Download Differential Expression of IFN Regulatory Factor 4 Gene in Human

Differential Expression of IFN Regulatory
Factor 4 Gene in Human Monocyte-Derived
Dendritic Cells and Macrophages
This information is current as
of June 14, 2017.
Anne Lehtonen, Ville Veckman, Tuomas Nikula, Riitta
Lahesmaa, Leena Kinnunen, Sampsa Matikainen and Ilkka
Julkunen
J Immunol 2005; 175:6570-6579; ;
doi: 10.4049/jimmunol.175.10.6570
http://www.jimmunol.org/content/175/10/6570
Subscription
Permissions
Email Alerts
This article cites 79 articles, 54 of which you can access for free at:
http://www.jimmunol.org/content/175/10/6570.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2005 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
References
The Journal of Immunology
Differential Expression of IFN Regulatory Factor 4 Gene in
Human Monocyte-Derived Dendritic Cells and Macrophages1
Anne Lehtonen,2* Ville Veckman,* Tuomas Nikula,‡ Riitta Lahesmaa,‡ Leena Kinnunen,†
Sampsa Matikainen,* and Ilkka Julkunen*
C
irculating blood monocytes provide a pool of precursor
cells that are able to differentiate into macrophages and
DCs, the cell types that form the bridge between innate
and adaptive immune responses. Macrophages and dendritic cells
(DCs)3 are APCs with overlapping as well as cell type-specific
functions. After capturing and processing foreign Ags, activated
DCs move to local lymph nodes and present Ags to naive T cells,
thus activating Ag-specific immune responses. Macrophages act as
scavengers by directly phagocytosing and destroying infectious
agents and other harmful substances. In the course of these events,
both macrophages and DCs produce a range of proinflammatory
chemokines and cytokines that regulate inflammatory reactions
and stimulate the development of innate and adaptive immune responses. At present, the molecular basis for the functional differences between macrophages and DCs is under active investigation.
IFN regulatory factors (IRFs) are a family of transcription factors involved in the regulation of both innate and adaptive immunity (1, 2). By gene knockout studies, IRF1, IRF4, and IRF8 have
been found to be essential for the proper differentiation and func*Department of Viral Diseases and Immunology and †Department of Epidemiology
and Health Promotion, National Public Health Institute, Helsinki, Finland; and ‡Turku
Centre for Biotechnology, University of Turku and Åbo Akademi University, Turku,
Finland
Received for publication September 13, 2004. Accepted for publication September
7, 2005.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by the Medical Research Council of the Academy of
Finland and the Finnish Cancer Foundation.
2
Address correspondence and reprint requests to Dr. Anne Lehtonen, Department of
Viral Diseases and Immunology, National Public Health Institute, Mannerheimintie
166, FI-00300 Helsinki, Finland. E-mail address: [email protected]
3
Abbreviations used in this paper: DC, dendritic cell; IRF, IFN regulatory factor;
CHX, cycloheximide; ChIP, chromatin immunoprecipitation; GAS, IFN-␥ activation
site; CIS, cytokine-inducible Src homology-domain containing protein.
Copyright © 2005 by The American Association of Immunologists, Inc.
tions of immune cells. Lymphocyte development requires IRF1
and IRF4 (3–7), whereas IRF7 and IRF8 are needed for monocyteto-macrophage differentiation (8, 9), and together with IRF1, IRF8
orchestrates the development of Th1 immune responses by regulating the gene expression of IL-12, the major Th1 immune response-inducing cytokine (10 –13). Recently, IRF4 and IRF8 have
also been shown to participate in DC differentiation and functions
(14 –19). IRF1 is ubiquitous in its expression, whereas IRF4 and
IRF8 are preferentially expressed in the cells of the immune system (1, 2, 20, 21).
IRF proteins bind to a variety of related DNA elements on their
target promoters. An interesting feature of IRF4 and IRF8 is their
ability to function as transcriptional activators and repressors (20,
21), depending on the promoter context. This is due to their ability
to form homo- and heterodimers with other IRFs and their ability
to interact with other transcription factors in a cell type-specific
manner (22–26), adding another level of regulation in the control
of cell-specific target gene expression.
IRF4, originally thought to follow a lymphocyte-restricted expression pattern (27), has remained one of the least studied members of the IRF family. This holds true even though IRF4 expression has also been detected in murine and human macrophages (28,
29) and in human DCs (19, 30). IRF4 is known to interact with
IRF8, a factor playing a key role in regulating the differentiation
and functions of the cells of the monocytic lineage. Additionally,
both IRF4 and IRF8 are known to form complexes with PU.1 (31),
an Ets family transcription factor required for terminal differentiation of myeloid cells (32, 33). To date, no specific inducer of
IRF4 expression has been identified in myeloid cells. In the present
study, we have focused on factors regulating IRF4 gene expression
in human primary monocytes, macrophages, and DCs. We show
that IRF4 mRNA expression was regulated by cytokines important
for generation of macrophages and DCs from monocytes. DCs
were found to express IRF4 mRNA and protein constitutively, and
0022-1767/05/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
In vitro human monocyte differentiation to macrophages or dendritic cells (DCs) is driven by GM-CSF or GM-CSF and IL-4,
respectively. IFN regulatory factors (IRFs), especially IRF1 and IRF8, are known to play essential roles in the development and
functions of macrophages and DCs. In the present study, we performed cDNA microarray and Northern blot analyses to characterize changes in gene expression of selected genes during cytokine-stimulated differentiation of human monocytes to macrophages or DCs. The results show that the expression of IRF4 mRNA, but not of other IRFs, was specifically up-regulated during
DC differentiation. No differences in IRF4 promoter histone acetylation could be found between macrophages and DCs, suggesting
that the gene locus was accessible for transcription in both cell types. Computer analysis of the human IRF4 promoter revealed
several putative STAT and NF-␬B binding sites, as well as an IRF/Ets binding site. These sites were found to be functional in
transcription factor-binding and chromatin immunoprecipitation experiments. Interestingly, Stat4 and NF-␬B p50 and p65
mRNAs were expressed at higher levels in DCs as compared with macrophages, and enhanced binding of these factors to their
respective IRF4 promoter elements was found in DCs. IRF4, together with PU.1, was also found to bind to the IRF/Ets response
element in the IRF4 promoter, suggesting that IRF4 protein provides a positive feedback signal for its own gene expression in DCs.
Our results suggest that IRF4 is likely to play an important role in myeloid DC differentiation and gene regulatory functions. The
Journal of Immunology, 2005, 175: 6570 – 6579.
The Journal of Immunology
6571
STAT and NF-␬B transcription factors play an important role in
regulating IRF4 expression in DCs. Finally, IRF4 protein bound to
a regulatory element in its own promoter, suggesting an autoregulatory loop controlling IRF4 mRNA expression in DCs.
Materials and Methods
Cytokines and cell culture
cDNA microarray analyses
The human ImmunoChip cDNA microarrays (35) were printed on glass
slides in the Finnish DNA Microarray Centre at Turku Centre for Biotechnology (具www.btk.utu.fi典) according to established protocols (具http://
microarrays.btk.fi典). The ImmunoChip contains ⬃2000 genes implicated in
immune cell activation and differentiation, including cytokines, chemokines and their receptors, transcription factors, and genes involved in signaling, apoptosis, and cell cycle regulation. Samples were labeled with
FluoroLink Cy3-dUTP and Cy5-dUTP (Amersham Biosciences) using 16
␮g of total RNA for direct labeling during cDNA synthesis and hybridized
using loop-design (36). Protocols for labeling and hybridization are available through a web site of the Finnish DNA microarray centre (具http://
microarrays.btk.fi/public/Resources.shtml典). Separate images for Cy3 and
Cy5 dyes were acquired using ScanArray 5000 laser-scanning microscope
(Packard BioSciences), and gene transcript levels were then determined
from the fluorescence intensities of scanned data image files with the QuantArray Microarray Analysis software (Packard BioSciences).
