Download Unit One Review KEY - Mr. Lesiuk

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Natural selection wikipedia , lookup

The Selfish Gene wikipedia , lookup

Hologenome theory of evolution wikipedia , lookup

Symbiogenesis wikipedia , lookup

Molecular paleontology wikipedia , lookup

Koinophilia wikipedia , lookup

Population genetics wikipedia , lookup

Microbial cooperation wikipedia , lookup

Inclusive fitness wikipedia , lookup

Adaptation wikipedia , lookup

Introduction to evolution wikipedia , lookup

Transcript
Unit One Review Answers
1. R: Reproduce offspring either sexually (two parents) or asexually (one parent
making clones).
H: Homeostasis. All organisms have physiological mechanisms to try to help them
maintain a stable balanced environment inside their cells and outside their cells.
C: Cells. All life forms consist of one or more cells
A: Adapt. All life forms have structural, behavioural, physiological adaptations to
help them survive in a given environment.
G: Grow. All life forms grow and develop.
E: Energy. All life forms take in energy from their environment and transform that
energy.
R: Respond: All life forms have the ability to detect changes in their environment
and respond appropriately to help them survive.
2. Homeostasis is defined above. Examples include shivering to warm up the body,
sweating to cool it down, breathing faster to take in O2 and give off CO2 during
exercise etc.
3. Abiogenesis means “producing without life”, it was the old theory that stated that
living things could come from non-living things. It is also known as “Spontaneous
Generation”
4. Redi: Rotting meat did not turn into maggots when mesh was used to keep the
flies off of the meat. – living did not come from non-living.
Needham : Boiled broth in fairly well-sealed flasks did turn into thousands and
thousands of microbes.
- Living did come from non-living
Spallanzani: Broth boiled much longer and sealed tightly did not give rise to
microbes. Living did not come from the non-living.
Pasteur: Broth boiled and stored in flasks did not give rise to microbes, even when
swan-necked tube was used to allow fresh air in but air-borne microbes could not
get in.
- Living did not come from non-living.
5. Cell Theory
a) The smallest entity of life is the cell, anything smaller than a cell is non-living.
b) All organisms consist of one or more cells
c) Cells only come from pre-existing cells.
6.
7. The limit of resolution is the point of magnification in a microscope beyond which
images become blurry and lose detail.
8.
POWER
LOW
MEDIUM
HIGH
Ocular
10 X
10 X
10 X
Objective
4X
10 X
40 X
9. The total power would be 15 X times 20 X = 300 X
10. There are 10 mm in 1 centimeter.
There are 1000 um in 1 mm, and there are 10, 000 um in 1 cm.
11. 4.5 mm = 4,500 um
12. FOV = 2.2 mm  2,200 um
Estimated size of specimen is :
________FOV____________
# of specimens that fit across
________2,200 um_____
2.6 specimens fit across
The specimen must be approximately 846 um wide
Total
40 X
100 X
400 X
13. The drawing magnification of the specimen is :
Drawing mag. = _____Drawing size_____
Estimated actual size
Drawing mag. = 1 cm  10, 000 um (on the piece of paper)
846 um
Drawing Magnification is approximately = 11.8 X
14. Proteins are made up of amino acids linked together
DNA is made up of DNA nucleotides linked together.
15. The three major nutrient groups are : FATS, PROTEINS, CARBOHYDRATES
16. There are about 20 different amino acids used by the body.
17. Deoxyribolnucleic Acid
18. Each nucleotide consists of the following:
a) A five carbon sugar molecule (deoxyribose)
b) A phosphate group
c) A nitrogenous base
or
19. The shape of DNA is described as being a “double helix”
20. DNA wrapped around histones forms “chromatin”
Chromosome
21. The X-shaped structures of condensed chromatin are called chromosomes.
22.a) In a normal (healthy) human diploid cell, there would be 46 chromosomes.
b) In a normal (healthy) haploid cell (Gamete :egg or sperm) there would be 23.
23. A gene is a segment of DNA that codes for the synthesis of a particular protein.
24. Purines are double-ringed bases called “adenine” and “guanine”, they are two
types of nitrogenous bases that form a given type of DNA nucleotide.
Pyrimidines are single-ringed bases called “cytosine” and “thymine”, these are the
other
25. The four nitrogenous bases as illustrated above are:
- Adenine and guanine which are double-ringed (purines)
- Cytosine and thymine which are single-ringed (pyrimidines)
26. The type of bonds that form between two complimentary bases is a weak bond,
called a “hydrogen bond”
Hydrogen
Bond
27. The complimentary strand for the following is illustrated in red.
__________________________________________
ACGTTTAGCCGATTAAGAGCATA
TGCAAATCGGCTAATTCTCGTAT
28. Replication is the process of making two identical molecules of DNA from
one original molecule of DNA. First DNA unwinds and then unzips, then
each half strand acts as a template for complimentary base pairing of
