Download Student

Integrated General
Biology
A Contextualized Approach
Active Learning Activities
FIRST EDITION
Jason E. Banks
Julianna L. Johns
Diane K. Vorbroker, PhD
Macromolecules: The Big Four
Active Learning Activities
Chapter 5 Macromolecules: The Big Four
Section 5.1 Carbohydrates = Carbon + Water
Directions for
the Student:
This lesson is designed for you to complete, on your own or in your study group. Use
your notes and follow along in the text, as you find necessary.
Objectives:
1. Describe the structure of carbohydrates and their role in plants and animals.
2. Explain what process forms carbohydrates.
3. Define "polymer" and give examples of carbohydrates that are polymers.
Imagine that you live on a houseboat with your family. The safety of your family depends upon the
proper maintenance and functioning of your houseboat.
1. What are some possible threats that could
damage your house?
Answers will vary; leaks, floating and sunken
debris, barges, other crafts
2. What will you need in order to maintain
proper functioning of the house?
Answers will vary: fuel, paint, water purifier, etc.
Look back at your list of possible threats to your house. Your list probably includes threats due to
weather like hurricanes or floods. Your list may also include threats due to microbes such as bacteria or
fungi that may break down some of the structure of the boat. Regardless of the threats you will face, it
is clear that there will be some maintenance required.
Look at your answer to the second question: What will you need in order to maintain proper functioning
of the house? Your list may include things like wood, fiberglass, nuts and bolts. These items fall under
the category of materials (MATTER), and these are the structural components of the houseboat. As parts
of the vessel wear out or become damaged, new materials must be acquired to maintain the structure.
Besides building materials, what else is required for maintaining a functioning vessel? Well, how will you
get the materials where they need to be? What will you need in order for screws to be screwed in? In
order to make things move you will need ENERGY. In order to get all of the materials in place you will
need either electricity as a power source for your tools or if you are using hand tools you will need
muscle power. Having materials is useless without the energy to put them in place.
There is one more requirement besides matter and energy. If we have all of the necessary materials and
a reliable source of energy that is still not enough. We must know how to arrange all the materials. We
must be able to use all of this matter and energy in an appropriate manner otherwise having energy and
matter will not be enough. To maintain the structure and function of out houseboat we need MATTER,
ENERGY, and ORGANIZATION.
When it comes to maintaining living things the same principle applies. In order for cells to maintain
proper function the structure of those cells must be maintained. Structure and function are intricately
Carbohydrates = Carbon + Water
2
Macromolecules: The Big Four
Active Learning Activities
related. Cells need a reliable source of matter (building blocks), a reliable source of energy, and a
method of organization. The rest of this section will focus on the roles of carbohydrates and how these
molecules fulfill some of the needs of living things. Examine the structure of the molecule shown below.
3. Which elements make up this
molecule?
Carbon, Oxygen, Hydrogen
4. What is the chemical formula for this
compound? (Count how many there
are of each element, and write the
symbol with its number subscript.)
C6H12O6
Notice that the carbon : hydrogen : oxygen ratio is one : two : one. This ratio is maintained in all
carbohydrates. In other words, all carbohydrates have equal parts carbon atoms and oxygen atoms and
twice that amount of hydrogen atoms. In fact, carbohydrate means carbon + water, or C and H2O.
Remembering this will help us remember the 1 : 2 : 1 ratio found in all carbohydrates.
But where do carbohydrates come from? How are they produced? Below is a diagram of the process of
photosynthesis. The process is shown in three different ways. In this process, plants use the energy from
sunlight to take small molecules of carbon dioxide and water, and rearrange the atoms to form glucose
(the most common carbohydrate) and oxygen gas.
Carbohydrates = Carbon + Water
3
Macromolecules: The Big Four
Active Learning Activities
5. Complete the following chart showing the total number of each type of atom.
Total number of atoms on the reactants side
Element
Left of the arrow
Right of the arrow
Carbon
6
6
Oxygen
18
18
Hydrogen
12
12
6. What do you notice about the amounts of
carbon, hydrogen and oxygen on each side of
the equation?
They are equal. There are the same number of
atoms entering the equation that exit.
This process is a rearrangement of atoms—the atoms are not created or destroyed, they are just
rearranged. This is called the conservation of matter. Chemical bonds break and new chemical bonds
form. But, in order to build larger molecules an energy source is required.
7. In the case of photosynthesis what energy
source is used to build this glucose molecule?
Photosynthesis uses sunlight as its energy source.
During this process of photosynthesis, some of the energy that is put in gets lost along the way. But
some is stored in the newly formed chemical bonds.
8. Looking at the product side of the reaction
Glucose
which molecule is storing some of that energy
from the sun?
Since it required energy to build glucose, glucose now has some energy stored in its chemical bonds.
Carbohydrates are energy-storing molecules. From here glucose can be used for a few different
purposes. Plants often string many glucose molecules together in a long chain to store energy. This very
large energy-storing molecule is known as starch. This energy can be accessed as needed by the plant.