DNA affinity-binding and Western blot analysis
Cells were treated with cytokines as indicated in the figures and figure
legends. Cells were collected, and whole cell extracts were prepared as
described previously (38). Both strands of the DNA elements (Table I)
were synthesized with BamHI overhangs as spacers, and the upper strand
oligonucleotide was 5⬘-biotinylated (DNA Technology). The oligonucleotides were annealed in 0.5 M NaCl and incubated with streptavidin-agarose
beads (Neutravidin; Pierce) at ⫹4°C for 2 h in a ratio to yield maximum
saturation of the beads with the biotinylated oligonucleotide. Protein samples were incubated with agarose beads saturated with the oligonucleotide
for 2 h at ⫹4°C. After washing, the bound proteins were released in SDS
sample buffer, and equal aliquots were subjected to SDS-PAGE and Western blotting.
For direct Western blot analyses, cells were lysed, and 30-␮g protein
aliquots were separated on 10% SDS-PAGE (15% for detection of PU.1)
using the Laemmli buffer system. Proteins separated on gels were transferred onto Immobilon-P membranes (Millipore). Binding of primary and
secondary Abs was performed in PBS (pH 7.4) containing 5% nonfat milk
for 1 h at room temperature. Primary Abs against IRF4 (1/1000) (39), IRF8
(sc-6058X), PU.1 (sc-352X), Stat4 (sc-486X), Stat5 (sc-835X), Stat6 (sc981X), p50 (sc-7178X), p65 (sc-372X), RelB (sc-226X), and c-Rel (sc70X; all from Santa Cruz Biotechnology) were used in immunoblotting (all
in 1/5000 dilution, except p65 in 1/1000). HRP-conjugated anti-guinea pig
(P0141; DakoCytomation), anti-goat (P0449; DakoCytomation), and antirabbit (P0448; DakoCytomation) Igs were used as secondary Abs. The
protein bands were visualized on HyperMax film using the ECL system
(Amersham Biosciences).
Chromatin immunoprecipitation (ChIP)
Detection of histone-H3 acetylation of the IRF4 promoter was done by
using a commercial ChIP kit (17-245; Upstate Biotechnology) according to
the manufacturer’s instructions. Macrophages and DCs were treated as
specified in the kit’s protocol. The primers from the IRF4 gene promoter
region used in PCR were 5⬘-ACA GCG CCT GGC CTA TTT TG-3⬘ (forward) and 5⬘-TGC ATC TAT TAG GCT GGT GA-3⬘ (reverse). Binding of
transcription factors to the IRF4 promoter region in macrophages and DCs
was further characterized with ChIP experiments using the following Abs:
anti-Stat4 (sc-486), anti-Stat6 (sc-1698), anti-PU.1 (C-terminal, sc-352),
and anti-PU.1 (N-terminal, sc-5972) (all Abs from Santa Cruz Biotechnology). The PCR detection (FastStart TaqDNA polymerase; Roche Diagnostic Systems) of the precipitates was done using primers flanking the
IRF4combi binding site: 5⬘-AGC ATG TCA GAC ACG CAG AG-3⬘ (forward) and 5⬘-CTT CGC TTT GCA GAG CGT GT-3⬘ (reverse). Input
controls, representing the starting material before the immunoprecipitation
step, were included in the PCR, alongside with the immunoprecipitated
samples and no-Ab control samples. PCR samples were analyzed by agarose gel electrophoresis on 1.5% gels.
Northern blot analysis
EMSA
Total cellular RNA was isolated as described previously (37). Ten-microgram aliquots were size-fractionated on a 1% formaldehyde-agarose gel,
transferred to a nylon membrane (Hybond; Amersham Biosciences), and
hybridized with IRF1, IRF4, IRF8, PU.1, Stat1, Stat4, Stat5A, Stat5B,
Stat6, NF-␬B p50, and NF-␬B p65 probes. Ethidium bromide staining of
ribosomal RNA bands was used to ensure equal RNA loading. The probes
were labeled with [␣-32P]dCTP (3000 Ci/mmol; Amersham Biosciences)
using the random priming method. The membranes were hybridized in
Ultrahyb hybridization buffer (Ambion), washed twice at room tempera-
Nuclear extracts and nuclear protein/DNA-binding reactions were performed as described previously (40, 41). CIS1 IFN-␥ activation site (GAS)
(5⬘-gatc-CCC CGT TTT CCT GGA AAG TTT TGG AAA TCT GT-3⬘)
and IRF4/Stat6 (5⬘-gatc-CCT CGC CCT TCG CGG GAA ACG GCC CC
3⬘) oligonucleotides were obtained from DNA Technology. The probes
were labeled by Klenow fill-in. The binding reaction was done at room
temperature for 0.5 h. The samples were analyzed by electrophoresis on
6% nondenaturing low-ionic strength polyacrylamide gels in 0.25⫻ Trisborate-EDTA. The gels were dried and visualized by autoradiography.
Table I. Sequences of the DNA elements used in DNA-affinity binding assays
Element
Sequence (5⬘ biotin-ggatcc-)
IRF4combi
CD68
NF-␬BRE1
NF-␬BRE2
Stat6/␬B
GGCCATTTCCTATTTTCTTTTTAGTGAGTGCGATGTTCTCTAAACACCGC
CCTCTCTTGGAAAGGAGGAAATGAAAGTC
AAAGTATGTAAAATCCCTGGTCCA
TCGGCTTGCAAAGTCCCTCTCCCC
CCTCGCCCTTCGCGGGAAACGGCCCCAGTGACAGTCCCCGAAGC
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
Monocytes were purified from freshly collected leukocyte-rich buffy coats
obtained from healthy blood donors (Finnish Red Cross Blood Transfusion
Service). Human PBMCs were isolated by a density gradient centrifugation
over Ficoll-Paque gradient (Amersham Biosciences). To obtain DCs,
monocytes were further purified as described previously (34). Briefly,
mononuclear cells were centrifuged over a Percoll gradient (Amersham
Biosciences). Next, the remaining T and B cells were removed using antiCD3 and anti-CD19 magnetic beads (Dynal). Monocytes were allowed to
adhere to plastic 6-well plates (Falcon; BD Biosciences) for 1 h at 37° C
in RPMI 1640 medium supplemented with antibiotics and glutamine without FCS (2.5 ⫻ 106 cells/well). After incubation, nonadherent cells were
removed, and the wells were washed with PBS. Monocytes were differentiated into macrophages in macrophage-serum-free medium (Invitrogen
Life Technologies) supplemented with antibiotics and recombinant human
GM-CSF (10 ng/ml; Biosite). Culture medium (2 ml/well) was replaced
every 2 days. Monocyte-derived immature DCs were cultured for 6 –7 days
in RPMI 1640 medium with 10% FCS, recombinant human IL-4 (20 ng/ml;
R&D Systems), and recombinant human GM-CSF (10 ng/ml; Biosite).
Fresh medium (1 ml/well) was added every 2 days. Cultured DCs were
CD1a⫹, CD14⫺, CD80⫺, CD83⫺, and CD86⫹, and they showed a typical
DC morphology (data not shown). To study the effect of protein synthesis
inhibition on gene expression in monocytes, the cells were cytokine stimulated in the presence of cycloheximide (CHX) (100 ␮g/ml) for 2 h. CHX
was added onto the cells 0.5 h before cytokine stimulation. In some experiments, DCs were treated with TNF-␣ (10 ng/ml; Biosite) for times
indicated in the figures.
ture, and once at 65°C in 1⫻ SSC/0.1% SDS for 0.5 h each time and
exposed to Kodak AR X-Omat films at ⫺70°C using intensifying screens.
