Download Please read the following information in your groups. Make sure you

Please read the following information in your groups. Make sure you understand the
material and write down any questions you have so they can be discussed. You may take
notes and annotate the text as you read it directly on the sheet.
A Simulation of DNA Mutations and Cancer
Cancer is the uncontrolled growth of cells that produces tumors. Cancer is almost
always caused by mutations in the DNA or by the abnormal activity of genes that
control cell growth and cell mitosis. Abnormal genes that cause cancer are called
oncogenes. Oncogenes have been discovered for many kinds of cancers.
Cell mutations commonly happen within the body, yet only a very small number
of mutations ever lead to cancer. The fact that few mutations lead to cancer is due
to several factors:
• Most mutated cells cannot perform the normal cell functions and thus die
quickly.
• Only a few mutated cells that do survive lose their ability to maintain normal
cell growth.
• Potentially cancerous cells are often destroyed by the body’s immune system.
• DNA and its associated repair enzymes have a precise self-checking system that
cuts and repairs any abnormal DNA segments before mitosis occurs.
How then does cancer occur? The chance of developing cancer is increased when
the risk of genetic mutations is increased. Some chemical, physical, or biological
agents increase the chance of mutations. These agents are called carcinogens if
they produce mutations that cause cancer. Carcinogens include the following.
• Ionizing radiation, such as ultraviolet rays and X-rays, can break DNA strands
and cause an increase in mutations.
• Chemical substances such as cigarette smoke can cause mutations.
• Physical irritants, such as foods that cause a continual wearing down of the
lining of the small intestine, can cause mutations.
• Biological agents that can cause cancer include viruses that attack the DNA of
normal cells. For example, the AIDS virus has been linked to a type of skin
cancer called Kaposi’s sarcoma. Therefore, getting HIV increases a person’s risk
factor for this cancer.
• Heredity affects mutations. Most cancers require two or more mutations in a
gene before cancer can occur. If a person inherits a particular mutation, only one
more mutation in the same gene may be needed to cause cancer. Researchers
estimate that heredity may be a factor in 5–7 percent of all types of cancer.
Adapted from Addison-Wesley Publishing Company
TEAR THIS PAGE OFF FROM THE LAB - YOU WILL BE KEEPING IT AS PART OF YOUR
NOTES.
Name __________________________________________ Class _____________ Date ___________________
A Simulation of DNA Mutations and Cancer
In this simulation you will act as a DNA sequence checker in a cell. You must find all the mistakes in the DNA or
the cell will become cancerous and lead to the death of the organism.
Vocabulary - Define the following terms:
Mutations: ________________________________________________________________________________
Cancer: __________________________________________________________________________________
DNA Base Pairing: _________________________________________________________________________
Procedure:
1. Imagine that you are the DNA sequence checker in a cell. First, estimate––do not count––the total number of
mistakes you expect to find in the following two DNA base sequences. Write your estimate on the first estimate
line on your laboratory record sheet.
2. Examine the DNA base sequence below. Look for base pairs that have the wrong complementary bases. Circle
the base pairs that are wrong. Answer all parts in question 1 on your record sheet.
CAGCCTGACCGCTAAACCCGATGATGCAGCCTGACCACGTCGGTACTTAACCGTCAGATGACCG
GACGGTCTGGCGATTTGGGCTACTACGTCCGACTGCTGCAGCCATGAATTGGCAGTCTTCTGCC
3. Suppose a strand of DNA were removed from the cells lining the lungs of a man who smokes three packs of
cigarettes per day. Estimate the number of mistakes you expect to find in the following DNA base sequence from the
smoker’s lung cells. Write your estimate on the second estimate line on your record sheet.
4. Examine the DNA base sequence. Look for base pairs that have the wrong complementary bases. Circle the bases
that are mismatched. Answer all parts in question 2 on the record sheet.
GAATTGGCAGTCTGATGCAGCCTGACCACGTCGGTAAGGCCTTAATTGCCAATCATGCAGATTG
CTTAAGCGTCAGACTACGTGGGACAGGTGCAGCGATTCCCGAATTAAGGGTTAGTTCGTCTAAC
5. Examine the data in the table. Answer all parts in question 3 on the record sheet.
6. The higher incidence of cancer with age may be caused by a slowing down of the DNA sequence checker.
Estimate the number of mistakes you expect to find in the following DNA base sequence. Write your estimate on
the third estimate line on your record sheet.
7. To simulate slower checking, find the number of mistakes in the strand below. Answer all parts in question 4 on
the record sheet.
CAGCCTGACCGCTAAACCCGATGATGCAGCCTGACCACGTCGGTACTTAACCGTCAGATGACCA
GTCGGACTGGCCATTTGGGCTACTACGACGGACTGGTGCAGCCATGAATTGGCAGACTACTGGT
Laboratory Record Sheet
Estimate #1: _______
Estimate #2: _______
Estimate #3: _______
1a. How many mistakes did you find? ____________
b. For the mistakes, explain what was wrong.
_____________________________________________________________________________________________
_____________________________________________________________________________________________
c. Compare your estimate #1 to the actual number of mistakes. Explain any differences between the two numbers.
_____________________________________________________________________________________________
_____________________________________________________________________________________________
2a. How many mistakes did you find? __________
b. Compare your estimate #2 to the actual number of mistakes. Explain any differences between the two numbers.
_____________________________________________________________________________________________
_____________________________________________________________________________________________
3a. Using the information in the table, describe the relationship between age and cancer.
_____________________________________________________________________________________________
_____________________________________________________________________________________________
b. Explain what factors you think would contribute to this relationship.
__________________________________________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
c. Cigarette smoke is the number-one cause of cancer in the United States today. About 25 percent of all cancer
deaths are due to cigarette smoke. Using your knowledge of cancer, explain why.
_____________________________________________________________________________________________
_____________________________________________________________________________________________
_____________________________________________________________________________________________
4a. How many mistakes did you find? __________
b. Compare your estimate #3 to the actual number of mistakes. Explain any differences between the two numbers.
_____________________________________________________________________________________________
_____________________________________________________________________________________________
c. Would this cell develop into a cancerous cell? Explain your reasoning.
_____________________________________________________________________________________________
_____________________________________________________________________________________________
_____________________________________________________________________________________________