Download Chemistry department/ Third class Bioche

Chemistry department/ Third class
Biochemistry/ Nucleic acids
Nucleic acids
Nucleic acids are biopolymers, or large biomolecules, essential to all known
forms of life. They are composed of monomers called nucleotides. The
main function of nucleic acids is store and transfer genetic information. They are
found in abundance in all living cells, where they function to create and encode
and then store information in the nucleus of every living cell of every life
form organism on earth. Nucleic acids were discovered in 1869, by Swiss
physician Friedrich Miescher. There are two types of nucleic acids:
deoxyribonucleic acid (known as DNA) and ribonucleic acid (known as RNA).
Nucleotides:
Nucleotides are organic molecules that serve as the monomer units for
forming the nucleic acid polymers DNA and RNA. Nucleotides are the building
blocks of nucleic acids. They are composed of three parts: a nitrogenous base,
a five-carbon sugar (pentose sugar) ribose or deoxyribose, and at least
one phosphate group. They are also known as phosphate nucleosides. The
molecule without the phosphate group is called a nucleoside. Therefore, a
nucleoside is a nitrogenous base and a 5-carbon sugar. Thus a nucleoside plus a
phosphate group yields a nucleotide.
Nucleotides have a number of roles. Most notably they are the monomers for
nucleic acid polymers. Nucleoside triphosphates, like ATP and GTP, are energy
carriers in metabolic pathways. Nucleotides are also components of some
important coenzymes, like FAD, NAD+ and Coenzyme A.
Chemistry department/ Third class
Biochemistry/ Nucleic acids
Nitrogenous bases and pentoses:
The nitrogenous bases are derivatives of two parent compounds, pyrimidine
and purine. The bases and pentoses of the common nucleotides are heterocyclic
compounds. The carbon and nitrogen atoms in the parent structures are
conventionally numbered to facilitate the naming and identification of the many
derivative compounds. In the pentoses of nucleotides and nucleosides (ribose or
deoxyribose) the carbon numbers are given a prime (') designation to distinguish
them from the numbered atoms of the nitrogenous bases. The term ribonucleotides
are used if the sugar is ribose or deoxyribonucleotides if the sugar is deoxyribose.
Nucleotides contain either a purine or a pyrimidine base, the nitrogenous
base molecule, also known as a nucleobase. The components of the bases are
either purines (adenine A and guanine G) or pyrimidines (cytosine C, thymine
T, and
uracil
U).
base cytosine occur
The
in
purine
both
bases adenine and guanine and
DNA
and
RNA,
while
the
pyrimidine
pyrimidine
bases thymine (in DNA) and uracil (in RNA) in just one. Adenine forms a base
pair with thymine with two hydrogen bonds, while guanine pairs with cytosine
with three hydrogen bonds.
Chemistry department/ Third class
Biochemistry/ Nucleic acids
Figure 1: Structural elements of three nucleotides, each in turn is attached to the nucleoside (in
yellow, blue, green) at center: 1st, the nucleotide termed as a nucleoside monophosphate
nucleotide is formed by adding a phosphate group (in red); 2nd, adding a second phosphate
group forms a nucleoside diphosphate nucleotide; 3rd, adding a third phosphate group results in
a nucleoside triphosphate nucleotide. The nitrogenous base (nucleobase) is indicated
by "Base" and "glycosidic bond" (sugar bond). All five primary bases the purines and
pyrimidines are sketched at right (in blue).
Table 1: Naming of nucleosides and nucleotides.
Base
Nucleoside
Nucleotide
Nucleic acid
Adenine
Thymine
Adenosine
Deoxyadenosine
Guanosine
Deoxyguanosine
Cytidine
Deoxycytidine
Deoxythymidine
Adenosine-5'-monophosphate
Deoxyadenosine-5'-monophosphate
Guanosine-5'-monophosphate
Deoxyguanosine-5'-monophosphate
Cytidine-5'-monophosphate
Deoxycytidine-5'-monophosphate
Deoxythymidine-5'-monophosphate
RNA
DNA
RNA
DNA
RNA
DNA
DNA
Uracil
Uridine
Uridine-5'-monophosphate
RNA
Guanine
Cytosine
Structure of DNA:
DNA is a poly deoxyribonucleotide that contains many ribonucleotides covalently
linked by 3' to 5' phosphodiester bonds. With the exception of a few viruses that
contain single-stranded DNA, DNA exists as a double-stranded molecule, in which
the two strands wind around each other, forming a double helix. Phosphodiester
Chemistry department/ Third class
Biochemistry/ Nucleic acids
bonds join the 5'-hydroxyl group of the deoxypentose of one nucleotide to the 3'hydroxyl group of the deoxypentose of an adjacent nucleotide through a phosphate
group (Figure 2). The resulting long, unbranched chain has polarity, with both a 5'end (the end with the free phosphate) and a 3'-end (the end with the free hydroxyl)
that is not attached to other nucleotides. The bases located along the resulting
deoxyribose-phosphate backbone are, by convention, always written in sequence
from the 5'-end of the chain to the 3'-end. For example, the sequence of bases in
the DNA shown in Figure 2 is read "thymine, adenine, cytosine, and guanine" (5'TACG-3'). Phosphodiester linkages between nucleotides (in DNA or RNA) can be
cleaved hydrolytically by chemicals, or hydrolyzed enzymatically by a family of
nucleases: deoxyribonucleases for DNA and ribonucleases for RNA.
