* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Isolation and characterization of a functional promoter from
DNA sequencing wikipedia , lookup
DNA replication wikipedia , lookup
DNA profiling wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
DNA nanotechnology wikipedia , lookup
DNA polymerase wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
MICROBIOLOGY LETTERS ELSEVIER FEMS Microbiology Letters 137 (1996) 9-12 Isolation and characterization of a functional promoter from Nitrosomonas europaea Ali Nejidat *, Ornit Spector, Aharon Abeliovich Ben-Gut-ion University of the Negev, Environmental Microbiology, The Jacob Blaustein Institute for Desert Research, Sede-Boker Campus, 84990, Israel Received 14 November 1995; revised 14 December 1995; accepted 14 December 1995 Abstract A functional promoter from the obligate autotrophic ammonia oxidizing bacterium Nitrosonwnas europaea was identified by expression in Escherichia coli, using a promoterless reporter gene. Transcription initiation site of this promoter was determined by primer extension analysis. The sequences at -35 and - 10 have low similarity to the - lO/ - 35 consensus sequence of known prokaryotic promoters. Keywords: Nitrifying bacteria; Nitrosomonas europaea; Promoter 1. Introduction Ammonia oxidizing bacteria are obligate autotrophs which use 0, and ammonia as their sole natural energy source [l], thus playing a key role in the global nitrogen cycle. Nitrifiers reproduce very slowly and comprise only a nominal fraction of the viable cells within a given niche [ 1,2] due to their low rate of energy procurement [l]. Ammonia monooxygenase, which catalyzes the oxidation of ammonia to hydroxylamine, can transform many pollutant chemicals that may contaminate soils and aquifers [3,4]. This characteristic may facilitate the use of ammonia oxidizing bacteria in biore- * Corresponding (7) 565 835. author. Tel: +972 Federation of European Microbiological SSDZ 0378-1097(96)00011-0 (7) 565 765; Fax: Societies +972 analysis; Transcription initiation mediation of contaminated soils. Further exploitation of ammonia oxidizing bacteria for scientific as well as applied purposes requires genetic manipulation. This in turn depends on a transformation system which hitherto does not exist. Little is known, however, about tbe molecular genetics and gene regulation of the ammonia oxidizing bacteria. The promoter of the gene coding for the enzyme hydroxylamine oxidoreductase (HAO), which catalyzes the oxidation of hydroxylamine to nitrite, is the only Nitrosomonas europaea promoter so far analyzed [s]. This promoter has no typical - 10 or - 35 prokaryotic consensus sequence [51. Thus, it is possible that known prokaryotic promoters may not drive the expression of foreign genes in ammonia oxidizing bacteria. On the other hand, the RNA polymerase of Escherichia coli recognizes a diversity of promoters which do not have a typical - 10 and - 35 consensus sequence [6,7]. Thus, with IO A. Nyjidar rt rrl. / k’EMS Miuohiolo,q\ the ultimate goal of constructing a transformation system for the ammonia oxidizing bacteria, an attempt was made towards the isolation and characterization of a constitutive promoter from the ammonia oxidizing bacterium N. europueu by functional expression in E. co/i. The isolation, sequencing and analysis of such a promoter is described. 