REGULATION OF IRF4 GENE EXPRESSION IN DCs AND M␾
6572
Results
Expression of IRF4 mRNA is induced in monocytes treated with
GM-CSF or IL-4
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
To study the immediate early events in monocyte differentiation
into macrophages or DCs, we stimulated freshly isolated human
primary monocytes for 3 h with GM-CSF, IL-4, or their combination. Total cellular RNA was isolated and hybridized to a cDNA
microarray (ImmunoChip). Because IRF8 is essential for the development of macrophages and DCs (9, 14 –17), we were interested in analyzing IRF gene expression in the early phases of macrophage and DC differentiation. Surprisingly, the expression of the
IRF8 gene remained virtually unchanged when monocytes were
treated with GM-CSF and/or IL-4 (Table II). The IRF4 gene, instead, was one of the most strongly up-regulated genes in cytokinestimulated monocytes (Table II). Therefore, the regulation of IRF4
gene expression, a known partner of IRF8, was studied in more
detail. First, to verify the results obtained with the cDNA array,
monocytes were treated with GM-CSF, IL-4, or their combination
for 2 or 4 h, and total cellular RNA was isolated and analyzed by
Northern blotting with IRF1, IRF4, IRF8, and PU.1 probes. IRF4
mRNA expression was strongly up-regulated already at 2 h after
stimulation with GM-CSF or IL-4 and especially with their combination (Fig. 1A). IRF8 gene expression was transiently up-regulated (at 2 h) by IL-4 alone or in combination with GM-CSF.
IRF1 mRNA expression was weakly down-regulated by IL-4.
IRF4 mRNA expression is enhanced during DC differentiation
To further characterize IRF and PU.1 expression during macrophage and DC differentiation, we performed Northern blot analyses on total cellular RNA isolated from monocytes and 3- and
7-day macrophages and DCs. IRF1 was basally expressed in
monocytes, but its expression decreased during differentiation
(Fig. 1B). IRF8 and PU.1 mRNA expression remained stable
throughout macrophage and DC differentiation. In contrast, IRF4
mRNA expression could only be seen in cells committed to DC
differentiation (Fig. 1B).
Because there was a marked difference in IRF4 mRNA expression between macrophages and DCs, we analyzed whether this
difference was due to accessibility of the IRF4 promoter. We performed ChIP experiments using anti-acetyl-histone H3 Abs to detect possible differences in IRF4 promoter acetylation between
macrophages and DCs (Fig. 1C). IRF4 promoter-specific primers
produced an amplification product of the expected size both from
macrophages and DCs (Fig. 1C), suggesting that there was no
major difference in IRF4 promoter histone acetylation that could
explain the differential IRF4 mRNA expression between macrophages and DCs.
Comparison of human and mouse IRF4 promoters
To characterize the role of cytokine-activated transcription factors
in regulating IRF4 gene expression, we analyzed the IRF4
Table II. Fold change values from the cDNA microarray analysis of
cytokine-stimulated monocytes
Fold Change
Accession
Gene Name
GM-CSF
IL-4
GM-CSF⫹IL-4
AA478043
AA393214
AA825491
N30372
AA877255
AI391632
AA291577
IRF1
IRF2
IRF4
IRF5
IRF7
IRF8
IRF9
0.70
0.08
2.10
0.50
⫺0.15
⫺0.30
⫺0.18
⫺0.01
⫺0.28
2.18
0.82
⫺0.14
⫺0.41
⫺0.14
⫺0.55
⫺0.24
2.63
0.68
⫺0.21
0.64
0.02
FIGURE 1. Characterization of IRF and PU.1 mRNA expression in
monocytes and during differentiation of macrophages and DCs. A, Monocytes were stimulated with GM-CSF, IL-4, or their combination for 2 or
4 h. Total cellular RNA was isolated and analyzed by Northern blotting
with IRF1, IRF4, IRF8, and PU.1 probes. B, Monocytes were differentiated
into 3- and 7-day macrophages (M␾) and DCs with GM-CSF or GMCSF⫹IL-4, respectively. Total RNA was isolated and analyzed as in A.
Ethidium bromide staining of ribosomal RNA is shown as a control of
equal RNA loading. C, ChIP was used to analyze the status of IRF4 promoter histone H3 acetylation in 7-day M␾ and DCs. The resulting PCR
products from the IRF4 promoter region are visualized by agarose gel
electrophoresis.
The Journal of Immunology
6573
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 2. Sequence analysis of the human IRF4 promoter and comparison of the transcription factor binding sites between human and mouse
promoters. The program MatInspector was used to analyze the human (compiled from sequences U52683 and BC015752) and mouse (bp 1981–3355 of
sequence U20949) IRF4 promoter sequences for putative transcription factor binding sites. A, Detailed sequence of the human promoter. Previously
characterized binding sites are boxed and named as in original publications. The binding sites analyzed in this study are shaded and named IRF4combi,
Stat6/␬B, NF-␬BRE1, and NF-␬BRE2. Factor binding sites are typed in boldface. B, Alignment of transcription factor binding sites between human and
mouse promoters. Previously characterized binding sites and those relevant to this study are shown in the comparison.
promoter region in detail in silico. The human and mouse IRF4
promoters have partially been characterized previously (42– 45).
Analysis of the human (1307 bp; compiled of sequences U52683
(43) and BC015752) and mouse IRF4 promoters (1375 bp; bp
1981–3355 of sequence U20949 (42)), with the MatInspector program (46), revealed both similarities and differences in the promoter
6574
REGULATION OF IRF4 GENE EXPRESSION IN DCs AND M␾
elements (Fig. 2). A total of 171 putative transcription factor binding
sites in the human and 188 sites in the mouse promoter was found. For
more detailed studies, we chose three putative NF-␬B binding sites
(NF-␬BRE1, NF-␬BRE2, and Stat6/␬B) and two GAS sites (Stat6/␬B
and IRF4combi). The Stat6-binding GAS element is adjacent to a
NF-␬B element and is conserved between human and mouse (Fig.
2B). The IRF4combi element includes the IRF4 GAS element previously described by us (39), with an extension of 8 nt upstream to
include a predicted PU.1/IRF4 binding site.
Cytokine-inducible expression in monocytes
Multiple transcription factors bind to the IRF4combi and
Stat6/␬B GAS-containing elements in DCs
To characterize STAT binding to putative IRF4 promoter GAS
elements during differentiation of macrophages and DCs, we prepared whole cell extracts from monocytes and 3- and 7-day macrophages and DCs and conducted DNA affinity-binding experiments. Biotinylated double-stranded oligonucleotides were
prepared spanning the putative GAS elements, IRF4combi and
Stat6/␬B (Fig. 2A). Proteins binding to these elements were pulled
down and identified by Western blotting using STAT-specific Abs
(Fig. 4A). The IRF4combi element bound Stat4 in monocytes and
DCs, but only very weakly in macrophages. Stat5 and Stat6 binding was detected only in 7-day DCs. The Stat6/␬B element bound
Stat6 very strongly in 7-day DCs, whereas Stat5 binding occurred
at a lower level (Fig. 4A). Weak Stat4 binding was also detected in
DCs. As a whole, the results suggest that Stat6 is the major factor
binding to this site, as predicted by the computer analysis.
Interestingly, the MatInspector program recognized a putative
IRF4/PU.1 binding site in the IRF4 promoter, adjacent to the Stat4
binding GAS site (IRF4combi). To test the functionality of this
binding site, pull-down experiments followed by Western blot detection with anti-IRF4 and anti-PU.1 Abs were performed. IRF4
bound to this element, but only in 7-day DCs, although IRF4 protein expression was high also in 3-day DCs (Fig. 4B). PU.1 was
also found to bind the IRF4combi element especially in 7-day DCs
and, to a lesser extent, in macrophages. Western blotting with the
PU.1 Ab also revealed a protein band of smaller size (⬃25 kDa)
with DNA-binding capacity.
FIGURE 3. Protein synthesis inhibition does not completely block IRF4
mRNA expression in cytokine-stimulated monocytes. A, Total cellular
RNA was isolated from monocytes stimulated with GM-CSF, IL-4, or their
combination for 2 h in the presence or in the absence of CHX, a protein
synthesis inhibitor. Expression of IRF4 and CIS1 mRNAs was analyzed by
Northern blotting. B, Monocytes were stimulated for 1 h with GM-CSF or
GM-CSF⫹IL-4. Nuclear extracts were prepared and analyzed by EMSA
using CIS1 GAS and IRF4/Stat6 oligonucleotide probes.
