Download 6 Core Chapter 6

Chapter
6
DNA: The Molecule
of Life
Lecture Presentation
by Wendy Kuntz
© 2015 Pearson Education, Inc.
Chapter 6 DNA: The Molecule of Life:
Unit Hyperlinks
•
•
•
•
•
•
•
•
•
•
6.1 DNA intro
6.2 DNA replication
6.3 DNA directs the production of proteins
6.4 Flow from DNA to RNA to protein
6.5 Transcription
6.6 Translation part one
6.7 Translation part two
6.8 Gene expression regulation
6.9 Signal transduction
6.10 Mutations effects
© 2015 Pearson Education, Inc.
Chapter 6 DNA: The Molecule of Life:
Unit Hyperlinks
•
•
•
•
•
•
•
•
•
6.11 Cancer part one
6.12 Cancer part two
6.13 Genetic engineering
6.14 DNA manipulation
6.15 Genetically modification
6.16 PCR
6.17 DNA profiles
6.18 Genome mapping
6.19 Gene therapy
© 2015 Pearson Education, Inc.
6.1 Opening Questions: What molecule
holds the instructions for living things?
Do these organisms all share the same
genetic code? Explain.
Mushroom
Aquatic Algae
Caterpillar
Elephant
Protist
© 2015 Pearson Education, Inc.
Flower
Human
6.1 DNA is the molecule that holds the
instructions for all living things
• DNA is shorthand for
Deoxyribose Nucleic Acid
• A DNA molecule is a
double helix with two
strands made up of a long
string of nucleotides.
© 2015 Pearson Education, Inc.
6.1 Each nucleotide consists of a sugar,
a phosphate, and a base
Bases
© 2015 Pearson Education, Inc.
6.1 In a DNA molecule there are four bases
with specific pairing rules
• Adenine (A) can
only bond with
thymine (T).
• Guanine (G) can
only bond with
cytosine (C).
Each strand of DNA
in a double helix is
complementary.
© 2015 Pearson Education, Inc.
A-T
C-G
6.2 Opening Questions: Can you build a
DNA molecule?
• In a DNA double helix,
adenine (A) can only
bond with thymine (T)
and guanine (G) can
only bond with
cytosine (C).
• Given a half strand of
DNA, build the other
strand.
© 2015 Pearson Education, Inc.
A • ?T
T • ?A
C•?
G
A • ?T
C•?
G
G•C
?
C•?
G
6.2 What makes DNA a great molecule for
hereditary information?
• DNA strands are complementary!
– If you know ½ of the molecule, you can build
the other.
• To replicate, the DNA molecule unzips.
• Each strand serves as a template to build
a new strand following the base-pairing
rules.
Genetic instructions are passed
down via DNA replication.
© 2015 Pearson Education, Inc.
6.2 During DNA replication a cell duplicates
its chromosomes
• New DNA molecules
are made up of one
of the original
parental strands
plus a new half.
• As a result, DNA
replication is called
semi-conservative.
© 2015 Pearson Education, Inc.
6.3 Opening Questions: True or false?
• True or false. DNA codes for all the information
needed to make up an organism uses only four
building blocks (A,T,C,G).
• True or false. All the DNA molecules in your body
put end to end would reach from the Earth to the Sun
and back over 600 times.
• True or false. Typing 60 words per minute, eight
hours a day, it would take about 50 years to type the
human genome.
• True or false. Humans and bananas share about
50% common DNA.
All true!
© 2015 Pearson Education, Inc.
6.3 DNA directs the production of proteins
via an intermediate molecule of RNA
• RNA is also a nucleic acid (like DNA):
Ribonucleic Acid
• RNA has three major differences:
1. Single-stranded (not a helix)
2. Sugar in RNA is ribose
3. Thymine (T) is replaced by
uracil (U)
© 2015 Pearson Education, Inc.
6.3 DNA holds information on how to
produce proteins
• DNA is able to act as the
molecule of heredity because
it can direct the production of
proteins.