Figure 2: A. DNA chain with the nucleotide sequence shown in 5' to 3' direction. A 3' to 5'
phosphodiester bond is shown highlighted in the blue box, and the deoxyribose-phosphate
backbone is shaded in yellow. B. The DNA chain written in a more stylized form, emphasizing
the ribose-phosphate backbone. C. A simpler representation of the nucleotide sequence. D. The
simplest representation, with the abbreviation for the bases written in the conventional 5' to 3'
direction.
Chemistry department/ Third class
Biochemistry/ Nucleic acids
DNA Double helix:
In the double helix of DNA, the two chains are coiled around a common axis
called the axis of symmetry. The chains are paired in an antiparallel manner, that
is, the 5'-end of one strand is paired with the 3'-end of the other strand (Figure 3).
In the DNA helix, the hydrophilic deoxyribose-phosphate backbone of each chain
is on the outside of the molecule, whereas the hydrophobic bases are stacked
inside. The overall structure resembles a twisted ladder. The spatial relationship
between the two strands in the helix creates.
The bases of one strand of DNA are paired with the bases of the second
strand, so that an adenine is always paired with a thymine and a cytosine is always
paired with a guanine. Therefore, one polynucleotide chain of the DNA double
helix is always the complement of the other. Given the sequence of bases on one
chain, the sequence of bases on the complementary chain can be determined
(Figure 4). The specific base pairing in DNA leads to Chargaff's Rules: in any
sample of double-stranded DNA, the amount of adenine equals the amount of
thymine, the amount of guanine equals the amount of cytosine, and the total
amount of purines equals the total amount of pyrimidines. The base pairs are held
together by hydrogen bonds: two between A and T and three between G and C
(Figure 4).These hydrogen bonds, plus the hydrophobic interactions between the
stacked bases, stabilize the structure of the double helix.
Example: A sample of DNA contains 20 % adenine on a molar basis. What the
percentage of the other bases present?
Melting temperature of DNA (Tm):
The two strands of the double helix separate when hydrogen bonds between
the paired bases are disrupted. Disruption can occur in the laboratory if the pH of
Chemistry department/ Third class
Biochemistry/ Nucleic acids
the DNA solution is altered so that the nucleotide bases ionize, or if the solution is
heated. When DNA is heated, the temperature at which one half of the helical
structure is lost is defined as the melting temperature (Tm). The loss of helical
structure in DNA is called denaturation. Because there are three hydrogen bonds
between G and C but only two between A and T, DNA that contains high
concentrations of A and T denatures at a lower temperature than G- and C-rich
DNA (Figure 4). Under appropriate conditions, complementary DNA strands can
reform the double helix by the process called renaturation (or reannealing).
Figure 4: Two complementary DNA sequences.
Figure 3: DNA double helix, illustrating some of its major structural features.
Chemistry department/ Third class
Biochemistry/ Nucleic acids
Ribonucleic acid (RNA):
RNA is assembled as a chain of nucleotides, but unlike DNA it is more often
found in nature as a single-strand folded onto itself, rather than a paired doublestrand. There are three types of RNA that includes messenger RNA (mRNA),
ribosomal RNAs (rRNAs) and transfer RNA or tRNA.
The chemical structure of RNA is very similar to that of DNA, but differs in
three main ways:
1. Unlike double-stranded DNA, RNA is a single-stranded molecule in many of its
biological roles and has a much shorter chain of nucleotides.
2. While DNA contains deoxyribose, RNA contains ribose (in deoxyribose there is
no hydroxyl group attached to the pentose ring in the 2' position). These
hydroxyl groups make RNA less stable than DNA because it is more prone
to hydrolysis.
3. The complementary base to adenine in DNA is thymine, whereas in RNA, it
is uracil, which is an unmethylated form of thymine.
The main job of RNA is to transfer the genetic code need for the creation of
proteins from the nucleus to the ribosome. This process prevents the DNA from
having to leave the nucleus. This keeps the DNA and genetic code protected from
damage. Without RNA, proteins could never be made. In fact, RNA is formed
from DNA by a process called transcription. RNA is central to protein synthesis,
where the messenger RNA (mRNA) carries information from DNA to ribosomes
(the sites of protein synthesis (translation) in the cell). The ribosomes are made
from proteins and ribosomal RNAs (rRNAs). These all come together and form a
complex that can read messenger RNAs and translate the information they carry
into proteins. This process requires the help of transfer RNA or tRNA. Transfer
RNA (tRNA) transfers a specific amino acid to a growing polypeptide chain at the
ribosomal site of protein synthesis during translation.
Chemistry department/ Third class
Biochemistry/ Nucleic acids
An example of transcription process:
One strand of DNA contains the following sequence reading from 5′- to 3′-:
TCGTCGACGATGATCATCGGCTACTCGA
This strand will form the following duplex:
5′-TCGTCGACGATGATCATCGGCTACTCGA-3'
3′-AGCAGCTGCTACTAGTAGCCGATGAGCT-5'
The sequence of bases in the mRNA transcribed from DNA written 5′- to 3′- is
5′-UCGAGUAGCCGAUGAUCAUCGUCGACGA-3'