But plants can also use carbohydrates to build their bodies (this is something animals cannot do). Plants
make cellulose (a polysaccharide) which is part of their cell wall (another thing animals do not have).
A picture of a starch molecule follows this paragraph. Note that in actuality, starch consists of many
more than three glucose molecules, as shown by the middle glucose having a "300-600" underneath it,
meaning that there would be 300 to 600 more glucose molecules as part of this starch chain.
Carbohydrates = Carbon + Water
4
Macromolecules: The Big Four
Active Learning Activities
Starch is an example of a polymer. Polymers are large molecules with repeating subunits.
9. What is the repeating subunit for starch?
glucose
Polymers that have sugar as the repeating subunit (monomer) are known as polysaccharides. Another
polysaccharide that has glucose as a monomer is cellulose. This is the main structural component of
plants. Although cellulose is indigestible to humans, getting enough cellulose (a form of fiber) in the diet
is important to maintaining a healthy digestive tract.
Although plants use carbohydrates for energy storage and as a main structural component, humans
primarily use carbohydrates as an immediate energy source. Glucose is broken down in a series of steps
to release energy. Examine the overall chemical equation for cellular respiration below.
C6H12O6 +
6O2
6CO2 +
6H2O + energy
Notice that energy is on the product side of the equation.
10. Which molecule did that energy come from?
The energy came from the chemical bonds of
glucose.
11. Where was the energy before it was in the
molecule from the previous question?
The Sun (light).
Humans and other animals string many molecules of glucose together to make energy storing molecules
known as glycogen. Glycogen is a polymer.
12. What is the monomer for glycogen?
glucose
Carbohydrates = Carbon + Water
5
Macromolecules: The Big Four
Active Learning Activities
Think back to the three broad categories that living things need to maintain their structure and function:
MATTER, ENERGY, and ORGANIZATION.
13. Carbohydrates assist in fulfilling which of
these three requirements in animals? (Pick 1)
Energy—animals only use carbohydrates as a
source of energy.
14. Carbohydrates assist in fulfilling which of
these three requirements in plants? (Pick 2)
Matter and Energy—plants use carbohydrates to
build their bodies and as a source of energy.
Carbohydrates = Carbon + Water
6
Macromolecules: The Big Four
Active Learning Activities
Section 5.2 Lipids—Don't Cut Out the Fat
Directions for
the Student:
This lesson is designed for you to complete, on your own or in your study group. Use
your notes and follow along in the text, as you find necessary.
Objectives:
1. Identify and describe the roles that lipids play in cells and organisms.
2. Compare and contrast the different types of macromolecules in terms of structure
and function.
Examine the two molecules below and answer the questions.
Molecule A
Molecule B
1. Which elements make up molecule A?
Carbon, Hydrogen, Oxygen
2. Which elements make up molecule B?
Carbon, Hydrogen, Oxygen
3. What is one difference you see between the
two molecules?
circular vs linear shape
4. Remembering that carbohydrates have equal
parts carbon and oxygen, which of the above
molecules is a carbohydrate?
Molecule A
The next set of molecules are examples of a lipids. Lipids have many important functions in the body and
of course the functions of these molecules are tied to their structures. Lipids come in a variety of shapes.
They do not, however, form polymers. Examine the following molecules.
Remember, there is a carbon atom wherever two lines meet. Organic molecules are carbon-based, with
many carbon atoms linked together. When scientists write these long chains of carbon, they don’t
usually like to write a “C” so many times, so they just write lines instead.
Scientists also don’t usually write all of the hydrogen atoms that are bonded to the carbons, but they are
still there.
Lipids—Don't Cut Out the Fat
7
Macromolecules: The Big Four
5. Although these molecules may have small
amounts of oxygen, phosphorus, or nitrogen,
which two elements make up the majority of
each lipid molecule?
Active Learning Activities
Carbon and hydrogen make up the majority of
lipid molecules.
6. Most of the bonds in these molecules are
Since these lipids are nonpolar, they would not like
nonpolar covalent bonds. Because of this,
being around the polar water molecule, and would
these compounds will not be attracted to
not mix with the water (they would separate).
polar molecules. How would you expect these
molecules to interact with water?
Lipids are hydrophobic molecules, meaning that they are water-fearing. Generally, lipids will not mix
with water. Remember that water forms hydrogen bonds with other polar molecules. Carbohydrates are
rich in polar oxygen-hydrogen bonds and will therefore form hydrogen bonds with water. Carbohydrates
are hydrophilic, or water-loving.
One type of lipid has unique characteristics that allow it to form the membrane of cells and various
other structures. Phospholipids are made of nonpolar hydrocarbon tails (shown in yellow below), and
these tails are attached to polar phosphate "heads" (shown in white below). Phospholipids have a part
that is water-loving and a part that is water-fearing! Because of these dual properties of the
phospholipid molecules, they can make a variety of shapes when in the presence of water.