• DNA first directs the
production of RNA, which in
turn controls the manufacture
of proteins.
• Proteins then perform the
majority of cellular functions
and control physical traits.
© 2015 Pearson Education, Inc.
DNA
RNA
Proteins
6.3 The flow of genetic information
© 2015 Pearson Education, Inc.
6.4 Opening Questions: How does DNA
make brown eyes?
• What color are your eyes?
• What color are your neighbor’s eyes?
• How might your DNA instructions for eye
color vary from your neighbor’s?
• How are the instructions in DNA turned
into the physical pigment in your eye?
© 2015 Pearson Education, Inc.
6.4 Genetic information flows from DNA to
RNA to protein in two steps
© 2015 Pearson Education, Inc.
6.4 Transcription rewrites the DNA code
into RNA, which then leaves the nucleus
• Transcription follows
the DNA base-pairing
rules with one
exception:
– Uracil (U) is used
instead of thymine (T).
• The molecule that
results from transcription
is called messenger RNA (mRNA).
© 2015 Pearson Education, Inc.
6.4 In translation, the RNA molecule serves
as instructions for making a protein
• At the ribosomes in the cytoplasm, each
mRNA codon is translated into an amino
acid to build a protein.
© 2015 Pearson Education, Inc.
6.5 Opening Questions: What is a gene?
• How would you define a gene?
• Write your answer down and then share it
with your neighbor.
• Are your answers the same?
© 2015 Pearson Education, Inc.
6.5 Transcription creates a molecule of RNA
from a molecule of DNA
• During transcription,
the DNA double
helix separates.
• One strand of DNA
is used to generate
a molecule of RNA.
• The RNA is processed to become
messenger RNA, which then exits the
nucleus via a nuclear pore.
© 2015 Pearson Education, Inc.
6.5 Review Question: What is a gene?
• There is no simple, agreed-upon definition
that accurately describes all known genes.
– Is it a stretch of DNA?
– Does it produce a protein?
– What if a protein is made from two different
genes?
• As we study the genome, it actually becomes
harder to find one definition.
• For now, we can define a gene as a discrete
unit of hereditary information consisting of a
specific nucleotide sequence in DNA.
© 2015 Pearson Education, Inc.
6.6 Opening Questions: DNA and you
• Would you get a personal DNA test if you
could? Why or why not?
• Would you get a personal DNA test before
you had a baby? Why or why not?
• Should we run personal DNA tests on
newborn babies? Why or why not?
© 2015 Pearson Education, Inc.
6.6 Translation involves the coordination
of three kinds of RNA
• Translation is done
in the cytoplasm by
ribosomes.
• Ribosomes are
made from rRNA
and protein.
• Ribosomes read mRNA and use tRNA to
produce a string of amino acids.
© 2015 Pearson Education, Inc.
6.6 The genetic code uses triplets
• “Language” of nucleotides is in three-letter
codons.
• Each mRNA codon matches one of 20
amino acids.
• One end of a transfer
RNA (tRNA) holds an
amino acid.
• At the other end is an
anticodon that matches
up with the mRNA.
© 2015 Pearson Education, Inc.
6.6 The genetic code:
© 2015 Pearson Education, Inc.
6.7 Opening Questions: Can you translate
the genetic code?
• What amino acid would be produced from
an mRNA with the sequence:
AUG-ACU-AAA-GAG-UCA-UAA
Hint: Use your genetic code table!
Met-Thr-Asn-Glu-Ser
© 2015 Pearson Education, Inc.
6.7 Translation creates a molecule of
protein via the genetic code
• Translation is divided
into three phases:
– Initiation
– Elongation
• Translation begins when two subunits of a
ribosome assemble on an mRNA.
• A transfer RNA (tRNA) then brings in
amino acids that match the codon in the
mRNA.
© 2015 Pearson Education, Inc.
6.7 Translation results in a polypeptide
• Elongation continues until
the ribosome reaches a
stop codon on the
mRNA.
