a galactose-inducible GAL promoter in the
fun12Δ strain. Only expression of the eIF5B of Candida
albicans complemented the slow-growth phenotype of the
fun12Δ yeast strain.
Abbreviation: eIF5B, eukaryotic translation initiation factor 5B.
Kyung Ok Jun et al.
173
Materials and Methods
Results and Discussion
Preparation of RNA and RT-PCR A cDNA library of Arabidopsis thaliana was kindly provided by Dr. Pyee of Dankook
University. 10 mg of the cells of Oryza sativa, Aspergillus nidulans and Candida albicans were ground with a pestle and lysed
in 800 µg of Trizol (Invitrogen) reagent with vortexing, and
chloroform and isopropanol were then added. After shaking
vigorously the samples were centrifuged at 12,000 × g for 15
min and RNA was precipitated in the aqueous phase by mixing
with isopropyl alcohol. First strand cDNA synthesis was performed with M-MLV reverse transcriptase (Takara).
The evolutionary tree for the datasets was inferred using the
neighbor-joining method (Saitou and Nei, 1987). The PHYLIP
package (Felsenstein, 1993) was used for constructing the tree.
Phylogenetic analysis of the eIF5B of various organisms Based on the high level of sequence similarity between the eIF5Bs of various organisms, it has been argued
that eIF5B could be an indicator of evolutionary divergence from archaea to humans (Lee et al., 1999). Since
the cDNA sequences of eIF5B from filamentous fungi
and plants are now available in databases, we obtained the
coding sequences of the eIF5Bs of Oryza sativa, Arabidopsis thaliana, Aspergillus nidulans, Neurospora crassa
and Candida albicans. The N-terminal region of eIF5B is
not essential for its function. The G-domains and Cterminal regions of the eIF5Bs comprised amino acid
residues 488-1072 for Aspergillus nidulans, 428-1017 for
Candida albicans, 413-1002 for Saccharomyces cerevisiae, 713-1294 for Arabidopsis thaliana, and 624-1206
for Oryza sativa. It seems that the N-terminal regions of
higher organism eIF5Bs are longer than those of lower
organism since the N-terminus region of the human gene
contains 637 amino acid residues (Lee et al., 1999).
Since the N-terminal regions of eIF5Bs are not essential for their function, alignment of the eIF5Bs sequences
of Oryza sativa, Arabidopsis thaliana, Aspergillus nidulans, Candida albicans, and Saccharomyces cerevisiae
was performed without the N-terminal regions (Fig. 1),
and a phylogenetic tree was constructed by the neighborjoining method (Fig. 2). As shown in Fig. 2, the Oryza
sativa and Arabidopsis thaliana proteins form one branch
of the tree, with the Candida albicans and Saccharomyces
cerevisiae eIF5B proteins on a separate branch. The protein of the filamentous fungus, Aspergillus, is on separate
branches from the single-celled fungus Candida. This
clustering of the eIF5B proteins in the tree is in accord
with the phylogenetic tree made by conventional methods,
indicating that eIF5B is a highly conserved protein and
potentially an evolutionary barometer.
eIF5B cloning and vector construction Primers were designed
to PCR amplify and incorporate restriction sites for ligating the
fragments. PCRs were carried out with the following primers:
YG25-26 for Arabidopsis thaliana, YG27-28 for Oryza sativa,
YG29-30 for Aspergillus nidulans and YG31-32 for Candida
albicans (Table 1). The PCR products for Arabidopsis thaliana,
Aspergillus nidulans and Candida albicans were digested with
BamHI and SmaI and then ligated to the vector pEMBLyex4
digested with same restriction endonucleases to generate eIF5B
expression vectors pYAra, pYAsp, pYCan. The PCR product
for Oryza sativa was digested with SmaI and SalI to generate
expression vector pYOry.
To tag eIF5B protein with glutathione S-transferase (GST),
the eIF5B coding sequences were amplified by PCR using primers that introduced a 5′ SmaI site and a 3′ SalI site. PCRs were
carried out with the following primers: YG51-52 for Arabidopsis thaliana, YG53-54 for Oryza sativa, YG55-56 for Aspergillus nidulans and YG57-58 for Candida albicans (Table 1). The
PCR products were inserted between the SmaI and SalI sites of
the vector pEGKT (Mitchell et al., 1993) creating the GSTeIF5B expression vector pGAra, pGAsp, and pGCan. The PCR
product for Oryza sativa was digested with SmaI and SalI to
generate expression vector pGOry. Each PCR product was confirmed by sequencing.