7. Which side of the phospholipid would be
The phosphate head is water-loving.
attracted to water molecules—the phosphate
head or hydrocarbon tail?
8. Which side of the phospholipid would not be
attracted to lipids and other nonpolar
molecules?
The hydrocarbon tail is water-fearing.
Lipids—Don't Cut Out the Fat
8
Macromolecules: The Big Four
Active Learning Activities
Examine the structures below. There is an attraction between the phosphate heads and water
molecules. There is also an attraction between hydrocarbon tails of one phospholipid molecule and the
tails of neighboring phospholipid molecules. Since a phospholipid is attracted to both water and lipids,
they are said to be amphiphilic (both-loving).
Forming membranes is one of the functions of phospholipids. Membranes are crucial in separating the
inside of the cell from the outside world or for compartmentalizing different activities within the cell.
9. Look at the bilayer sheet. On the inside and outside of the bilayer (next to the
phosphate heads) would you expect to find water?
Yes, on both
sides
10. On the inside of the micelle shown above, would you expect to find water or
lipids?
Lipids
Animals store energy that can be drawn upon for the body’s use. Just as carbohydrates can be broken
down to release energy, lipids can be utilized in much the same way. Examine the carbohydrate and fat
molecules below:
Carbohydrates: 4 calories per gram
Fats: 9 calories per gram
Lipids—Don't Cut Out the Fat
9
Macromolecules: The Big Four
Active Learning Activities
Carbohydrates (starch) are the primary energy storage molecule in plants. Animals, including humans,
store most excess energy in the form of fat.
11. Looking at the number of calories each can
store, what benefit would animals get from
storing energy in fat instead of in
carbohydrate?
Animals move around and have to carry their
reserves. Lipids provide denser reserve of energy
per gram with 9 calories per gram, compared to
carbohydrates that have only 4 calories per gram.
(Hint: What do animals do that plants don’t?)
This is another lipid known as cholesterol. It consists primarily of carbon and hydrogen like the other
lipids. Cholesterol and other related molecules form ring-shaped structures while other lipids from
chains. Cholesterol is used in the cell membrane to help maintain the appropriate level of fluidity.
12. Cholesterol is a nonpolar molecule. Will
cholesterol bond with water?
No, cholesterol will not bond with water.
Other important functions of lipids are insulation and shock absorption. Lipids have a variety of
functions in the human body.
Think back to the three broad categories that living things need to maintain their structure and function;
MATTER, ENERGY, AND ORGANIZATION.
13. Lipids assist in fulfilling which of these three
requirements in humans? Explain this, citing
specific examples.
Lipids help with all three.
Matter: lipids play various roles as basic matter
for structure, function and energy
Energy: as a reservoir of potential calories
Organization: functions as major component of
cell membranes
Lipids function as matter because they have
multiple uses (e.g., cell membranes, hormones,
energy as storage molecules and organization in
cell membranes).
Lipids—Don't Cut Out the Fat
10
Macromolecules: The Big Four
Active Learning Activities
Section 5.3 Of the First Importance: Proteins
Directions for
the Student:
This lesson is designed for you to complete, on your own or in your study group. Use
your notes and follow along in the text, as you find necessary.
Objectives:
1. Describe the structure and function of proteins.
2. Compare and contrast proteins with the other major macromolecules.
Ask yourself the following question: of the two types of macromolecules that we have covered thus far,
carbohydrates and lipids, which form polymers?
A few polysaccharides that we have discussed in previous sections have a repeating pattern of glucose,
over and over again—this means that some carbohydrates are polymers. Lipids do not form polymers.
All proteins are polymers. Proteins are polymers of amino acids (this means that many amino acids link
together to form long chains). Examine the amino acid chart below. These amino acids are the building
blocks of proteins. The highlighted portion of each amino acid is known as the r group.
Some amino acids are polar, some are nonpolar. Some amino acids are basic, some are acidic. With
these twenty amino acids put together in chains that are thousands of amino acids long, it is possible to
make millions of combinations.
Of the First Importance: Proteins
11
Macromolecules: The Big Four
Active Learning Activities
1. Which amino acids will form hydrogen bonds
with water?
Polar amino acids will form hydrogen bonds with
water.
2. Which amino acids will attract lipids?
Nonpolar amino acids will attract lipids.
Since proteins can be made of so many different combinations of amino acids that it is possible for them
to make many different three-dimensional shapes. These long polymers of amino acid fold and twist
into various forms that can serve many different functions. Proteins can form many different structures
and are responsible for many reactions.
3. Since we know that the shape of molecules is closely tied to their function, try to guess the function
of the proteins in the following images.
PROTEIN
FUNCTION
Passageway—this looks like a tunnel,
passageway or gate
Carrying or holding—this looks like a
basket.
Tying—this looks like a rope that can tie
things together
Of the First Importance: Proteins
12
Macromolecules: The Big Four
Active Learning Activities
As you can see, proteins come in a variety of shapes and can carry out a variety of functions. Refer to
your textbook for a description of the variety of protein functions. In future biology classes, you will
learn in depth about the unique characteristics of specific proteins.