complimentary DNA nucleotides. As illustrated below:
29. Transcription is the process of using a piece of DNA (gene) as a template to
make a piece of mRNA, it takes place in the nucleus. This newly formed piece of
mRNA will carry the code of the gene from the nucleus out to the cytoplasm.
- Translation is the process of using (decoding) the piece of mRNA to determine the
specific order that a number of amino acids should link together to form a given
protein.
30. The percentage of difference between the cytochrome c of a dog and the
cytochrome c of a pig is a 6% difference.
31. The closest genetic relationship is seen between:
Pig vs. Donkey = 5.1% difference
Pig vs. Dog = 6.0% difference
Horse vs. Dog = 7.7% difference
32. According to the “Case Study” the closest relationship is seen between the
“Silkworm” and the “Hornworm”
33. Five things that provide support for the theory that life forms can evolve are:
A) The fossil record. Ex. Ancestral horse  modern horse
B) Embryological similarities. Ex. gill slits, gill pouches, tail structure
C) Homologous structures. Ex. Forelimbs of bat, human, sea lion = similar
anatomy.
D) Vestigial structures. Ex. Human appendix, snakes hips, cave fish eyes
E) Biochemical homologies. DNA, cytochrome C etc.
F) Biogeographical evidence : Ostriches, Emus, Rheas, all large flightless birds;
could they have derived from a common ancestor back on Pangaea
34. The three main categories of adaptations are:
A) Structural : A body part/structure that helps that organism survive.
Ex. A turtle’s hard shell, thorns on a rose bush
B) Physiological : A biochemical mechanism in an organism that helps them
survive.
Ex. Toxins in a plant/chili pepper, the production of ink in a squids
ink sac.
C) Behavioural : A behaviour that an organism uses to help it survive.
Ex. A rattle snake rattling, a tree tracking sunlight.
35. See above
36. The name for Darwin’s theory is “Natural Selection” it is also called “Survival of
the Fittest”
37. Lamarck’s theory of evolution is called “Inheritance of Acquired
Characteristics”
38. Natural Selection states that within a species members of that species show
variation. There is also a limited amount of resources required for survival. To
attain the required resources members compete against each other. The members
with the best phenotypes (adaptations) will out-compete the other less-suited
members. The best fit will survive and pass their genes onto form the next
generation
Inheritance of Acquired Characteristics: According to Lamarck, he felt that if an
organism uses a structure frequently, that structure will begin to develop more. If a
structure is not being used it will diminish. Whatever the case, the change to that
organism will be passed onto the offspring.
39. Charles Lyell demonstrated that the Earth is much older than many people
thought and that the Earth changes over time.
- Thomas Malthus stated that offspring are being produced at a much higher rate
than the normal death rate due to old age. But populations do not grow
exponentially, but rather, they level off due to limited resources
- Artificial Selection – A selective breeding practice used by farmers to improve the
phenotypes of their crops and livestock.
40. For natural selection to take place the following are required:
a) There must be variation in a population
b) There must be limited resources
c) The population must be larger than the resources can
support.
d) There must be competition for those resources
41. The three main ways that natural selection can shift a population are:
A) Stabilizing selection
B) Disruptive selection
C) Directional selection
42. “Industrial Melanism” is a case of natural selection documented in a species of
moth called the pepper moth. Prior to the Industrial Revolution the normal
phenotype (peppered) were better at camouflaging to avoid predators than the other
phenotype(melanic). That was reversed during the industrial revolution; as soot
covered the trees the peppered phenotype stood out and the melanic blended in
better. The phenotypic ratio drastically changed over a short period of time due to
natural selection.
43. Gregor Mendel is known as the “Father of Genetics”
44.
A) Phentoype : The physical traits an organism possess. Ex. Brown Eyes
B) Allele: The given form of a gene. For biology 11, we say that each gene may have
two forms or alleles. Ex. A gene for eye colour may have a sequence of bases that
codes to make the iris brown, or it may have a different sequence of bases that may
code to make the iris blue. In this case the gene for eye colour has two alleles
(forms)
C) Genotype: Is the combination of alleles (forms of the gene) that an individual
possesses. Each individual inherits one set of genes from their father and the other
complimentary set of genes from their mother. So for a given gene, like the eye
colour gene, an individual gets a pair of that gene. Sometimes the pair consist of the
same two alleles for example, BB or bb; other times the individual gets two different
alleles Bb.