Immunoblotting Yeast cells grown in SGal media were harvested and lysed with glass beads as described previously
(Seong et al., 2007). Equal amounts of lysates prepared from
yeast cells transformed with the various plasmids were separated
by electrophoresis on SDS-polyacrylamide gels and transferred
onto nitrocellulose filters. The filters were blocked in a TBS-T
solution containing 20 mM Tris-HCl (pH 7.9), 150 mM NaCl,
and 0.2% Tween 20 supplemented with 4% nonfat milk. They
were then incubated in TBS-T-containing GST or eIF2-specific
antibody and 4% nonfat milk, washed three times in TBS-T, and
incubated with TBS-T containing goat anti-rabbit secondary
antibody conjugated to horseradish peroxidase (Bio-Rad). Proteins were detected using an ECL chemiluminescence kit (Amersham Biosciences).
eIF5B of Candida albicans substitutes functionally for
eIF5B of Saccharomyces cerevisiae Because the Nterminal region of eIF5B is not essential for its function,
only the G-domain and C-terminal regions were cloned
into the expression vector. The eIF5B gene of Arabidopsis thaliana was amplified from the cDNA library by PCR
and the others were obtained from cultures or tissues by
RT-PCR using a set of specific primers (Table 1). To see
whether the eIF5B of other organisms can function in
yeast, we attempted to express these eIF5Bs in the fun12Δ
strain of yeast. Strains lacking the FUN12 gene encoding
eIF5B show a severe slow-growth phenotype. The eIF5B
genes were expressed under the GAL promoter in pEMBLyex vector. We observed that only the Candida albicans gene was able to complement the slow growth phenotype of fun12Δ (Fig. 3A, sectors 1 and 5). In order to
examine the expression of the eIF5B genes of the various
174
Translation Factor eIF5B from Candida albicans
Fig. 1. Alignment of the amino acid sequences of eIF5B proteins. The accession numbers for the sequence of each organism were
shown in Fig. 2. The amino acid sequences of the middle G-domain and C-terminal region of eIF5Bs from human (639-1220), Oryza
sativa (624-1206), Arabidopsis thaliana (713-1294), Aspergillus nidulans (488-1072) and Candida albicans (428-1017) were aligned
with the partial amino acid sequence of Saccharomyces cerevisiae (413-1002). The starting numbers indicate the starts of the Gdomains. Identical aligned residues in all five sequences are shown in dark gray, similar residues in light gray. The sequences were
aligned using Clustal X with some manual adjustment (Thompson et al., 1997).
organisms, each coding sequence was cloned into the
GST fusion plasmid as described in Material and Methods. Expression of an N-terminally truncated form of Saccharomyces eIF5B under the control of the galactose-
inducible GAL promoter fully complemented the slowgrowth phenotype of the fun12Δ strain (Fig. 3B, sector 2).
As shown in Fig. 3B (sector 5), its expression also almost
fully complemented the slow-growth phenotype of the
Kyung Ok Jun et al.
175
Table 1. Oligonucleotides used in study.
Oligonucleotide
Sequence (5′ → 3′)
Restriction enzyme
YG25
CCCGGGATGAATCTCCGCTCTCCCATTTGC
SmaI
YG26
GGATCCCTACTGTATCTTGAAGATGTTCTTCAG
BamHI
YG27
CCCGGGATGGACCTTCGTTCACCAATTTGTTGC
SmaI
YG28
GTCGACTTATGGTATCTTCAAGATGCTC
SalI
YG29
CCCGGGATGAACTTGCGATCTCCTATTTGTTG
SmaI
YG30
GGATCCTCAAGGGATATCGAAAAGAACAGGC
BamHI
YG31
CCCGGGATGGATTTGCGTTCTCCAATTTGTTG
SmaI
YG32
GGATCCTCAAACACTGGTTTCAATTTTTTA
BamHI
YG51
CGCGGATCCAATCTCCGCTCTCCCATTTGC
BamHI
YG52
GAACCCGGGCTGTATCTTGAAGATGTTCTTCAG
SmaI
YG53
TCCCCCGGGAGACCTTCGTTCACCAATTTGTTGC
SmaI
YG54
CCCCCCGTCGACTTGGTATCTTCAAGATGCTC
SalI
YG55
CGCGGATCCAACTTGCGATCTCCTATTTGTTG
BamHI
YG56
TCCCCCGGGGCAGGGATATCGAAAAGAACAGGC
SmaI
YG57
CGCGGATCCGATTTGCGTTCTCCAATTTGTTG
BamHI
YG58
TCCCCCGGGGCAACACTGGTTTCAATTTTTTA
SmaI
A
B
Fig. 2. Phylogenetic tree of fungal, plant, and human eIF5B
proteins. The G-domain and C-terminal regions of the eIF5B
proteins from the indicated organisms were aligned and the evolutionary tree for the datasets was inferred using the neighborjoining method (Saitou and Nei, 1987). Following the name of
each organism is the accession number for the sequence. Numbers at the nodes indicate the levels of bootstrap support based
on a neighbor-joining analysis of 1,000 resampled datasets: only
values exceeding 50% are given. Bar, 0.1 amino acid substitution per amino acid position.