We also performed ChIP analyses in differentiated macrophages
and DCs using Abs recognizing Stat4, Stat6, and the N terminus
and the C terminus of PU.1. In macrophages, only the sample
precipitated with the anti-Stat4 Ab yielded an amplification product when primers flanking the IRF4combi element were used (Fig.
4C). In DCs, Abs against Stat4 and Stat6 as well as both anti-PU.1
Abs were able to precipitate the promoter fragment.
Stat4 mRNA is differentially expressed in macrophages and DCs
Differences in the expression of STAT transcription factors between macrophages and DCs could account for the differential
binding of STATs to IRF4 promoter elements in pull-down and
ChIP experiments. Because there is no comprehensive data on the
expression of STAT genes during primary human monocyte differentiation to macrophages or DCs, we conducted analyses of
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
According to the computer analysis (Fig. 2A) and our previous
studies (39), there are at least two GAS elements located in the
IRF4 promoter. GAS is the target element for STATs that are
activated by a number of cytokines, including GM-CSF (activates
Stat5) and IL-4 (activates Stat6). We studied cytokine-induced
IRF4 gene expression in the presence of CHX to see whether the
up-regulation of IRF4 gene expression was a direct effect mediated
by activated STATs. CHX was able to inhibit the induction of
IRF4 mRNA in response to GM-CSF (Fig. 3A). However, the effect of IL-4 alone or together with GM-CSF could not be completely blocked by CHX, suggesting that IL-4 was able to directly
activate transcription of the IRF4 gene. The expression of cytokine-inducible Src homology 2-domain containing protein (CIS;
Fig. 3A), whose expression is known to be regulated directly by
Stat5 (47, 48), was readily induced by GM-CSF also in the presence of CHX. IL-4 was also able to enhance CIS mRNA expression. We also studied STAT DNA binding in monocytes by EMSA
using a GAS element from the CIS1 promoter region and the
Stat6-binding element from the IRF4 promoter. Strong DNA binding in response to GM-CSF and GM-CSF⫹IL-4 was detected with
the CIS GAS probe (Fig. 3B). In contrast, a DNA-binding complex
was formed on the IRF4 promoter Stat6 GAS element only in
response to GM-CSF⫹IL-4 stimulation.
The Journal of Immunology
6575
steady-state STAT mRNA expression by Northern blotting. Stat1
mRNA expression remained virtually unchanged during differentiation (Fig. 4D). Stat5A and Stat5B mRNAs were more
strongly expressed in differentiated macrophages and DCs than
in monocytes. The expression of Stat6 mRNA was the highest
in monocytes and was somewhat lower in DCs and clearly
lower in macrophages. The most significant difference was seen
with Stat4 mRNA (Fig. 4D). Monocytes show low-level Stat4
mRNA expression, and in macrophages, Stat4 mRNA was
barely detectable. The strongest expression of Stat4 mRNA was
seen in 3- and 7-day DCs, where it coincided with IRF4 expression (compare Fig. 1B).
Constitutive mRNA expression and DNA-binding activity of
NF-␬B proteins are altered during macrophage and DC
differentiation
Human and mouse IRF4 promoters contain previously characterized (44, 45) as well as novel putative NF-␬B binding sites (Fig.
2). To characterize the NF-␬B system in our cell model, we analyzed p50 and p65 mRNA expression by Northern blotting in
monocytes, 3- and 7-day macrophages and DCs. The expression of
p50 and p65 mRNAs was clearly lower in 7-day macrophages than
in other cell types (Fig. 5A). We also studied whether NF-␬B family proteins constitutively bound to the Stat6/␬B site of the IRF4
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 4. Multiple transcription factors bind to IRF4 promoter elements during macrophage and DC differentiation. A. Whole-cell extracts were
prepared from monocytes and 3- and 7-day macrophages (M␾) and DCs. Proteins binding to the IRF4combi and Stat6/␬B DNA elements from the IRF4
promoter were pulled down and analyzed by Western blotting with anti-Stat4, anti-Stat5, and anti-Stat6 Abs. The band detected by the anti-Stat4 Ab in
7-day macrophages in the Stat6/␬B oligonucleotide pull-down represents nonspecific staining. B, Whole-cell extracts were prepared from monocytes and
3- and 7-day M␾ and DCs and analyzed by direct Western blotting with anti-IRF4 Abs (upper panel), or the IRF4combi DNA element from the IRF4
promoter was used to pull down interacting proteins subsequently visualized by Western blotting with anti-IRF4 and anti PU.1 Abs (lower panels). C,
Transcription factor binding to the IRF4combi element in the IRF4 promoter in 7-day M␾ and DCs was analyzed using ChIP with Abs against Stat4, Stat6,
N terminus of PU.1, and C terminus of PU.1. D, Total cellular RNA was isolated from untreated monocytes and 3- and 7-day differentiated M␾ and DCs,
and Stat1, Stat4, Stat5A, Stat5B, and Stat6 mRNA expression was analyzed by Northern blotting.
6576
REGULATION OF IRF4 GENE EXPRESSION IN DCs AND M␾
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 5. Gene expression and DNA binding of NF-␬B transcription
factors to IRF4 promoter elements during macrophage and DC differentiation. A, Total cellular RNA was isolated from untreated monocytes and 3and 7-day macrophages (M␾) and DCs. Basal NF-␬B p50 and p65 mRNA
was analyzed by Northern blotting. B, Whole-cell extracts were prepared
from monocytes and 3- and 7-day M␾ and DCs. Proteins binding to the
Stat6/␬B DNA element from the IRF4 promoter were pulled down and
analyzed by Western blotting with anti-p50, anti-p65, anti-RelB, and antic-Rel Abs.
promoter. DNA pull-down experiments, followed by Western
blotting with Abs specific for NF-␬B p50, p65, RelB, and c-Rel,
revealed basal binding of NF-␬B p50 protein in all cell types (Fig.
5B). In more differentiated cells a higher molecular mass form of
p50 protein was found. Basal binding of p65, RelB, and c-Rel was
only detected in 7-day macrophages and DCs, and the binding was
stronger in DCs compared with macrophages, except for the
binding of c-Rel.
TNF-␣ stimulates IRF4 mRNA expression and enhances NF-␬B
binding to IRF4 gene NF-␬B elements in DCs
To study whether the basal binding of NF-␬B (Fig. 5B) to IRF4
promoter elements could be further increased, we stimulated DCs
with TNF-␣ and conducted DNA affinity-binding studies. Basal
binding of NF-␬B p50 to all three NF-␬B binding sites (Fig. 2A)
was evident, whereas p65 binding was seen only in TNF-␣ -treated
DCs (Fig. 6A). RelB and c-Rel also bound to these three elements,
FIGURE 6. TNF-␣ enhances NF-␬B binding to DNA elements and upregulates IRF4 expression and DNA binding in DCs. A, Whole-cell extracts were prepared from 7-day DCs treated with TNF-␣ for 0.5 h and
untreated control cells. Proteins binding to the Stat6/␬B, NF-␬BRE1, and
NF-␬BRE2 DNA elements from the IRF4 promoter (Fig. 2A) were pulled
down and analyzed by Western blotting with anti-p50, anti-p65, anti-RelB,
and anti-c-Rel Abs. B, DCs were treated with TNF-␣ for 3 or 6 h or left
untreated. Total cellular RNA was isolated and mRNA expression of IRF4,
IRF8, and PU.1 was studied by Northern blotting. 0I and 0II represent
untreated control cells collected at 3 and 6 h, respectively. C, Whole-cell
extracts were prepared from 7-day macrophages (M␾) and DCs treated
with TNF-␣ for 6 h and untreated control cells. Proteins binding to CD68
promoter IRF/Ets or IRF4combi DNA elements were pulled down and
analyzed by Western blotting with anti-IRF4 and anti-PU.1 Abs.