The chart below shows the breakdown of fats, carbohydrates and proteins. Examine the data and
answer the questions that follow.
Type of Food
Total Carbohydrates
(grams)
Total Cellulose
(grams)
Total Protein
(grams)
Total Fat
Broccoli
19.3
7.2
8.2
1.1
Rice
21.1
1.8
2.1
0.7
Black Beans
18.4
6.7
6.9
0.4
Salmon
0
0
16.2
3.5
Steak
0
0
18.4
2.6
Chicken
0
0
16.2
2.5
(100 Calories)
4. What do you notice about the amount of
carbohydrates in the plant material
compared to the animal material?
(grams)
Plants have substantial amount of carbohydrates.
Animal sources do not show any carbohydrates.
5. What do you notice about the amount of fat Plants have much lower amounts of fat. Animals
in the plant material compared to the animal have more fat than plants.
material?
6. What do you notice about the amount of
Plants have low levels of protein while animals have
protein in the plant material compared to the much more.
animal material?
7. What do you notice about the amount of
cellulose (fiber) in the plant material
compared to the animal material?
Plants have lots of fiber; animals have none.
Based on this data it is clear that compared to animals, plants are rich in carbohydrates and fiber and
lower in fats and protein. Animals store more of their energy in fat molecules because fat holds more
energy per gram than carbohydrate. The amount of energy per gram is important for animals because
that have to carry all of their stored energy around with them. Plants store more energy in carbohydrate
because they basically sit in the same spot all of their lives.
Remember the three basic requirements of living things are matter, energy and organization.
Of the First Importance: Proteins
13
Macromolecules: The Big Four
Active Learning Activities
8. Of the three major macromolecules we have Proteins are the major component of animals.
discussed so far (carbohydrates, lipids and
proteins), which makes up the largest portion
of animals?
9. Complete this sentence:
Monosaccharides are to polysaccharides as
________________ are to proteins.
amino acids
10. Which element is found in proteins, but is not nitrogen
found in carbohydrates?
Of the First Importance: Proteins
14
Macromolecules: The Big Four
Active Learning Activities
Section 5.4 Nucleic Acids, Nucleotides and the Energy Currency
Directions for
the Student:
Objectives:
This lesson is designed for you to complete, on your own or in your study group. Use
your notes and follow along in the text, as you find necessary.
1. Describe how nucleic acids are used in the body
2. Describe the structure and function of ATP
01011010100010101101000010111010100101101001010110100010001001110011101010101011101
01010100101101011110101000101000100100100100100100100101011011111011110110101000101
This string of ones and zeros is not very useful all by itself. This is a segment of computer code. All by
itself, computer code is just a string of ones and zeros but it contains information. Under the proper
conditions this stored information can translate into the variety of different computer programs that we
rely on.
Examine the code below.
AGTCTCGATAAGCTCTACTTCTCAGTCAGTCTCTAGAGATCATACATAGATCCTCGATCCTCGACTTAGGGATAGTC
GA
This length of code above represents the order of molecules that make up DNA. The order of these
molecules stores information. Computer code is binary (two part). The input is either 0 or 1.
1. How many possible inputs are there for the
genetic code?
There are four possible inputs: A, G, T, or C
Computer code stores information that can be used to generate computer programs, DNA stores
information that can be used to generate a wide variety of proteins. DNA is a polymer of nucleotides. A
nucleotide consists of three basic parts. The sugar (ring structure with hydroxyl groups), the phosphate
Nucleic Acids, Nucleotides and the Energy Currency
15
Macromolecules: The Big Four
Active Learning Activities
(phosphorus atom with attached oxygen and hydroxyl group), and nitrogenous base (ring structures
containing nitrogen) together make a nucleotide.
2. Circle and label these three parts of the nucleotide on the picture below.
For DNA, each nucleotide contains one of four possible nitrogenous bases. Using these four different
nitrogenous bases of DNA, each base is a single piece of information. In the English language, each letter
of the alphabet provides a piece of information that can be used to build a great variety of words and
sentences. Segments of nucleotides put together in different orders can code for a great variety of
proteins.
3. How is information stored in DNA?
Information is stored in the order of the bases.
DNA takes on a twisted ladder shape. Two long chains of nucleotides stick to each other because the
bases of one strand are attracted to the bases of the complementary strand. Certain bases always pair
up with their complementary base.
Nucleic Acids, Nucleotides and the Energy Currency
16
Macromolecules: The Big Four
Active Learning Activities
4. Provide the name of the nitrogenous base that corresponds to the given letter of the genetic code.
Letter of Genetic Code
Name of Nitrogenous Base
A
Adenine
G
Guanine
C
Cytosine
T
Thymine
Now let us compare a strand of RNA to DNA. RNA is similar to DNA but there are some important
differences.
5. Use the image above and your textbook to
identify 3 differences between DNA and RNA.