fun12Δ stain on galactose medium. However, the level of
complementation observed with the eIF5Bs of the other
organisms (Oryza sativa, Arabidopsis thaliana, and Aspergillus nidulans) was similar to that of the empty vector
transformant (Fig. 3B, sectors 1, 2 and 4). These results
indicate that Candida eIF5B can substitute for the yeast
Fig. 3. Expression of Candida eIF5B in yeast complements the
slow-growth phenotype of the fun12Δ strain. A. The fun12Δ strain
was transformed with the vectors pEMBLyex (vector, sectors 4
and 8), pYCan plasmid (sectors 1 and 5), pYAsp (sectors 2 and 6),
or pYAra (sectors 3 and 7). B. The fun12Δ strain was transformed
with vectors pEGKT (vector, sector 3), pGAra (sector 1), pEGKT
cloned into the yeast eIF5B pC485 plasmid (Choi et al., 1998)
(sector 2), pGOry (sector 4), the pGCan (sector 5), or pGAsp
(sector 6). The indicated strains were streaked on synthetic minimal medium containing 10% galactose plus the required nutrient
supplements, and the plates were incubated at 30°C for 6−7 d.
176
Translation Factor eIF5B from Candida albicans
viding eIF2 antibody. This work was supported by a Korea Research Foundation Grant funded by the Korean Government
(MOEHRD, Basic Research Promotion Fund) (KRF-2004-041C00267).
References
Fig. 4. Protein immunoblot analysis of the various GST-eIF5Bs
expressed in yeast. Twenty micrograms of crude yeast cell extracts from fun12Δ expressing the indicated eIF5B proteins was
subjected to SDS-PAGE and then blotted onto a nitrocellulose
membrane. The blot was cut in two and probed with anti-GST
and anti-eIF2α antisera, as indicated.
gene and that the eIF5Bs of the filamentous fungi and
plants have diverged in evolution from that of yeast.
Saccharomyces cerevisiae was transformed with each
plasmid containing an eIF5B gene and cell extracts were
tested in an immunoblot analysis. A single polypeptide of
about 95 kDa was detected (Fig. 4), as expected with the
Arabidopsis thaliana, Aspergillus nidulans and Candida
albicans genes. However the protein of Oryza sativa was
expressed in a truncated form, and the eIF5B of Aspergillus nidulans was better expressed than the others though it
was not functional in Saccharomyces cerevisiae.
Previously mammalian and archeal eIF5Bs were found
to be partly functional in Saccharomyces, implying that
the translation apparatus of Saccharomyces is similar to
that of mammals. Archaea contain both IF2 and eIF2 homologs indicating that the archaea possess an protein synthesis apparatus evolutionarily intermediate between prokaryotes and eukaryotes. Contrary to our expectation that
the filamentous fungi are close to single celled fungi, the
eIF5B of Aspergillus nidulans did not substitute for that
of Saccharomyces. It would be of interest to investigate
which regions of eIF5B differs most markedly between
these various organisms. Further analysis of the eIF5B
proteins and characterization of their role in translation
initiation should clarify the mechanism and evolution of
the translation apparatus.
In conclusion, our findings show that Candida eIF5B
can functionally substitute for that of Saccharomyces in
vivo, demonstrating that the translation apparatuses of the
two fungi are evolutionarily close. This result supports
the conclusion reached by conventional and molecular
phylogenetic methods.