• The ribosome machinery
then disassembles.
• The completed
polypeptide is now
available to be used or
modified by the cell into a
functioning protein.
© 2015 Pearson Education, Inc.
Polypeptide
Amino acid
6.8 Opening Questions: Are you your
genes?
• We are a product of both our genes and
our environment.
• What are ways your physical or behavioral
traits might be influenced by your genes,
your environment, or both?
© 2015 Pearson Education, Inc.
6.8 Gene expression, the production of
proteins, is regulated in several ways
• Gene regulation is the process of turning
genes on and off.
• Different cell types express different
genes.
– For example, not all cells need lactase
(enzyme that digests milk).
In what cell types would you expect
lactase gene expression?
© 2015 Pearson Education, Inc.
6.8 X-chromosome inactivation is an
extreme case of gene regulation
• In female mammals one X chromosome in
each body cell is highly compacted and
almost entirely inactive.
© 2015 Pearson Education, Inc.
6.8 There are several points along the path
from DNA to protein that can be regulated
1. Special transcription factors must bind
to DNA to “turn on” transcription.
© 2015 Pearson Education, Inc.
6.8 After transcription, the RNA may be
altered in several ways
2. Before leaving the nucleus, the RNA is
modified:
– A cap and tail are added.
– Non-coding introns may be removed.
– Protein-coding exons may be rearranged.
© 2015 Pearson Education, Inc.
6.8 Translation offers more opportunities for
gene regulation
3. The cell can control the
following:
– Whether translation
proceeds
– How proteins are modified
after translation
– When proteins are broken
down
© 2015 Pearson Education, Inc.
6.9 Opening Questions: Are all your cells
the same?
• All the cells in your body contain the same
DNA. But do all the cells make the same
proteins?
• How might the following cell types differ in
the functions of proteins produced? How
might they be similar?
– Liver cell
– Brain cell
– Stomach cell
© 2015 Pearson Education, Inc.
6.9 Cell-to-cell communication can control
gene expression
• Multicellular life depends on
cell-to-cell signaling.
• Molecules exit one cell and
bind to a receptor protein on
the outside of another cell.
• This binding triggers a
signal transduction
pathway.
© 2015 Pearson Education, Inc.
6.9 A signal from another cell can regulate
genes (turn on or off) in the receiving cell
• signal
transduction
pathways
• Cells can regulate
other cells by
turning genes on or
off in the target cell
• Cells communicate
with each other
either directly or by
sending molecules
through the blood
© 2015 Pearson Education, Inc.
6.9 A signal from another cell can regulate
genes (turn on or off) in the receiving cell
© 2015 Pearson Education, Inc.
6.9 Cell-to-cell communication is
particularly important in a developing
embryo
• Development involves frequent cell
division (to increase body size) that must
be carefully coordinated.
© 2015 Pearson Education, Inc.
6.9 Cell-to-cell communication is
particularly important in a developing
embryo
• Inductive signals can cause cells to
change shape, migrate, or even destroy
other cells.
© 2015 Pearson Education, Inc.
6.9 Cell-to-cell communication is
particularly important in a developing
embryo
• Homeotic genes are master control
genes; they direct the location of the head
and body parts.
© 2015 Pearson Education, Inc.
6.10 Opening Questions: What difference
does a letter make?
• We only will make sentences with three-letter words
(triplet). Start with the sentence:
THE CAT ATE THE RAT
• Change one letter (R to H):
THE CAT ATE THE HAT
• Delete letter C and move everything over:
THE ATA TET HER AT
• Add a letter B in the sixth letter place:
THE CAB TAT ETH ERA T
What happens to the meaning of each sentence?
© 2015 Pearson Education, Inc.
6.10 A mutation is any change in the
nucleotide sequence of DNA
• Replacing, deleting, or adding a nucleotide
base can have a wide range of effects.
• Mutations are the raw material of evolution
by natural selection.
• However, most mutations are harmful.