The Journal of Immunology
Discussion
Macrophages and myeloid DCs are important players in the interface between innate and adaptive immune responses. Blood monocytes give rise to both macrophages and DCs, two functionally
distinct cell types. The transcription factors that regulate functional
differences between macrophages and DCs in both human and
mouse have been intensively investigated by microarray analyses
(50 –56). However, the picture is far from being complete. Previously, we have observed that STAT expression and activation during human monocyte/macrophage differentiation is altered (37,
48). In the present study, we have compared the expression, activation, and functional differences of IRF, STAT, and NF-␬B transcription factors between monocyte-derived macrophages and DCs.
Our major observation was that IRF4 gene expression was very
high in DCs but was virtually absent in macrophages. It has been
shown previously that IRF8 is required for the terminal differentiation of macrophages and DCs (9, 14 –17). We observed that
IRF8 is constitutively expressed in human macrophages and DCs
(Fig. 1). Thus, it is likely that IRF8 requires other interaction partners or that additional transcription factors are involved in regulating the functional differences between macrophages and DCs.
We propose here that IRF4, with its DC-specific expression, may
be one of these factors that regulate DC differentiation and
functions.
We have shown for the first time that in human monocytes, IRF4
gene expression is up-regulated by GM-CSF and IL-4. The effect
of GM-CSF was sensitive to protein synthesis inhibition, whereas
IL-4 was able to directly activate IRF4 gene expression. The protein synthesis-sensitive factor responsible for mediating GM-CSFinduced IRF-4 expression could be AP-1. Growth factors rapidly
up-regulate the expression of Fos and Jun, the constituents of
AP-1, and the IRF4 promoter region contains binding sites for
AP-1 (Ref. 45 and present study Fig. 2). In contrast, IL-4 may
mediate its direct IRF-4 gene activation functions via Stat6. Furthermore, in monocytes, the up-regulation of IRF4 expression was
transient, and constitutively high IRF4 mRNA and protein expression was seen only in cells committed to DC differentiation.
Analyses on the effects of cytokine stimulation on IRF4 gene
expression have been limited, and little is known of the factors
regulating its expression in myeloid cells. In human NK and T
cells, we have shown that IL-12 or IFN-␣ induce IRF4 expression,
and this occurs via Stat4 (39). IL-4 alone or in synergy with CD40
ligation up-regulates IRF4 expression B cells (23). In the present
report, we identified a new GAS element in the IRF4 promoter that
bound Stat6 in IL-4/GM-CSF-differentiated DCs. This Stat6-binding element may convey both constitutive and inducible IL-4 responsiveness to the promoter in different cell types. In 7-day fully
differentiated immature DCs, Stat6 binding to the Stat6/␬B site
was strong even though the last GM-CSF/IL-4 stimulus had been
given 2 days earlier. This kind of prolonged Stat6 DNA-binding
activity has been reported previously in murine B cells (57). Also,
Stat6 and NF-␬B are known to interact on Stat6/␬B DNA elements
resembling the IRF4 gene element in different cell types (58 – 60).
In addition to lymphocytes, Stat4 expression has been found in
human and mouse monocytic cells (61, 62). In human and murine
monocytes and DCs, IFN-␣ and IL-12 stimulation, respectively,
results in Stat4 activation (61, 62). In the present study, we demonstrate by DNA pull-down and ChIP assays that Stat4 binds to
IRF4 regulatory elements. However, we were unable to directly
detect phosphorylation of Stat4 in DCs, and IFN-␣ or IL-12 stimulation that also activate Stat4 did not further enhance IRF4
mRNA expression in DCs (data not shown). Previously, it has
been shown that some nonphosphorylated Stat1 and Stat3 is constitutively found in the nucleus in some cell lines and primary
human cells (63, 64). Stat4 could also reside in the nucleus in a
nonphosphorylated form. Interestingly, constitutive transcription
of LMP2 is supported by nonphosphorylated Stat1 together with
IRF1 (65). In this report, we provide evidence that Stat4, IRF4, and
PU.1 bind constitutively to specific DNA elements in the IRF4
promoter in DCs, pointing out a role for this protein complex in
basal IRF4 mRNA expression. It remains to be determined
whether interactions between IRFs and nonphosphorylated STAT
emerge as a common theme in regulating constitutive expression
of some genes.
We also found that IRF4 bound to the IRF4combi promoter
element in DCs but not in macrophages, suggesting the possibility
of a positive autoregulatory loop. IRF8 gene expression is also
positively regulated by its own gene product (66). We demonstrated IRF4 protein expression in 3- and 7-day DCs, but enhanced
IRF4 DNA-binding activity was seen only in 7-day DCs. IRF4
requires PU.1 for its interaction partner for binding to IRF/Ets sites
(67), and this interaction requires the PEST domain in PU.1 (68).
The 25-kDa PU.1 protein fragment detected in 3-day DCs had
DNA-binding capacity but was apparently unable to interact with
IRF4. Previously, it has been shown that molecular interactions
between the DNA-binding domains of PU.1 and IRF4 are not
strong enough to support stable complex formation (68 –70), accounting for the lack of interaction between these molecules in
3-day DCs. Alternatively, IRF4 protein may require some activation signals that are present in 7-day but not in 3-day DCs.
Functional NF-␬B binding sites were also identified in the IRF4
promoter, demonstrating both basal and TNF-␣-inducible NF-␬B
binding. NF-␬B p50 and p65 mRNA expression levels were lower
in macrophages than in DCs and the same difference applied for
constitutive NF-␬B DNA-binding activity. Similar results have
been obtained by others (71, 72). In addition, we found that the
basal RelB binding to IRF4 promoter Stat6/␬B element was strong
in DCs. In lymphoid cells, constitutively active RelB is known to
mediate basal transcription (73, 74). RelB is also essential for the
generation of myeloid DCs in the mouse (75). Constitutive expression and DNA-binding activity of RelB may be one of the factors
specifically regulating basal IRF4 expression in DCs. Inducible
expression of IRF4 mRNA and protein by TNF-␣ was weak, even
though NF-␬B p65 DNA binding was strongly induced. This suggests that basal NF-␬B activity in DCs is sufficient to enable efficient IRF4 gene expression together with STATs and possibly
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
and their binding was weakly enhanced by TNF-␣ stimulation
(Fig. 6A). To study the effects of TNF-␣ on IRF4 mRNA expression, we stimulated 7-day DCs with TNF-␣ for 3 or 6 h or left them
untreated. Northern blot analyses show that, although constitutive
expression of IRF4 and IRF8 mRNAs was clearly detectable in
DCs, their expression was also weakly induced by TNF-␣ stimulation (Fig. 6B). PU.1 expression was not significantly altered.
IRF4 protein was found to bind to the IRF4combi DNA element
in DCs (Fig. 4B). To analyze whether TNF-␣ stimulation also
enhanced DNA binding of IRF4, we prepared whole-cell extracts
for DNA affinity-binding studies from TNF-␣-treated (for 6 h)
7-day macrophages and DCs. We used IRF4combi and CD68 gene
IRF/Ets DNA elements to pull down the interacting proteins. The
IRF/Ets element from the CD68 gene is known to bind IRF4 together with PU.1 and served as a positive control (49). IRF4 was
found to bind to both CD68(IRF/Ets) and IRF4combi elements in
DCs, and its binding was weakly enhanced by TNF-␣ stimulation
(Fig. 6C). Constitutive PU.1 binding was detected in macrophages
and DCs, and its binding was not further increased by TNF-␣
stimulation. In DCs, a 25-kDa DNA-binding PU.1 protein fragment was also detected (Fig. 6C).
6577
6578
Acknowledgments
We thank Mari Aaltonen, Arja Reinikainen, Hanna Valtonen,
Teija Westerlund, and the Finnish DNA Microarray Centre at Turku Centre
for Biotechnology for skillful technical assistance.
Disclosures
The authors have no financial conflict of interest.
References
1. Mamane, Y., C. Heylbroeck, P. Genin, M. Algarte, M. J. Servant, C. LePage,
C. DeLuca, H. Kwon, R. Lin, and J. Hiscott. 1999. Interferon regulatory factors:
the next generation. Gene 237: 1–14.