DNA – double strand, T instead of U, deoxyribose
6. What is the monomer for RNA?
A nucleotide, like DNA, but with ribose as its sugar
7. What would be different between the DNA
that codes for myosin (a protein used in
muscle contraction) and the DNA that codes
for insulin (a protein that functions as a
hormone)?
The differences are found in the sequence (order of
nitrogenous bases) and length of DNA strand.
RNA – single strand, U instead of T, ribose
Nucleic Acids, Nucleotides and the Energy Currency
17
Macromolecules: The Big Four
Active Learning Activities
Building RNA and DNA is not all that nucleotides are good for, however. It turns out that a certain
nucleotide can actually be used to power all kinds of work around the cell. This nucleotide is like money
that is accepted anywhere in the cell—it’s the energy currency of the cell!
This nucleotide specializes in transferring energy. It can exist in three different states, each
corresponding to a different amount of energy stored in the molecules. Remember that “mono-” means
one, “di-” means two, and “tri-” means three. AMP has only one phosphate group, ADP has two
phosphate groups, and ATP has three phosphate groups.
8. Remembering that energy is stored in
chemical bonds, which form has the most
energy stored: AMP, ADP, or ATP?
ATP has three phosphate molecules, and has the
more energy stored in it than ADP and AMP.
9. While ATP is the energy currency of the cell,
which macromolecule is the main source of
energy for cells?
Carbohydrates are the main source of energy for
cells.
The three basic requirements of living things are matter, energy and organization. As we have learned
thus far, living things are made of specific types of molecules. Living organisms must obtain certain types
of molecules in appropriate amounts. Essential amino acids, fatty acids, and vitamins are examples of
specific types of matter that are required for humans.
For humans, it is not enough to simply get enough of each element. The atoms of carbon, nitrogen,
hydrogen, phosphorous, etc. must be arranged in certain ways to be usable by the body.
Nucleic Acids, Nucleotides and the Energy Currency
18
Macromolecules: The Big Four
Active Learning Activities
Energy must also be in a usable form. Much in the way that some vending machines only accept money
in the form of quarters, the processes of the cell only accept energy in the form of ATP.
Quarters only!
ATP only!
This machine will not accept any paper money,
credit cards, personal checks, gift cards or foreign
currency—it will only accept quarters.
This protein pump in the cell membrane will not
accept any monosaccharides, polysaccharides, fats,
oils, or proteins—it will only accept ATP.
You may have a wallet full of $100 bills, but you will not get any candy from the vending machine unless
you first convert your money to quarters. In the same way, you may have huge amounts of energy
stored in oil and sugar molecules, but this sodium-potassium protein pump will not move any ions until
you have converted that energy into the proper form—ATP only!
Cellular respiration breaks apart glucose (C6H12O6) to release energy. The cell uses that energy to attach
the third phosphate onto ADP to make ATP (attaching a phosphate is called phosphorylation).
Cellular Respiration –
Phosphorylation –
C6H12O6 +
6O2

6CO2 +
6H2O + energy
ADP + one phosphate + energy

ATP
10. In cellular respiration, what molecule was the
energy released from?
The energy was released from the chemical bonds
of glucose.
11. How does the energy that comes out of
cellular respiration relate to what happens in
the phosphorylation?
The energy from cellular respiration is used to add the
third phosphate molecule onto ADP to make ATP.
12. What process builds up carbohydrates? Where Photosynthesis builds up carbohydrates using the
does the energy for that process come from? energy from the sun.
Nucleic Acids, Nucleotides and the Energy Currency
19
Macromolecules: The Big Four
Active Learning Activities
Section 5.5 Making Trains – Dehydration Synthesis and Hydrolysis
Directions for
the Student:
This lesson is designed for you to complete, on your own or in your study group. Use
your notes and follow along in the text, as you find necessary.
Objectives:
1. Identify examples of dehydration synthesis and hydrolysis.
2. Explain how dehydration synthesis and hydrolysis reactions occur, and how these
reactions build up and tear apart each of the four macromolecules.
3. Identify polymers and their monomers.
 Biomolecule worksheet
(with 6 amino acids, 6 nucleotides, 6 glucose molecules, 3 fatty acids and 1
glycerol)
 Scissors for each person
Materials
The four macromolecules weren’t always so large. Carbohydrates, lipids, proteins, and nucleic acids
have to be built up, and torn apart! It is a constant cycle, back and forth. But how does this happen?
The terms we use to describe these reactions are terms that you probably are already familiar with.
There is a special type of protein that helps reactions occur. It is like a meeting place for molecules to
come and react together, like a dating website.
1. What is the name of the special type of
protein that helps reactions occur?
Enzymes are special proteins that help reactions
occur.
Enzymes are special proteins that can act like catalysts, helping reactions occur without changing
themselves. Enzymes are necessary for the majority of reactions that occur in your body, and they help
the biomolecules grow and get torn apart. There are terms that describe when molecules are combined
to make new compounds and when molecules are torn apart.
2. What term describes when molecules are
combined to make a new compound?