What might happen to the protein
product if there is a change in the
nucleotide sequence?
© 2015 Pearson Education, Inc.
6.10 Mutations in DNA can change the
protein produced
• Mutations can be:
– Point mutations
– Frame shift mutations
– Spontaneous
– Induced by mutagens
• High-energy radiation
• Chemicals
© 2015 Pearson Education, Inc.
6.10 Point mutations occur at a single
nucleotide
No mutation:
DNA
ACA
RNA
UGU
Amino Acid
CYSTEINE
Silent mutation:
ACG
UGC
CYSTEINE
Missense:
TCA
AGU
SERINE
Nonsense:
ACT
UGA
STOP
Point mutations can have varying effects.
© 2015 Pearson Education, Inc.
6.10 Frameshift mutations are due to the
addition or deletion of a nucleotide
Added A
Frameshift mutations often result in different
or defective proteins.
© 2015 Pearson Education, Inc.
6.11 Opening Questions: What do you
know about cancer?
• List three things you know about cancer.
• List something you want to know about
cancer.
© 2015 Pearson Education, Inc.
6.11 Loss of gene expression control can
result in cancer
• Mutations can lead to a mass of body cells
growing out of control, a tumor.
• If a tumor spreads to other tissues, the
person is said to have cancer.
© 2015 Pearson Education, Inc.
6.11 Genes regulate the cell cycle
• A cell cycle control system regulates
the timing of cell duplication.
• A proto-oncogene codes for proteins
that tell the cell when to duplicate.
GO
© 2015 Pearson Education, Inc.
STOP
6.11 Mutations in regulator genes can lead
to an overgrowth of cells
• A mutated proto-oncogene fails to regulate
cell division and is called an oncogene.
?
?
Cancer is caused by out-of-control cell growth due
to a breakdown of the cell cycle control system.
© 2015 Pearson Education, Inc.
6.11 Cancer can occur when protooncogenes are mutated to oncogenes
• A mutation in a growth factor
gene can produce a hyperactive
protein that promotes
unnecessary cell division.
• A mutation that deactivates a
tumor suppressor gene may
result in uncontrolled growth.
GO!
X
STOP
Mutations may result in proteins that either
don’t stop the cell cycle or stimulate growth.
© 2015 Pearson Education, Inc.
6.12 Opening Questions: What is cancer?
• Imagine your cousin texted you that your
aunt has just been diagnosed with cancer.
Your cousin knows you are taking a
biology course, so she asks, “What is
cancer?”
• Send a text explaining how we define
cancer.
© 2015 Pearson Education, Inc.
6.12 Cancer is caused by out-of-control cell
growth
• Cancer begins
within a single
cell when
proto-oncogenes
mutate into
oncogenes.
© 2015 Pearson Education, Inc.
6.12 A tumor is an abnormally growing
mass of body cells
• The spread of cancer cells in the body is
called metastasis.
A benign
tumor
A malignant
tumor
- No spreading
- Spreading
© 2015 Pearson Education, Inc.
6.12 There are several ways to treat cancer
Surgery can
remove a tumor.
Radiation can
disrupt cell
division locally.
What might happen to your
normally dividing cells?
© 2015 Pearson Education, Inc.
Chemotherapy
drugs can
disrupt cell
division
throughout the
body.
6.12 There are ways to reduce cancer risk
Healthy diet
Exercise
Regular
screenings
Not
smoking
Sun
protection
© 2015 Pearson Education, Inc.
6.13 Opening Questions: True or false?
• True or false. You can pay to save a sample of your
dog’s or cat’s DNA for future cloning.
• True or false. Condo associations can use DNA to
identify the proper owner of a poop sample.
• True or false. Some of us are carrying Neanderthal
DNA.
• True or false. The U.S. Supreme Court has ruled
police can take DNA upon arrest.
• True or false. DNA-based computers may one day
hold more data than our fastest server today.
All true!
© 2015 Pearson Education, Inc.