2. Taniguchi, T., K. Ogasawara, A. Takaoka, and N. Tanaka. 2001. IRF family of
transcription factors as regulators of host defense. Annu. Rev. Immunol. 19:
623– 655.
3. Matsuyama, T., T. Kimura, M. Kitagawa, K. Pfeffer, T. Kawakami, N. Watanabe,
T. M. Kundig, R. Amakawa, K. Kishihara, A. Wakeham, et al. 1993. Targeted
disruption of IRF-1 or IRF-2 results in abnormal type I IFN gene induction and
aberrant lymphocyte development. Cell 75: 83–97.
4. Taki, S., T. Sato, K. Ogasawara, T. Fukuda, M. Sato, S. Hida, G. Suzuki,
M. Mitsuyama, E. H. Shin, S. Kojima, et al. 1997. Multistage regulation of
Th1-type immune responses by the transcription factor IRF-1. Immunity 6:
673– 679.
5. Lohoff, M., D. Ferrick, H. W. Mittrucker, G. S. Duncan, S. Bischof,
M. Rollinghoff, and T. W. Mak. 1997. Interferon regulatory factor-1 is required
for a T helper 1 immune response in vivo. Immunity 6: 681– 689.
6. Mittrücker, H.-W., T. Matsuyama, A. Grossman, T. M. Kündig, J. Potter,
A. Shahinian, A. Wakeham, B. Patterson, P. S. Ohashi, and T. W. Mak. 1997.
Requirement for the transcription factor LSIRF/IRF4 for mature B and T lymphocyte function. Science 275: 540 –543.
7. Lohoff, M., H. W. Mittrucker, S. Prechtl, S. Bischof, F. Sommer, S. Kock,
D. A. Ferrick, G. S. Duncan, A. Gessner, and T. W. Mak. 2002. Dysregulated T
helper cell differentiation in the absence of interferon regulatory factor 4. Proc.
Natl. Acad. Sci. USA 99: 11808 –11812.
8. Lu, R., and P. M. Pitha. 2001. Monocyte differentiation to macrophage requires
interferon regulatory factor 7. J. Biol. Chem. 276: 45491– 45496.
9. Tamura, T., T. Nagamura-Inoue, Z. Shmeltzer, T. Kuwata, and K. Ozato. 2000.
ICSBP directs bipotential myeloid progenitor cells to differentiate into mature
macrophages. Immunity 13: 155–165.
10. Holtschke, T., J. Lohler, Y. Kanno, T. Fehr, N. Giese, F. Rosenbauer, J. Lou,
K. P. Knobeloch, L. Gabriele, J. F. Waring, et al. 1996. Immunodeficiency and
chronic myelogenous leukemia-like syndrome in mice with a targeted mutation of
the ICSBP gene. Cell 87: 307–317.
11. Giese, N. A., L. Gabriele, T. M. Doherty, D. M. Klinman, L. Tadesse-Heath,
C. Contursi, S. L. Epstein, and H. C. Morse, 3rd. 1997. Interferon (IFN) consensus sequence-binding protein, a transcription factor of the IFN regulatory
factor family, regulates immune responses in vivo through control of interleukin
12 expression. J. Exp. Med. 186: 1535–1546.
12. Scharton-Kersten, T., C. Contursi, A. Masumi, A. Sher, and K. Ozato. 1997.
Interferon consensus sequence binding protein-deficient mice display impaired
resistance to intracellular infection due to a primary defect in interleukin 12 p40
induction. J. Exp. Med. 186: 1523–1534.
13. Salkowski, C. A., K. Kopydlowski, J. Blanco, M. J. Cody, R. McNally, and
S. N. Vogel. 1999. IL-12 is dysregulated in macrophages from IRF-1 and IRF-2
knockout mice. J. Immunol. 163: 1529 –1536.
14. Schiavoni, G., F. Mattei, P. Sestili, P. Borghi, M. Venditti, H. C. Morse, 3rd,
F. Belardelli, and L. Gabriele. 2002. ICSBP is essential for the development of
mouse type I interferon-producing cells and for the generation and activation of
CD8␣⫹ dendritic cells. J. Exp. Med. 196: 1415–1425.
15. Tsujimura, H., T. Tamura, and K. Ozato. 2003. Cutting edge: IFN consensus
sequence binding protein/IFN regulatory factor 8 drives the development of type
I IFN-producing plasmacytoid dendritic cells. J. Immunol. 170: 1131–1135.
16. Aliberti, J., O. Schulz, D. J. Pennington, H. Tsujimura, C. Reis e Sousa, K. Ozato,
and A. Sher. 2003. Essential role for ICSBP in the in vivo development of murine
CD8␣⫹ dendritic cells. Blood 101: 305–310.
17. Schiavoni, G., F. Mattei, P. Borghi, P. Sestili, M. Venditti, H. C. Morse, 3rd,
F. Belardelli, and L. Gabriele. 2004. ICSBP is critically involved in the normal
development and trafficking of Langerhans cells and dermal dendritic cells. Blood
103: 2221–2228.
18. Tamura, T., P. Tailor, K. Yamaoka, H. J. Kong, H. Tsujimura, J. J. O’Shea,
H. Singh, and K. Ozato. 2005. IFN regulatory factor-4 and -8 govern dendritic
cell subset development and their functional diversity. J. Immunol. 174:
2573–2581.
19. Gauzzi, M. C., C. Purificato, L. Conti, L. Adorini, F. Belardelli, and S. Gessani.
2005. IRF-4 expression in the human myeloid lineage: up-regulation during dendritic cell differentiation and inhibition by 1␣,25-dihydroxyvitamin D3. J. Leukocyte Biol. 77: 944 –947.
20. Tamura, T., and K. Ozato. 2002. ICSBP/IRF-8: Its regulatory roles in the development of myeloid cells. J. Interferon Cytokine Res. 22: 145–152.
21. Marecki, S., and M. J. Fenton. 2002. The role of IRF-4 in transcriptional regulation. J. Interferon Cytokine Res. 22: 121–133.
22. Eklund, E. A., A. Jalava, and R. Kakar. 1998. PU.1, interferon regulatory factor
1, and interferon consensus sequence-binding protein cooperate to increase
gp91phox expression. J. Biol. Chem. 273: 13957–13965.
23. Gupta, S., M. Jiang, A. Anthony, and A. B. Pernis. 1999. Lineage-specific modulation of interleukin 4 signaling by interferon regulatory factor 4. J. Exp. Med.
190: 1837–1848.
24. Hu, C. M., S. Y. Jang, J. C. Fanzo, and A. B. Pernis. 2002. Modulation of T cell
cytokine production by interferon regulatory factor-4. J. Biol. Chem. 277:
49238 – 49246.
25. Rengarajan, J., K. A. Mowen, K. D. McBride, E. D. Smith, H. Singh, and
L. H. Glimcher. 2002. Interferon regulatory factor 4 (IRF4) interacts with
NFATc2 to modulate interleukin 4 gene expression. J. Exp. Med. 195:
1003–1012.
26. Alter-Koltunoff, M., S. Ehrlich, N. Dror, A. Azriel, M. Eilers, H. Hauser,
H. Bowen, C. H. Barton, T. Tamura, K. Ozato, and B. Z. Levi. 2003. Nramp1mediated innate resistance to intraphagosomal pathogens is regulated by IRF-8,
PU.1, and Miz-1. J. Biol. Chem. 278: 44025– 44032.
27. Yamagata, T., J. Nishida, S. Tanaka, R. Sakai, K. Mitani, M. Yoshida,
T. Taniguchi, Y. Yazaki, and H. Hirai. 1996. A novel interferon regulatory factor
family transcription factor, ICSAT/Pip/LSIRF, that negatively regulates the activity of interferon-regulated genes. Mol. Cell. Biol. 16: 1283–1294.
28. Marecki, S., M. L. Atchison, and M. J. Fenton. 1999. Differential expression and
distinct functions of IFN regulatory factor 4 and IFN consensus sequence binding
protein in macrophages. J. Immunol. 163: 2713–2722.