Synthesis means to combine two things to make
something new.
3. What term describes when a cell or molecule
is torn apart?
Lysis means to split or tear apart.
When we combine two things to make something new, that is called synthesis. And when we split or
tear things apart, that is called lysis. (Please note: When used by itself, lysis refers to the splitting of a
cell—but we will be adding a prefix onto the beginning of lysis to make it a new word.)
To complete these terms that describe how we make and tear apart the four macromolecules, we need
one more piece. This final part of these terms has to do with water.
Making Trains – Dehydration Synthesis and Hydrolysis
20
Macromolecules: The Big Four
Active Learning Activities
4. What is the term we use when someone does
not have enough water?
Dehydration means that there is not enough
water.
5. What is the term we use to describe
something that has water?
We put the prefix “hydro-” onto words to mean
that they are associated with water.
We have all been thirsty before. But, by the time our bodies send that signal to us, we are already short
on our water supplies, or dehydrated. In this term, we can see a root word that means water. “Hydro-”
means water, and this makes sense when we remember that water is made of two hydrogen atoms and
one oxygen atom.
When we make the biomolecules (carbohydrates, lipids, proteins and nucleic acids), enzymes help two
smaller molecules bond to form a larger molecule, while removing a water—in other words, we take out
water to combine two smaller molecules, which is why we call this reaction dehydration synthesis
(sometimes this is simply referred to as a dehydration reaction, which is a type of condensation
reaction). Here’s an example:
Monosaccharide—OH
+
H—Monosaccharide

Disaccharide +
H2O
Normally, we wouldn’t highlight the “—OH” and the “—H” on the ends of the monosaccharides, but it
shows you how they hydroxyl functional group (the –OH) bonds with the hydrogen on the other
monosaccharide. And when two monosaccharides are bonded, we call it a disaccharide.
When we need to tear these larger molecules apart, we use enzymes (again), but this time we ADD
water. In other words, we use water to split apart a larger molecule into smaller molecules, which is why
we call this hydrolysis (sometimes this is called a hydration reaction). Here’s an example:
Disaccharide +
H2O

Monosaccharide—OH
+
H—Monosaccharide
Let’s try to model this with each of the macromolecules. We will start with proteins, which are made up
of amino acids. For the next sections, use the Materials Cutouts pages at the end of this section.
Making Proteins
Proteins are biomolecules consisting of one or more long chains of amino acids (they are polymers with
amino acids as their monomers). Proteins are responsible for a multitude of reactions in the human
body, and for much of its structure too. This is why they have a name that means “of the first
importance.”
1) Cut out the amino acids. Place two amino acids close to each other. Notice which hydroxyl
functional group (that’s part of the carboxyl functional group) on the left amino acid will bond with a
hydrogen on the amine group on the right amino acid.
Making Trains – Dehydration Synthesis and Hydrolysis
21
Macromolecules: The Big Four
Active Learning Activities
The general form of an amino acid has a central carbon atom with an amine group (—NH2), a
carboxyl functional group (—COOH) and an R group (that changes from amino acid to amino acid).
2) Cut off the hydroxyl functional group (the –OH) on the amino acid on the left, and cut off the
hydrogen off of the nitrogen on the amino acid on the right. Combine the -OH and the -H (set them
next to each other) to make H2O (water).
3) Link the two amino acids together by forming the peptide bond between them to make a dipeptide
(two amino acids linked with a peptide bond). Set the amino acids together and draw a line with a
pencil to show this bond, where appropriate. You just modeled a dehydration synthesis reaction.
4) Repeat this dehydration synthesis process until you have linked all 6 amino acids from the
worksheet together. You have now formed a polypeptide chain (poly- means many). A protein is
made up of one or more polypeptide chains. Because a protein is made up of a repeating subunit (a
bunch of amino acids), it is a polymer. Show your work to your instructor or your group, or check it
with a picture of a polypeptide chain.
5) Now, model hydrolysis by breaking the peptide bond, putting the –OH back on the left amino acid
and putting the –H on the amino acid on the right.
6) Repeat this until you have six, separate amino acids.
Making Nucleic Acids
There are two types of nucleic acids: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). While the
have the name “nucleic” acids, they are not always found in a nucleus. RNA can leave the nucleus of
eukaryotic cells. Prokaryotic cells (like bacteria and Archaea) don’t even have a nucleus, but they still
have DNA!
Making Trains – Dehydration Synthesis and Hydrolysis
22
Macromolecules: The Big Four
Active Learning Activities
Nucleic acids hold the genetic information (heredity) and have the instructions for how to make proteins
(which then make the body). Nucleic acids are polymers, with nucleotides as their monomers.
1) Cut out the six nucleotides. A nucleotide is made up of three parts: a five-carbon sugar (either ribose
or deoxyribose), a phosphate group, and a nitrogenous base. (Remember: carbon atoms are not
always written as a “C”, but sometimes are just where two lines meet.) Nucleotide example:
(Author: OpenStax)
6. What is the name of the sugar in these
nucleotide cutouts?