6.13 Genetic engineering involves
manipulating DNA for practical purposes
Biotechnology
is the manipulation
of organisms or
their components
to make useful
products.
© 2015 Pearson Education, Inc.
DNA technology
is a set of methods
for studying and
manipulating
genetic material.
Genetic
engineering
is the direct
manipulation of
genes for practical
purposes.
Making Humulin
– In 1982, the world’s first
genetically engineered
pharmaceutical product was
produced.
• Humulin, human insulin, was
produced by genetically
modified bacteria.
• is used today by more than 4
million people with diabetes.
– Today, Humulin is
continuously produced in
gigantic fermentation vats
filled with a liquid culture of
bacteria
© 2015 Pearson Education, Inc.
6.13 Gene cloning is an example of genetic
engineering
• How can we produce
large quantities of a
protein (such as
human insulin)?
• We can insert DNA
into bacteria and
have them do the
work.
© 2015 Pearson Education, Inc.
PLASMID
A small circular DNA molecule
that replicates separately from
the much larger bacterial
chromosome. (The plasmid
is not drawn to scale here.)
6.13 Cutting and pasting DNA is an
important step in genetic engineering
• Restriction enzymes
are proteins that
cut DNA at specific
nucleotide sequences.
• The resulting fragments
are called restriction
fragments.
© 2015 Pearson Education, Inc.
6.14 Opening Questions: Who owns genes?
Part 1
Real-World Case Study: In the 1990s a
private company discovered a set of
genes that increase the risk of getting
breast and ovarian cancers (BRCA1 and
BRCA2). They applied for and received a
patent for the genes, which means they
are the only company that can offer a
genetic test for the BRCA1 and BRCA2
genes, earning the company over $400
million in 2012.
In June 2013 the U.S. Supreme Court took up
the issue.
© 2015 Pearson Education, Inc.
6.14 Opening Questions: Who owns genes?
Part 2
• The company president says they have
invested more than $500 million to study and
isolate the BRCA genes.
• Opponents say genes are made by nature and
can’t be patented.
• Doctors and patients say they should be able to
access tests at a reasonable cost in order to
prescribe relevant treatments.
What do you think? Should a private company
be able to patent a gene?
Present your arguments.
© 2015 Pearson Education, Inc.
6.14 DNA may be manipulated many ways
within the laboratory
• Scientists can now answer questions and
solve problems by manipulating DNA.
• Let’s explore some
of the tools in the
genetic engineering
toolbox.
© 2015 Pearson Education, Inc.
6.14 DNA can be isolated from a cell and
put into a genomic library
• A genomic library is a
collection of cloned
DNA fragments that
includes an organism’s
entire genome.
• Once created, a
genomic library can be
used to hunt for and
manipulate any gene
from the starting
organism.
© 2015 Pearson Education, Inc.
This collection of bacteria
constitutes a genomic
library that can be used
for later experiments.
6.14 DNA can be visualized using nucleic
acid probes
• In order to find a
gene of interest a
researcher can use
a nucleic acid
probe.
• A complementary
molecule made
using radioactive or
fluorescent building
blocks will bind with
DNA.
© 2015 Pearson Education, Inc.
6.14 DNA can be synthesized from scratch
• An automated DNA synthesizer machine
can quickly and accurately produce
customized DNA molecules up to lengths
of a few hundred nucleotides.
© 2015 Pearson Education, Inc.
6.14 DNA produced from a cell’s mRNA
• Reverse transcriptase can synthesize
DNA from the mRNAs within the cell.
• The result is complementary DNA
(cDNA) representing the genes that were
being transcribed in the cell at the time.
© 2015 Pearson Education, Inc.
6.14 Case Study Update: Who owns genes?
• In June 2013, The U.S. Supreme Court
case Association for Molecular Pathology
et al. v. Myriad Genetics, Inc., et al. was
presented.
• The Court’s opinion was that “a naturally
occurring DNA segment is a product of
nature and not patent eligible merely
because it has been isolated.”