29. Rosenbauer, F., J. F. Waring, J. Foerster, M. Wietstruk, D. Philipp, and I. Horak.
1999. Interferon consensus sequence binding protein and interferon regulatory
factor-4/Pip form a complex that represses the expression of the interferon-stimulated gene-15 in macrophages. Blood 94: 4274 – 4281.
30. Izaguirre, A., B. J. Barnes, S. Amrute, W. S. Yeow, N. Megjugorac, J. Dai,
D. Feng, E. Chung, P. M. Pitha, and P. Fitzgerald-Bocarsly. 2003. Comparative
analysis of IRF and IFN-␣ expression in human plasmacytoid and monocytederived dendritic cells. J. Leukocyte Biol. 74: 1125–1138.
31. Marecki, S., and M. J. Fenton. 2000. PU.1/interferon regulatory factor interactions: mechanisms of transcriptional regulation. Cell Biochem. Biophys. 33:
127–148.
32. Olson, M. C., E. W. Scott, A. A. Hack, G. H. Su, D. G. Tenen, H. Singh, and
M. C. Simon. 1995. PU.1 is not essential for early myeloid gene expression but
is required for terminal myeloid differentiation. Immunity 3: 703–714.
33. DeKoter, R. P., J. C. Walsh, and H. Singh. 1998. PU.1 regulates both cytokinedependent proliferation and differentiation of granulocyte/macrophage progenitors. EMBO J. 17: 4456 – 4468.
34. Veckman, V., M. Miettinen, J. Pirhonen, J. Siren, S. Matikainen, and I. Julkunen.
2004. Streptococcus pyogenes and Lactobacillus rhamnosus differentially induce
maturation and production of Th1-type cytokines and chemokines in human
monocyte-derived dendritic cells. J. Leukocyte Biol. 75: 764 –771.
35. Nikula, T., A. West, M. Katajamaa, T. Lönnberg, R. Sara, T. Aittokallio,
O. S. Nevalainen, and R. Lahesmaa. 2005. A human ImmunoChip cDNA microarray provides a comprehensive tool to study immune response. J. Immunol.
Methods 303: 122–134.
36. Kerr, M. K., and G. A. Churchill. 2001. Experimental design for gene expression
microarrays. Biostatistics 2: 183–201.
37. Lehtonen, A., S. Matikainen, and I. Julkunen. 1997. Interferons up-regulate
STAT1, STAT2, and IRF family transcription factor gene expression in human
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
IRF4 itself, and further stimulation of NF-␬B activity cannot significantly contribute to regulation of IRF4 gene expression. Interestingly, during DC and macrophage differentiation, we observed
a shift in the molecular mass of p50, which could e.g., be due to the
phosphorylation of the molecule. Phosphorylation of NF-␬B subunits controls the DNA-binding and gene regulatory activity of
NF-␬B homo- and heterodimers (76, 77). NF-␬B p50 homodimers
are associated with transcriptional repression (78, 79), and our
finding suggests differential regulation of constitutive p50 DNAbinding activity in monocytes compared with more differentiated
cells.
Recently, IRF4 and IRF8 were observed to be differentially expressed in DCs and regulate the development of different DC subsets in the mouse (18). IRF4 was linked to GM-CSF-induced in
vitro DC differentiation, whereas IRF8 was linked to Fms-like tyrosine kinase 3 ligand-mediated differentiation. In the present
study, we conducted a detailed analysis of IRF4 gene promoter
elements, revealing functional Stat6, NF-␬B, and, interestingly,
also IRF4-binding elements that were likely to regulate IRF4 expression in human DCs. Our results also demonstrated differences
in the expression and activity of several transcription factor systems, IRF, STAT, and NF-␬B, between human macrophages and
DCs. Expression of IRF4 was controlled by the concerted action of
several factors, some ubiquitous and some following tissue-specific expression patterns, pointing to a very prominent role for this
protein in DC functions.
REGULATION OF IRF4 GENE EXPRESSION IN DCs AND M␾
The Journal of Immunology
38.
39.
40.
41.
42.
43.
44.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58. Shen, C.-H., and J. Stavnezer. 1997. Interaction of Stat6 and NF-␬B: direct association and synergistic activation of interleukin-4-induced transcription. Mol.
Cell. Biol. 18: 3395–3404.
59. Tinnell, S. B., S. M. Jacobs-Helber, E. Sterneck, S. T. Sawyer, and D. H. Conrad.
1998. STAT6, NF-␬B and C/EBP in CD23 expression and IgE production. Int.
Immunol. 10: 1529 –1538.
60. Matsukura, S., C. Stellato, J. R. Plitt, C. Bickel, K. Miura, S. N. Georas,
V. Casolaro, and R. P. Schleimer. 1999. Activation of eotaxin gene transcription
by NF-␬B and STAT6 in human airway epithelial cells. J. Immunol. 163:
6876 – 6883.
61. Frucht, D. M., M. Aringer, J. Galon, C. Danning, M. Brown, S. Fan, M. Centola,
C.-Y. Wu, N. Yamada, H. El Gabalawy, and J. J. O’Shea. 2000. Stat4 is expressed in activated peripheral blood monocytes, dendritic cells, and macrophages at sites of Th1-mediated inflammation. J. Immunol. 164: 4659 – 4664.
62. Fukao, T., D. M. Frucht, G. Yap, M. Gadina, J. J. O’Shea, and S. Koyasu. 2001.
Inducible expression of Stat4 in dendritic cells and macrophages and its critical
role in innate and adaptive immune responses. J. Immunol. 166: 4446 – 4455.
63. Meyer, T., K. Gavenis, and U. Vinkemeier. 2002. Cell type-specific and tyrosine
phosphorylation-independent nuclear presence of STAT1 and STAT3. Exp. Cell
Res. 272: 45–55.
64. Melen, K., L. Kinnunen, and I. Julkunen. 2001. Arginine/lysine-rich structural
element is involved in interferon-induced nuclear import of STATs. J. Biol.
Chem. 276: 16447–16455.
65. Chatterjee-Kishore, M., K. L. Wright, J. P.-Y. Ting, and G. R. Stark. 2000. How
Stat1 mediates constitutive gene expression: a complex of unphosphorylated
Stat1 and IRF1 supports transcription of the LMP2 gene. EMBO J. 19:
4111– 4122.
66. Kantakamalakul, W., A. D. Politis, S. Marecki, T. Sullivan, K. Ozato,
M. J. Fenton, and S. N. Vogel. 1999. Regulation of IFN consensus sequence
binding protein expression in murine macrophages. J. Immunol. 162: 7417–7425.
67. Eisenbeis, C. F., H. Singh, and U. Storb. 1995. Pip, a novel IRF family member,
is a lymphoid-specific, PU.1-dependent transcriptional activator. Genes Dev. 9:
1377–1387.
68. Perkel, J. M., and M. L. Atchison. 1998. A two-step mechanism for recruitment
of Pip by PU.1. J. Immunol. 160: 241–252.
69. Brass, A. L., A. Q. Zhu, and H. Singh. 1999. Assembly requirements of PU.1-Pip
(IRF-4) activator complexes: inhibiting function in vivo using fused dimers.
EMBO J. 18: 977–991.
70. Meraro, D., S. Hashmueli, B. Koren, A. Azriel, A. Oumard, S. Kirchhoff,
H. Hauser, S. Nagulapalli, M. L. Atchison, and B.-Z. Levi. 1999. Protein-protein
and DNA-protein interactions affect the activity of lymphoid-specific IFN regulatory factors. J. Immunol. 163: 6468 – 6478.
71. Ammon, C., K. Mondal, R. Andreesen, and S. W. Krause. 2000. Differential
expression of the transcription factor NF-␬B during human mononuclear phagocyte differentiation to macrophages and dendritic cells. Biochem. Biophys. Res.
Commun. 268: 99 –105.
72. Neumann, M., H. Fries, C. Scheicher, P. Keikavoussi, A. Kolb-Maurer,
E. Brocker, E. Serfling, and E. Kampgen. 2000. Differential expression of Rel/
NF-␬B and octamer factors is a hallmark of the generation and maturation of
dendritic cells. Blood 95: 277–285.
