Download Supplementary Information (doc 42K)

Supplementary Materials and Methods
Cell lines and Antibodies. SW480 and HCT116 human colon carcinoma cell lines, CT26
murine colon carcinoma cell line were purchased from ATCC. Cos-7 cells were from ATCC.
The following antibodies were used: monoclonal antibody anti-CD81 (clone1.3.3.22 , Santa Cruz
Biotechnology), monoclonal antibody anti-ADAM10 ectodomain (clone 163003, R&D
systems), goat polyclonal antibody anti-ADAM10 (A-20, Santa Cruz Biotechnology), rabbit
polyclonal antibody anti-RhoA (119, Santa Cruz Biotechnology), rabbit polyclonal antibody
anti-GFP (FL, Santa Cruz Biotechnology), rabbit polyclonal antibody anti-Gα13 (A-20, Santa
Cruz Biotechnology), rabbit polyclonal antibody anti-Phospho-Ezrin
(Thr567)/Radixin(Thr564)/Moesin(Thr558) (#3141, Cell Signaling Technology), rabbit
polyclonal antibody anti-Phospho-Myosin Light Chain2 (Ser19)(#3671, Cell Signaling
Technology), monoclonal antibody anti-CD9, clone FMC56 was provided by Dr. H. Zola,
monoclonal antibody anti-α-tubulin (clone DM1A, Sigma).
Shotgun Proteomics. The application of this technique is the analysis of protein complexes
isolated by immunoprecipitation to identify protein interactions and binding partners. This
method replaces the conventional gel-based methods with bi-dimensional liquid chromatography
that is more sensitive in revealing peptides present in low concentrations. To immunoprecipitate
CD81- associated proteins, anti-CD81 antibody 1.3.3.22 was coupled to protein A Sepharose
beads and incubated with the pre-cleared lysate of SW480 overnight at 4°C. The precipitated
proteins were resuspended in 8M urea and 100mM Tris, pH 8.5. Proteins were digested and
Multidimensional Protein Identification Technology (MudPIT) was carried out as described
with a bi-dimensional LC-ESI-MS/MS on a Finningan LQC ion trap instrument [Link et al
1999]. Using the SEQUEST algorithm, collected MS/MS spectra of peptides were correlated
with predicted amino acid sequences in translated genomic databases. The resulting list of
peptide sequences identified the proteins in the starting complex.
Gelatinolytic Zymography. SW480 cell lysates and conditioned media from the SW480
cultures were immunoprecipitated with antibodies anti-ADAM10 or anti-CD81 and analyzed for
gelatin degradation activity by SDS-PAGE under nonreducing conditions. The gel contained 5.8
mg/ml gelatin and 8% acrylamide. After one wash with water, the SDS was extracted by
incubating the acrylamide gel in a 2% Triton X-100/PBS solution. The gel was then incubated in
a buffer containing 5 mM CaCl2, 150 mM NaCl, and 50 mM Tris at 37 °C for 16 h and the
gelatinolytic activities were visualized by staining the gel with Coomassie Blue R-250.
Expression of ADAM10 truncation mutants. The plasmid pcDNA3-ADAM10 coding for
wild-type bovine ADAM10 (GenBank: Z21961.1) was used as template to clone ADAM10 into
pEGFP-N1 (Clontech) or pTagRFP-N1 (Evrogen) plasmids and construction of truncation
mutants of ADAM10 by PCR using XhoI and KpnI restriction enzymes. Disintegrin and
cysteine-rich domain ADAM10 (DisCy-EGFP 420-721)
Forward primer sequence: 5’CGCCTCGAGATGGCAAGAGCAACATCT3’.
Reverse primer sequence: 5’CGCGGTACCACACGTCTCATATGTCCCAT3’.