Do you agree with the
Supreme Court’s decision?
© 2015 Pearson Education, Inc.
6.15 Opening Questions: What is a GMO?
• Have you ever eaten a genetically
modified organism (GMO)? If yes,
describe what you’ve eaten.
• Write down a question that you have
about GMOs.
• Share your question with your neighbor.
© 2015 Pearson Education, Inc.
6.15 Plants and animals can be genetically
modified
• Genetically modified organisms
(GMOs) are ones that have acquired one
or more genes by artificial means.
© 2015 Pearson Education, Inc.
6.15 GM plant crops currently make up a
significant part of our food supply
Bt corn has been
genetically
modified to
express a protein
that acts as
an insecticide,
© 2015 Pearson Education, Inc.
Golden rice is a
transgenic variety,
created with genes
that produce betacarotene.
Hawaii papaya
is genetically
engineered to be
resistant to the
ring-spot virus.
Genetically Modified (GM) Foods
– In the United States today, roughly half of the
corn crop and more than three-quarters of the
soybean and cotton crops are genetically
modified.
– Corn has been genetically modified to resist
insect infestation, attack by an insect called
the European corn borer.
© 2013
Pearson
Education,
© 2015
Pearson
Education,
Inc. Inc.
Genetically Modified (GM) Foods
– “Golden rice 2”
• is a transgenic
variety of rice
that carries
genes from
daffodils and
corn
• could help
prevent vitamin
A deficiency and
resulting
blindness.
© 2013
Pearson
Education,
© 2015
Pearson
Education,
Inc. Inc.
6.15 GM animals are not part of our food
supply (yet), but do have other uses
• Pharmaceutical
companies have
produced various GM
animals that produce
drugs.
• The FDA (Food and Drug Administration)
is considering approval for the first GM
food, a fast-growing transgenic salmon.
© 2015 Pearson Education, Inc.
6.15 Pros and cons of GMOs
Complete the comparison table:
PROS
© 2015 Pearson Education, Inc.
CONS
6.16 Opening Questions: What role should
DNA play in the criminal process?
Real-World Case Study: In 2013, a Texas man convicted in
a 1981 stabbing death was freed by DNA evidence after
serving 29 years in prison. In the original crime, the victim’s
abandoned car was found with several pieces of evidence,
including a black hairnet. In 2011, hair samples preserved
for three decades underwent DNA testing and linked the
samples to someone else. Randolph Arledge’s conviction
was overturned.
• Should DNA testing of evidence be mandatory?
• Who should pay for DNA testing in trials?
• What do you think is the responsibility of the
state for old cases? Explain.
© 2015 Pearson Education, Inc.
6.16 Polymerase chain reaction (PCR)
copies target DNA quickly and precisely
• Heating splits apart DNA helix
into two complementary strands.
• A heat-stable DNA polymerase
(enzyme that synthesizes DNA)
is used to build new strands.
• Billions of gene copies are
generated in just a few hours.
Using PCR, one drop of blood can
provide enough DNA for analysis.
© 2015 Pearson Education, Inc.
6.16 PCR involves cycles of heating and
cooling
© 2015 Pearson Education, Inc.
6.16 PCR is generally used to amplify one
region of DNA
• Primers (short single strands of DNA)
bind to the start and end points of the
segment of DNA being amplified.
© 2015 Pearson Education, Inc.
6.17 Opening Questions: Is your DNA
showing?
If you knowingly (or unknowingly) provide a DNA
sample, who should have access?
–
–
–
–
–
–
You?
Doctor?
Insurance company?
Police department?
Spouse?
Girlfriend/boyfriend?
Rank the above by their level of access.
Who else would you include or deny?
© 2015 Pearson Education, Inc.
6.17 DNA profiling can prove a match
between two samples
• Imagine that you have a
sample of DNA from a
crime scene and a
second sample from a
suspect.
• How can you prove they
match?
• Entire genome matching
is impractical, but we can
compare regions of DNA.