Acknowledgments We thank Dr. Tomas Dever (NIH) for pro-
Algire, M.A., Maag, D., Savio, P., Acker, M.G., Tarun, S.Z. Jr.,
Sachs, A.B., Asano, K., Nielsen, K.H., Olsen, D.S., Phan, L.,
et al. (2002). Development and characterization of a reconstituted yeast translation initiation system. RNA 8, 382−397.
Choi, S.K., Lee, J.H., Zoll, W.L., Merrick, W.C., and Dever,
T.E. (1998). Promotion of Met-tRNAiMet binding to ribosomes by yIF2, a bacterial IF2 homolog in yeast. Science
280, 1757−1760.
Choi, S.K., Olsen, D.S., Roll-Mecak, A., Martung, A., Remo,
K.L., Burley, S.K., Hinnebusch, A.G., and Dever, T.E.
(2000). Physical and functional interaction between the eukaryotic orthologs of prokaryotic translation initiation factors
IF1 and IF2. Mol. Cell. Biol. 20, 7183−7191.
Fekete, C.A., Applefield, D.J., Blakely, S.A., Shirokikh, N.,
Pestova, T.V., Lorsch, J.R., and Hinnebusch, A.G. (2005).
The eIF1A C-terminal domain promotes initiation complex
assembly, scanning and AUG selection in vivo. EMBO J. 24,
3588−3601.
Felsenstein, J. (1993). PHYLIP (Phylogeny Inference Package)
version 3.5.c Department of Genetics, University of Washington, Seattle, USA.
Hershey, J.W.B., and Merrick, W.C. (2000). In translational
control of gene expression. Sonenberg, N., Hershey, J.W.B.,
and Mathews, M.B., eds., (NY, USA: Cold Spring Harbor
Lab. Press, Plainview), pp. 33−88.
Lee, J.H., Choi, S.K., Roll-Mecak, A., Burley, S.K., and Dever,
T.E. (1999). Universal conservation in translation initiation
revealed by human and archaeal homologs of bacterial translation initiation factor IF2. Proc. Natl. Acad. Sci. USA. 96,
4342−4347.
Marintchev, A., Kolupaeva, V.G., Pestova, T.V., and Wagner, G.
(2003). Mapping the binding interface between human eukaryotic initiation factors 1A and 5B: a new interaction between old partners. Proc. Natl. Acad. Sci. USA 100, 1535−
1540.
Mitchell, D.A., Marshall, T.K., and Deschenes, R.J. (1993).
Vectors for the inducible overexpression of glutathione Stransferase fusion proteins in yeast. Yeast 9, 715−722.
Olsen, D.S., Savner, E.M., Mathew, A., Zhang, A.F., Krishnamoorthy, T., Phan L., and Hinnebusch, A.G. (2003). Domains of eIF1A that mediate binding to eIF2, eIF3 and eIF5B
and promote ternary complex recruitment in vivo. EMBO J.
22, 193−204.
Pestova, T.V., and Kolupaeva, V.G. (2002). The roles of individual eukaryotic translation initiation factors in ribosomal
scanning and initiation codon selection. Genes Dev. 16,
2906−2922.
Pestova, T.V., Lomakin, I.B., Lee, J.H., Choi, S.K., Dever, T.E.,
and Hellen, C.U. (2000). The joining of ribosomal subunits
in eukaryotes requires eIF5B. Nature 403, 332−335.
Saitou, N., and Nei, M. (1987). The neighbor-joining method: a
Kyung Ok Jun et al.
new method for reconstructing phylogenetic trees. Mol. Biol.
Evol. 4, 406−425.
Seong, K.M., Baek, J.H., Ahn, B.Y., Yu, M.H., and Kim, J.
(2007). Rpn10p is a receptor for ubiquitinated Gcn4p in proteasomal proteolysis. Mol. Cells 24, 194−199.
Shin, B.S., Maag, D., Roll-Mecak, A., Arefin, M.S., Burley,
S.K., Lorsch, J.R., and Dever, T.E. (2002). Uncoupling of
177
initiation factor eIF5B/IF2 GTPase and translational activi
ties by mutations that lower ribosome affinity. Cell 111,
1015−1025.
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and
Higgins, D.G. (1997). The CLUSTAL_X windows interface:
flexible strategies for multiple sequence alignment aided by
quality analysis tools. Nucleic Acids Rec. 15, 4876−4882.