The sugar is deoxyribose.
(Compare the cutouts with these two choices.)
2) Identify the 3’ carbon (said “three prime”) on each of the cutout nucleotides. On each cutout, label
each carbon (5’, 4’, 3’, 2’, and 1’) on the five carbon sugar. (Remember: there is a carbon wherever
two lines meet, even if there is not a “C” written there.)
Making Trains – Dehydration Synthesis and Hydrolysis
23
Macromolecules: The Big Four
Active Learning Activities
3) Take the hydroxyl group (-OH) off of the 3’ carbon on the nucleotide on the left, and take the
hydrogen off of the phosphate group on the nucleotide on the right. Set the -OH and the -H next to
each other to make water.
4) Link the nucleotides together (set them next to each other and draw a line, if necessary) modeling
dehydration synthesis (a type of condensation reaction). You have now formed a phosphodiester
bond because two (that’s where the “di” part comes from) of the hydroxyl groups on the phosphate
group have reacted with hydroxyl groups on other molecules to form two ester bonds—in other
words, two oxygen atoms from the phosphate group are bonded with another molecule. These
phosphodiester bonds are necessary for the backbone of all nucleic acids!
5) Continue to link together nucleotides until you have all six linked together. Check this in with your
instructor, with your group, or with a picture in a book. Nucleic acids have repeating subunits of
nucleotides—this means that nucleic acids are polymers.
6) Now model hydrolysis and add the –OH and the –H back in the proper places, breaking apart the
nucleotides, until you have six separate nucleotides.
Making Complex Carbohydrates
Carbohydrates are the main source of energy for living things, and they can be simple or complex. You
may have heard of simple carbohydrates or simple sugars—these include monosaccharides (one-unit, or
single, sugars) and disaccharides (two-unit, or double, sugars). Complex carbohydrates are long chains
Making Trains – Dehydration Synthesis and Hydrolysis
24
Macromolecules: The Big Four
Active Learning Activities
of many units (usually hundreds) called polysaccharides (many sugars), which means polysaccharides
are polymers.
Monosaccharides include: glucose, fructose and galactose.
Disaccharides include: lactose, sucrose (table sugar) and maltose.
Lactose = glucose + galactose
Sucrose = glucose + fructose
Maltose = glucose + glucose
Polysaccharides include: starch, glycogen and cellulose.
Monosaccharides can be readily absorbed, but disaccharides and polysaccharides must be broken down
into monosaccharides first. (Did you notice the ending on the names of most of these sugars?)
1)
Cut out the six glucose molecules, and place two next to each other.
2) Cut off the hydroxyl group on the glucose on the left glucose, and cut off the hydrogen off of the
hydroxyl group on the glucose on the right. Place the –OH and the –H together to make water.
3) Link the oxygen from the glucose on the right to the now free carbon on the glucose on the left (set
them next to each other and draw a line, if necessary). This is the disaccharide maltose.
4) Continue linking glucose molecules together in this way (dehydration synthesis) until you have
linked all six together. Check your work with your instructor or with your group, or compare it with a
picture in a book. (Please note: Technically, this is an oligosaccharide because it has three to ten
monosaccharides. A polysaccharide will have more than ten simple sugars joined together.)
5) Now model hydrolysis and tear apart this six-unit sugar. Add the hydroxyl group and the hydrogen
atom back into the proper spot on each glucose molecule, until you have six separate glucose
molecules.
Making Trains – Dehydration Synthesis and Hydrolysis
25
Macromolecules: The Big Four
Active Learning Activities
Making Larger Lipids
Lipids make up the majority of cell membranes and serve as a molecule that can store energy. Lipids
include fats, waxes, vitamins A, D, E and K, triglycerides and phospholipids. Triglycerides are made of
three fatty acids and a glycerol molecule. Each of the fatty acids are attached to the glycerol molecule,
not each other. This means that the fatty acids are not a repeating subunit and, therefore, are not
polymers.
1) Triglycerides are the main part of body fat and they are present in the blood to help convert blood
sugar (glucose) to adipose tissue (fat), and vice versa. Cut out the three fatty acids and the glycerol.
(Remember that there are carbon atoms wherever two lines meet, even if there is no “C” written.)
2) Cut all three of the hydroxyl groups (--OH) off of the glycerol., and the hydrogen off of the fatty
acids. Put the –OH and the -H next to each other to make water.
3) Model a dehydration synthesis (a type of condensation reaction) by attaching the oxygens from the
fatty acids to the now free carbons on the glycerol. Check in with your instructor or group, or
compare your work to the picture here.
Triglycerides are one of the macromolecules (large molecules), but they are not polymers because
there are not any repeating subunits. Each fatty acid is attached to the glycerol, instead of to
another fatty acid. Think of polymers as trains, with many cars in a row. The fatty acids are not in a
row, and this is not a polymer.
4) Now model hydrolysis by attaching the hydroxyl groups (–OH) back onto the glycerol, and the
hydrogen (—H) back onto each fatty acid.