© 2015 Pearson Education, Inc.
What can be
learned with
just a drop of
blood?
6.17 DNA profilers focus on specific sites
that are known to vary considerably
• Scattered throughout the genome are
short tandem repeats (STRs) sites.
• At each STR site, a four-nucleotide
sequence is repeated many times in a row.
For example:
AGATAGATAGATAGATAGAT
• The number of repeats varies widely within
the human population.
© 2015 Pearson Education, Inc.
6.17 STR analysis compares 13 sites within
the human genome
• These sites vary so
widely that no two
humans have ever had
the same number of
repeats at all 13 sites
(except identical
twins).
© 2015 Pearson Education, Inc.
6.17 Follow a crime scene blood drop
• STR analysis can determine if the sample
matches the suspect.
© 2015 Pearson Education, Inc.
6.17 Gel electrophoresis provides
comparison of DNA samples
© 2015 Pearson Education, Inc.
6.18 Opening Questions: What can we learn
from the entire genome?
• In the 1990s, scientists set out on a quest
to map the entire set of human genes.
• This quest was a huge undertaking.
What are at least three things we might be
able to learn with knowledge of all the
genes in the human genome?
© 2015 Pearson Education, Inc.
6.18 Whole genomes can be sequenced
and mapped
• In 1995, a team of biologists announced
they had determined the DNA sequence of
the entire genome of Haemophilus
influenzae, a disease-causing bacterium.
• This marked the first successful
experiment in genomics, the science of
studying the complete sets of genes
(genomes) and their interactions.
© 2015 Pearson Education, Inc.
6.18 The Human Genome Project was
completed in 2003
• The human genome
contains 21,000
genes that encode for
100,000 different
proteins.
• The data are
providing insight into
development,
evolution, and many
diseases.
© 2015 Pearson Education, Inc.
Human Genome Facts
6.18 Genome mapping involved several
separate techniques
• The set of techniques used to sequence
an entire genome from an organism is
called the whole-genome shotgun
method.
© 2015 Pearson Education, Inc.
6.18 The field of proteomics examines the
proteins encoded by a genome
• The number of
proteins in humans
vastly exceeds the
number of genes.
• Understanding
proteins and their
tasks is at the
forefront of
biological research.
© 2015 Pearson Education, Inc.
6.19 Opening Questions: Can we fix genes?
• From what you’ve learned about DNA and
genetic information, do you think it is
possible to “fix” someone’s genes?
• Several diseases are the result of a single
gene mutation.
• How can we fix genes?
• What might be some benefits?
• What might be some risks?
© 2015 Pearson Education, Inc.
6.19 Gene therapy aims to cure genetic
diseases
• Gene therapy is the alteration of a
person’s genes in order to treat or cure a
disease by inserting the “correct” DNA into
the cell.
• As you can imagine, the easiest disorders
to “fix” are those with a single defective
gene.
© 2015 Pearson Education, Inc.
6.19 Gene therapy aims to cure genetic
diseases
1. Gene therapy
begins with
isolation of the
normal gene from
a healthy person.
2. Enzymes are
used to produce
an RNA version
of the target DNA
gene.
© 2015 Pearson Education, Inc.
6.19 Gene therapy aims to cure genetic
diseases
3. The RNA gene is
combined with an
infectious, but
harmless, retrovirus
The virus is the vector.
3. The virus is used to
infect a patient’s
bone marrow cells,
transferring the
proper gene to a
diseased individual.
© 2015 Pearson Education, Inc.
A genetically engineered
bone marrow cell carrying
the correct version of the
gene
6.19 Gene therapy in practice
• Gene therapy has
been used to treat a
disease caused by a
defect in the genes of
the immune system.
• Some children were
cured, but others died or developed cancers.
• Although gene therapy remains promising, there
are still problems with its application.
• Better vectors are needed to insert the corrected
gene into the cells of a person with a genetic
disease
© 2015 Pearson Education, Inc.