2. Materials 2. I. Promoter and methods isolation Genomic DNA from streptomycin-resistant (200 pg/ml) N. eurtjpaea ATCC 19718 was isolated as in [8]. BumHI-digested DNA was ligated to BamHI-digested pKk232-8 (Pharmacia Biotech.) plasmid vector, upstream of a promoterless chloramphenicol acetyltransferase gene. Recombinant plasmids were transformed into E. coli DH5a and 50 chloramphenicol resistant colonies were isolated. of which clone pKA16 was randomly chosen for characterization. E. coli bacteria harboring the recombinant plasmid pKA16 were able to grow on 100 pug/ml of chloramphenicol (maximum tested). Repeated transformations using the pKk-232 plasmid alone gave no chloramphenicol resistant colonies. The BumHI fragment in the clone pKA16 (about 1000 bp) was sequenced by the dideoxynucleotide chain termination method [9] using the Sequenase kit (USB, Cleveland, OH). RNA isolation and primer extension analysis were performed as described in B1. Lrrter.r 137 (IYY61 Y-l-7 3. Results and discussion 3.1. Clorle churucteri:ution Partial DNA sequence (304 bp) of the BumHI fragment in the pKA 16 clone is indicated in Fig. I. To confirm the origin of the DNA fragment and to rule out a possible major reorganization of the DNA fragment during the cloning process, the DNA fragment was amplified by PCR from genomic DNA isolated from an axenic N. europuea culture. Primers L and RI and primers L and R2 amplified only the expected DNA fragments, 765 and 470 bp respectively. from 1.0 ng of total genomic DNA of N. europaeu (Fig. 2). Based on DNA sequences of pKA16, the 470 bp fragment does not contain a restriction site for PstI while the 765 bp fragment contains two restriction sites which produce three DNA fragments of 491, 152 and 122 bp and the expected results were obtained (Fig. 2). These results support the co-linearity of the DNA fragment with the DNA of N. europaea. 3.2. Transcription initiation site After preliminary experiments, the transcription start site in the fragment cloned in pKA 16 was determined by primer extension analysis with an 18-mer oligonucleotide primer complementary to sequences spanning bp l88- 171, using total RNA isolated from N. europueu and E. coli (Fig. 3). In N. europuea the transcription initiation site is located at nucleotide 102 (Fig. 3). The transcript which starts 2.2. DNA umpl$ication Genomic DNA was isolated from an axenic culture of N. europaeu and polymerase chain reaction (PCR) amplification was carried out as previously described [lo] except that the annealing temperature was decreased to 50°C. A 17-mer primer, L (5’CGCTGAGTATTGAAAGC), located between bp 123 and 139, a l7-mer primer Rl (5’-GATTCCGTGTACCCAGG), complementary to the sequence spanning bp 887 and 871 and an internal 17-mer primer R2 (5’-GGTCATGGTTGGATAAG), complementary to the sequences located between bp 592 and 576 were used in the PCR reactions. ACGCCGGATAAACTGCGTGRGCCTGGGAAGCAGGGCAAACCGTATTCGG 50 TGAAAATTACCTGCAGGAAGGTCTGGTCAAAATCCGCGCACTGTCAGACC 100 * -35 -10 TGCCAATCGAATGGCATTTCATCGGTCCGAATTCAAAGCAACAAAACCAA 150 ACTGATTGCCGAGAATTTTTCCTGGGTACACGGAATCGATCGGGAAAAAA 200 TCGCAACCCGCCTTTCAGCAGCACGGCCGGAATCGTTACCACCGCTGCAA 250 GTCTGTGTGCAGGTAAATGTAAGTGGAGAAATCACCAAGATGTGGAGTGG 300 ATCC 350 Fig. I. Fig. I. Partial DNA sequence 304 (bp) of the Bu~uHl fragment in clone pKAl6. Transcription start site (in N. eurqxwu) is indicated by a star. The - 10 and -35 regions xe underlined. The DNA sequences have been submitted to the EMBL Data Library under accession number X834 18. A. Nejidat et al./ FEMS Microbiology Letters 137 (1996) 9-12 polymerase of both N. europaea and E. coli have recognized similar DNA sequences. Although this may be not true for other promoters, the results support the possibility of using E. coli to trap functional promoters from N. europaea. 2ooo 3.3. Sequence analysis 600 - Fig. 2. Ethidium bromide stained 1.4% agarose gel of PCRamplified DNA fragments from 1.0 ng of N. europaea DNA. Lane 1 is a 100 bp DNA ladder (GIBCO BRL). Lanes 2 and 3 are DNA products amplified by primers L-RI and L-R2 respectively. Lanes 4 and 5 are DNA products amplified by primers L-RI and L-R2 respectively, after PstI treatment. at nucleotide 106 (Fig. 2) could be a second start site, or the result of reverse transcriptase pausing due to formation of RNA secondary structures. However, several prokaryotic promoters initiate transcription at more than one site 17,111 and in some cases as a mechanism of gene regulation [12]. Primer extension analysis