73. Lernbecher, T., U. Muller, and T. Wirth. 1993. Distinct NF-␬B/Rel transcription
factors are responsible for tissue-specific and inducible gene activation. Nature
365: 767–770.
74. Lernbecher, T., B. Kistler, and T. Wirth. 1994. Two distinct mechanisms contribute to the constitutive activation of RelB in lymphoid cells. EMBO J. 13:
4060 – 4069.
75. Wu, L., A. D’Amico, K. D. Winkel, M. Suter, D. Lo, and K. Shortman. 1998.
RelB is essential for the development of myeloid-related CD8␣⫺ dendritic cells
but not of lymphoid-related CD8␣⫹ dendritic cells. Immunity 9: 839 – 847.
76. Li, Q., and I. M. Verma. 2002. NF-␬B regulation in the immune system. Nat. Rev.
Immunol. 2: 725–734.
77. Chen, L.-F., and W. C. Greene. 2004. Shaping the nuclear action of NF-␬B. Nat.
Rev. Mol. Cell Biol. 5: 392– 401.
78. Plaksin, D., P. A. Baeuerle, and L. Eisenbach. 1993. KBF1 (p50 NF-␬B homodimer) acts as a repressor of H-2Kb gene expression in metastatic tumor cells.
J. Exp. Med. 177: 1651–1662.
79. Ledebur, H. C., and T. P. Parks. 1995. Transcriptional regulation of the intercellular adhesion molecule-1 gene by inflammatory cytokines in human endothelial
cells: essential roles of a variant NF-␬B site and p65 homodimers. J. Biol. Chem.
270: 933–943.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
45.
peripheral blood mononuclear cells and macrophages. J. Immunol. 159:
794 – 803.
Rosen, R. L., K. D. Winestock, G. Chen, X. Liu, L. Henninghausen, and
D. S. Finbloom. 1996. Granulocyte-macrophage colony-stimulating factor preferentially activates the 94-kD STAT5A and an 80-kD STAT5A isoform in human
peripheral blood monocytes. Blood 88: 1206 –1214.
Lehtonen, A., R. Lund, R. Lahesmaa, I. Julkunen, T. Sareneva, and
S. Matikainen. 2003. IFN-␣ and IL-12 activate IFN regulatory factor 1 (IRF-1),
IRF-4, and IRF-8 gene expression in human NK and T cells. Cytokine 24: 81–90.
Andrews, N. C., and D. V. Faller. 1991. A rapid micropreparation technique for
extraction of DNA-binding proteins from limited numbers of mammalian cells.
Nucleic Acids Res. 19: 2499.
Matikainen, S., T. Ronni, M. Hurme, R. Pine, and I. Julkunen. 1996. Retinoic
acid activates interferon regulatory factor-1 gene expression in myeloid cells.
Blood 88: 114 –123.
Matsuyama, T., A. Grossman, H. W. Mittrucker, D. P. Siderovski, F. Kiefer,
T. Kawakami, C. D. Richardson, T. Taniguchi, S. K. Yoshinaga, and T. W. Mak.
1995. Molecular cloning of LSIRF, a lymphoid-specific member of the interferon
regulatory factor family that binds the interferon-stimulated response element
(ISRE). Nucleic Acids Res. 23: 2127–2136.
Grossman, A., H. W. Mittrucker, J. Nicholl, A. Suzuki, S. Chung, L. Antonio,
S. Suggs, G. R. Sutherland, D. P. Siderovski, and T. W. Mak. 1996. Cloning of
human lymphocyte-specific interferon regulatory factor (hLSIRF/hIRF4) and
mapping of the gene to 6p23–p25. Genomics 37: 229 –233.
Grumont, R. J., and S. Gerondakis. 2000. Rel induces interferon regulatory factor
4 (IRF-4) expression in lymphocytes: modulation of interferon-regulated gene
expression by rel/nuclear factor ␬B. J. Exp. Med. 191: 1281–1292.
Sharma, S., N. Grandvaux, Y. Mamane, P. Genin, N. Azimi, T. Waldmann, and
J. Hiscott. 2002. Regulation of IFN regulatory factor 4 expression in human T cell
leukemia virus-I-transformed T cells. J. Immunol. 169: 3120 –3130.
Quandt, K., K. Frech, H. Karas, E. Wingender, and T. Werner. 1995. MatInd and
MatInspector: new fast and versatile tools for detection of consensus matches in
nucleotide sequence data. Nucleic Acids Res. 23: 4878 – 4884.
Verdier, F., R. Rabionet, F. Gouilleux, C. Beisenherz-Huss, P. Varlet, O. Muller,
P. Mayeux, C. Lacombe, S. Gisselbrecht, and S. Chretien. 1998. A sequence of
the CIS gene promoter interacts preferentially with two associated STAT5A
dimers: a distinct biochemical difference between STAT5A and STAT5B. Mol.
Cell. Biol. 18: 5852–5860.
Lehtonen, A., S. Matikainen, M. Miettinen, and I. Julkunen. 2002. Granulocytemacrophage colony-stimulating factor (GM-CSF)-induced STAT5 activation and
target-gene expression during human monocyte/macrophage differentiation.
J. Leukocyte Biol. 71: 511–519.
O’Reilly, D., C. M. Quinn, T. El-Shanawany, S. Gordon, and D. R. Greaves.
2003. Multiple Ets factors and interferon regulatory factor-4 modulate CD68
expression in a cell type-specific manner. J. Biol. Chem. 278: 21909 –21919.
Granucci, F., C. Vizzardelli, N. Pavelka, S. Feau, M. Persico, E. Virzi,
M. Rescigno, G. Moro, and P. Ricciardi-Castagnoli. 2001. Inducible IL-2 production by dendritic cells revealed by global gene expression analysis. Nat. Immunol. 2: 882– 888.
Richards, J., F. Le Naour, S. Hanash, and L. Beretta. 2002. Integrated genomic
and proteomic analysis of signaling pathways in dendritic cell differentiation and
maturation. Ann. NY Acad. Sci. 975: 91–100.
Ahn, J. H., Y. Lee, C. Jeon, S. J. Lee, B. H. Lee, K. D. Choi, and Y. S. Bae. 2002.
Identification of the genes differentially expressed in human dendritic cell subsets
by cDNA subtraction and microarray analysis. Blood 100: 1742–1754.
Wells, C. A., T. Ravasi, R. Sultana, K. Yagi, P. Carninci, H. Bono, G. Faulkner,
Y. Okazaki, J. Quackenbush, D. A. Hume, and P. A. Lyons. 2003. Continued
discovery of transcriptional units expressed in cells of the mouse mononuclear
phagocyte lineage. Genome Res. 13: 1360 –1365.
Chaussabel, D., R. T. Semnani, M. A. McDowell, D. Sacks, A. Sher, and
T. B. Nutman. 2003. Unique gene expression profiles of human macrophages and
dendritic cells to phylogenetically distinct parasites. Blood 102: 672– 681.
Hacker, C., R. D. Kirsch, X. S. Ju, T. Hieronymus, T. C. Gust, C. Kuhl, T. Jorgas,
S. M. Kurz, S. Rose-John, Y. Yokota, and M. Zenke. 2003. Transcriptional profiling identifies Id2 function in dendritic cell development. Nat. Immunol. 4:
380 –386.
Grolleau, A., D. E. Misek, R. Kuick, S. Hanash, and J. J. Mule. 2003. Inducible
expression of macrophage receptor Marco by dendritic cells following phagocytic
uptake of dead cells uncovered by oligonucleotide arrays. J. Immunol. 171:
2879 –2888.
Andrews, R. P., M. B. Ericksen, C. M. Cunningham, M. O. Daines, and
G. K. Khurana Hershey. 2002. Analysis of the life cycle of Stat6: continuous
cycling of Stat6 is required for IL-4 signaling. J. Biol. Chem. 277: 36563–36569.
6579