D) Meiosis: The type of cell division that takes place in the reproductive organs to
make new haploid cells (gametes –sex cells) from normal diploid body cells.
E) Homozygous: The genotype of a cell where two of the same type of allele were
inherited. Ex BB or bb
F) Segregation: The separation of the two inherited alleles during the formation of
the gametes. Ex. Bb 
B
b
G) Heterozygous: The genotype of a cell where two different types of alleles were
inherited. Bb.
H) Crossover: A process that takes place during meiosis just before segregation.
During crossover two homologous chromosomes (one from mom, one from dad)
position themselves side-by-side, and a piece from one chromosome breaks off and
moves onto the other chromosome and vice versa.
45. The two main processes that increase variation in a population of a species are:
- Mutation – Makes new alleles
- Sexual Reproduction – Shuffles up the alleles
46. Heterozygous Black Rabbit (Bb) X Heterozygous Black Rabbit (Bb)
Gametes
B
b
B
BB
Bb
b
Bb
bb
B) Heterozygous Tall Pea Plant (Tt) X Homozygous Recessive (tt)
Gametes
T
t
Tt
t
Tt
t
tt
tt
47. For 50 % of the F1 generation to have the dominant phenotype while the other
50% has the recessive phenotype. The parents must be :
Bb
X bb
48. A) The allelic Frequency is - "B" = 24/50 = 48%
"b" = 26/50 = 52%
B) BB = 6/25 = 24%
bb= 7/25 = 28%
Bb = 12/25 = 48%
C)Phenotypic Ratio – BLACK – 18/25 = 72%
WHITE – 7/25 = 28%
49. Genetic equilibrium is the condition in a population where the gene pool (all the
genes and the relative frequency of each allele) is kept in balance, unchanged from
one generation to the next to the next. The population is not evolving (changing).
To maintain this state the following conditions must be met:
a) The size of the population must be very large
b) There must be no new alleles introduced – no mutation
c) There must be random mating – NO selective mating
d) There must be NO differential migration.
e) There must be equal viability (health) and fertility among all members
50A). Differential Migration is the process whereby a group of members moves out
of or moves into a population, but this group that moves out/in does not have the
same proportion of phenotypes that the main population possesses. Therefore there
is a shift in the frequency of each allele. Example, A population of 100 squirrels has
90 Grey squirrels and 10% Red squirrels. During a fire, 10 squirrels migrate into a
different part of the forest and they do not return to the original population. If the
10 that emigrated consist of 9 Grey and 1 Red, the allelic frequency is unlikely
changed, but if the 10 that emigrate are 7 Red and 3 Grey, the frequency of the red
allele would most likely be much lower and as a result the frequency of the Grey
allele would increase.
B) Genetic drift is the shift in frequency of the alleles, by chance. If 50% of all the
alleles in a population are (A) and the other 50% are (a), then the chances of the
next generation’s allelic frequency being 50% : 50% should be pretty good. But
there is also a chance that by chance the next generation’s allelic frequency could be
70% (a) and 30% (A). Example: get a coin and flip it 10 times, there’s a chance you
should get 5 heads and 5 tales, but there is also a chance you could get 10 heads in a
row. Try It!
51. Divergent evolution is change to one species in which two populations change to
become different to each other. Sometimes they become so different from one
another that they become two different species. Ex. Crocodiles and Alligators
Convergent evolution is change to two different species, so that they resemble each
other. They can never become so similar that they become one species.
Ex. Tasmanian wolf and Timber wolf.
52. Adaptive radiation is a type of DIVERGENT evolution in which one species
branches off to form many different but closely related species.
53. A) Species: a group of similar looking organisms that can and usually interbreed
with one another to reproduce fertile healthy offspring.
B) Population: A group that belongs to a given type of species that live in the same
area and breed with one another.
C) Speciation: The process by which two or more different species form from the
divergent evolution of one original species.
D) Niche : The combination of an organism’s habitat and its role it plays in that
habitat.
E) Analogous Structures : Structures that have similar appearance and function,
but the origin (DNA code/anatomical design) of the structures is very different.
F) Homologous Structures: Structures of different organisms that look quite
different and may have different functions, but they have similar origin. DNA
code/anatomical design)
54. Both Gradualism and Punctuated Equilibrium are different view on trying to
explain how fast evolution takes place. In Gradualism, the rate of evolution is very
slow and there is not any drastic change over a short period of time. In Punctuated
Equilibrium, there are long periods of unchanged (equilibrium) followed by quick
burst of drastic change.