using the same oligonucleotide primer, and total RNA isolated from E. coli cells growing in LB broth containing 50 pg/ml chloramphenicol also showed two major transcripts which are shorter by one nucleotide only than those produced in N. europaea (Fig. 3). Thus, in this promoter the RNA 123456 A 11 C 0 f Two conserved hexamers upstream of the transcription start site, TTGACA (- 35 region) and TATAAT ( - 10 region) were identified by comparison of different prokaryotic promoters [7,11]. The - 10 and the - 35 hexamers in pKA16 promoter have four matches to the 12 consensus nucleotides, (Fig. 1). Such a low level of homology to the consensus sequence has also been shown in other E. coli promoters [ 111. Interestingly, an AT rich region at the - 19 position of this promoter also exists in the HA0 promoter [5] and in another N. europaea promoter which was analyzed in E. coli (data not shown). It is tempting to speculate that these sequences may have a role in transcriptional regulation in N. europaea. However, the analysis of more promoters and site-directed mutagenesis studies are necessary to establish the presence of regulatory elements in the promoters of ammonia-oxidizing bacteria. An attempt to fuse the pKA16 promoter to a reporter gene for the expression in N. europaea will be made. Acknowledgements We thank Prof. Y. Heimer and Mr. S. Barak for reading the manuscript. This work was supported by the Rashi Foundation and an Eshcol grant from the Israeli Ministry of Science and Technology to A.N. References Fig. 3. Localization of the transcription initiation site of the promoter at clone pKA16 by primer extension analysis. The same primer used for primer extension analysis was also used to produce the sequence depicted (lanes 1 through 4). Lanes 5 and 6 contain primer extension products using 40 pg of total RNA isolated from E. coli and N. europaea respectively. [l] Hooper, A.B. (1989) Biochemistry of the nitrifying lithoautotrophic bacteria. In: Autotrophic Bacteria (Schlegel, H.G. and Bowien, B., Bds.), pp. 239-265. Springer Verlag, Berlin. [2] Focht, D.D. and Verstraete, W. (1977) Biochemical ecology of nitrification and denitrification. In: Advances in Microbial Ecology Vol. 1. pp. 135-214. Plenum Press, New York and London. [3] Keener, W.K. and Arp, D.J. (1994) Kinetic studies of ammo- 12 [4] [5] [6] [7] A. Nejidat et 01. / FEMS Microbiology nia monooxygenase inhibition in Nifrosomonc~s ruropueu by hydrocarbons and halogenated hydrocarbons in an optimized whole-cell assay. Appl. Environ. Microbial. 60, 1914- 1920. Vannelli, T., Logan, M., Arciero, D.M. and Hooper. A.B. (1990) Degradation of halogenated aliphatic compounds by ammoniaoxidizing bacterium Nitrosomonas europura. Appl. Environ. Microbial. 56. I I69- I 17 I. Sayavedra-Soto, L.A., Hommes, N.G. and Arp, D.J. (1994) Characterization of the gene encoding hydroxylamine oxidoreductase in Nitrosomonus ruropcwi. J. Bacterial. 176. 504-5 10 McClure, W.R. (1985) Mechanism and control of tranacription initiation in prokaryotes. Ann. Rev. Biochem. 54, 171204. Harley, C.B. and Reynolds, R.P. (1987) Analyaia of E. co/i promoter sequences. Nucleic Acids Rea. 15. 2343-2360 Letters 137 (IY%/ Y-12 [8] Ausubel, F.M., Brent, R.. Kingston, R.E., Moore, D.D., Smith. J.A., Sideman, J.G. and Strul, K. (1987) Current Protocols in Molecular Biology. John Wiley And Sons Inc.. New York. [91 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467. [IO] Nejidat, A. and Abeliovich, A. (1994) Detection of Nitrosomonas spp. by polymerase chain reaction. FEMS Microbiol. Lett. 120, 191-194. [I II Lisser, S. and Margalit, H. (1993) Compilation of E. coli promoter sequences. Nucleic Acids Res. 2 I, 1507- I5 16. [I21 Wilson, H.R., Archer, CD., Liu, J. and Tumbough, C.L., Jr. (1992) Translational control of pyrC expression mediated by nucleotide-sensitive selection of transcriptional start sites in Evcherichia coli. J. Bacterial. 174, 514-524.