Making Trains – Dehydration Synthesis and Hydrolysis
26
Macromolecules: The Big Four
Active Learning Activities
Analysis
1. What is the name for a reaction that removes
water while linking molecules together?
Dehydration synthesis
2. What is the name for a reaction that adds
water to split apart molecules?
Hydrolysis
3. Which of the macromolecules are (or can
form) polymers? (There’s three of them.)
Carbohydrates, Proteins, and Nucleic Acids
4. Which of the macromolecules do not form
polymers? (There’s only one.)
Lipids
5. What is the name of the functional group that Hydroxyl Functional Group
is necessary for dehydration reactions to
occur?
6. Dehydration synthesis is part of a larger group Condensation reactions
of reactions. What are they called?
7. What are monosaccharides, disaccharides and Monosaccharides (single sugars), disaccharides (double
sugars) and polysaccharides (many sugars) are all
polysaccharides? Which one is a polymer?
carbohydrates. Polysaccharides are also polymers.
8. What is the monomer for nucleic acids?
Nucleotides
Making Trains – Dehydration Synthesis and Hydrolysis
27
Macromolecules: The Big Four
Active Learning Activities
Materials Cutouts
Six Amino Acids
Six Nucleotides
Making Trains – Dehydration Synthesis and Hydrolysis
28
Macromolecules: The Big Four
Active Learning Activities
Six Glucose Molecules
One Glycerol
Three Fatty Acids
Making Trains – Dehydration Synthesis and Hydrolysis
29
Macromolecules: The Big Four
Active Learning Activities
Section 5.6 Metabolize This
Directions for
the Student:
This lesson is designed for you to complete, on your own or in your study group. Use
your notes and follow along in the text, as you find necessary.
Objectives:
1. Define anabolism and catabolism and provide an example of each.
2. Explain the relationship between anabolism and catabolism.
3. Define metabolism.
We know that we are made out of materials that we receive from the environment around us. One of
the main ways that we gain materials is through eating. Every atom in your body was once in something
else.
1. Identify some of the processes that must occur Ingestion, digestion, absorption
in order for food material to become the
structure of a human.
2. What are examples of molecules that we gain
from food?
Carbohydrates, proteins, fats
You probably listed familiar molecules such as lipids, carbohydrates, proteins, etc. These are major
components of the foods that we eat.
3. Which of these macromolecules is the main
component of a human’s mass?
Of the all the macromolecules, proteins are the
most abundant.
While water makes up about half of a human’s body, proteins are the most abundant macromolecule.
4. Remembering that proteins are made of many The sequence and length of amino acids which
amino acids in a chain, what makes one type
determines the size and shape of the protein.
of protein different from another type?
Metabolize This
30
Macromolecules: The Big Four
Active Learning Activities
Proteins found in the food that we eat must be broken down into individual amino acids. In the body,
these amino acids are strung together in a different order to construct a new and different protein. This
process of breaking proteins down into their parts and then building something new is a bit like taking
apart a house and using the parts to build a boat.
5. Aside from all the amino acids necessary to
Energy is required to build a body (and a building
build a protein, what else is required to do the plan from DNA).
work of building a body?
Some of the materials in food are used as building blocks for the structure of the body. Other materials
found in food are not used for structural components, but are broken down in energy releasing
processes.
6. Photosynthesis builds up the energy-storing
Aerobic or cellular respiration breaks apart
molecules called carbohydrates. What process carbohydrates to release their stored energy.
breaks apart carbohydrates to release their
energy?
Any reaction in the body that breaks down large molecules and releases energy is an example of
catabolism. Cellular respiration is the classic example of a catabolic process since it breaks apart
carbohydrates to release their energy. Catabolism is absolutely crucial. The energy gained from
catabolism is needed for all the processes in the body that require energy. Muscle contraction, pumping
ions across membranes, and synthesizing proteins all require energy.
But tearing apart the molecules you ingest is only the first step. You must build up the molecules you
need from the building materials you eat—building up molecules is called anabolism.
Your body is mostly made up of proteins. And to make a protein, you must link amino acids together—
this process requires energy. Any time energy is used to build larger molecules would be an example of
anabolism. But what powers building these large molecules? Anabolic processes rely on energy released
by catabolism. Catabolism and anabolism work hand in hand, and, together, make metabolism.
Of course, the energy used in these anabolic reactions must be in a usable form. While carbohydrates
are the source of the energy, carbohydrates are not accepted forms of energy for cellular processes.
7. What is the name of a molecule that shuttles ATP is the energy currency for the cell and is used
energy around the cell and holds the energy in to power cellular processes.
a usable form (the energy currency of the
cell)?
Both anabolism and catabolism occur simultaneously in the body. Energy is extracted while breaking
apart large molecules in catabolism. Then, in anabolism, the energy and molecules are used for
reactions and the building of large molecules that the organism requires. The sum of all of these
reactions that are happening in the body is known as metabolism.
Metabolize This
31