Cysteine-rich domain ADAM10 (Cys-EGFP 554-721)
Forward primer sequence:5’CGCCTCGAGATGGACTGTAATAGACAT3’
Reverse primer sequence: 5’CGCGGTACCACACGTCTCATATGTCCCAT3’
Transmembrane and intracytoplasmic domain ADAM10 ( TMCyt-EGFP 677-721)
Forward primer sequence:5’ CGCCTCGAGATGTACTGGTGGGCAGTA3’
Reverse primer sequence: 5’CGCGGTACCACACGTCTCATATGTCCCAT3’
Mutants were transfected into Cos-7 cells using Arrest-In transfection reagent (Open Biosystems,
ThermoFisher scientific).
RhoA activity assay. SW480 and CT26 were plated onto control dishes (100mm) or dishes
coated with supernatant of Cos-7 transfected with ADAM10Cys-EGFP or ADAM10-EGFP 60
min. Cells were lysed in 0.5 ml lysis buffer (50 mM Tris, pH 7.4, 10 mM MgCl2, 500 mM NaCl,
1% Triton X-100, 10 µg/ml each of aprotinin and leupeptin, 1 mM phenylmethylsulfonyl
fluoride, and 200 μM sodium orthovanadate) and lysates were cleared by centrifugation at
15,000 g for 10 minutes at 4°C. The supernatants were then incubated for 1 hour with 30 μg
purified GST-Rhotekin RhoA-binding domain fusion protein (GST-RBD) bound to the
glutathione-Sepharose 4B beads, washed three times with washing buffer (50mM Tris, pH 7.4,
10 mM MgCl2, 150 mM NaCl, 1% Triton X-100) and then immunoblotted with an anti-RhoA
polyclonal antibody. An anti-RhoA antibody was used as loading control.
RNA interference. Two different Gα13 siRNA target sequences were used: siRNA sequence for
murine Gα13 , 5’-GTCCACCTTCCTGAAGCAG3’. siRNA sequence for human Gα13,
5’GGATAAACTTGGAGAACCA3’. Scrambled siRNA sequence was : 5'GAGGAGCCGACGCTTAATA-3'. The siRNAs were chemically synthesized by Qiagen. For
transfection, the Amaxa nucleofection technology™ (Amaxa) was employed as previously
described (Mazzocca et al 2008). 72 h after transfection, the protein expression levels were
analyzed by immunoblotting or immunofluorescence. The efficiency of transfection was at least
80% as detected by Alexa Fluor 488-labelled control siRNA.
Retroviral infections. We cloned by PCR the EcoRI and SalI-flanked insert from plasmid pRetroQ
ADAM10-GFP containing ADAM10 Cys rich domain-GFP cDNA into retroviral vector pBabepuro (Addgene). Furthermore, we cloned the EcoRI and XhoI–flanked fragment from vector
pRetroQ-DsRedmonomer (Clontech), containing the full-length monomeric RFP cDNA, into retroviral
vector pLXSN (Clontech). Retroviral particles were generated by transient transfection of the
Phoenix-amphotropic packaging cell line (Allele Biotech). Phoenix cells plated onto 100mm dishes
were transfected at approximately 80% confluence with 20 µg of plasmid using Arrest-In
transfection reagent. After 48 h, virus-containing supernatant was recovered centrifuged and used
immediately or aliquoted and frozen at -80°C. Target cells were infected with virus-containing
supernatant in the presence of polybrene (8µg/ml, Sigma).
We made pBabeN19RhoA-AcGFP1 subcloning the BamHI-EcoRI fragment from plasmid
pCEV29N19RhoA into BamHI-EcoRI sites of retroviral vector pBabe-puro, successively we cloned
by PCR the HindIII and ClaI-flanked insert from pRetroQ-AcGFP1 (Clontech) containing
AcGFP1cDNA into pBabe-puro replacing the puromycin cDNA. Retroviral particles were
generated by transient transfection of the Phoenix-amphotropic packaging cell line.
Gene Knockdown assay
The following shRNAs (OriGene Technologies) were stably delivered into CT26 and HCT116
by retroviral infection according to manufacturer’s instructions: TG509819, is a plasmid
containing 29 mer shRNA construct in retroviral GFP vector to knockdown mouse CD9 ;
TG314060 is a plasmid containing 29 mer shRNA construct to silence human CD9; TR30013 is
a non-effective 29 mer scrambled shRNA used as control. Retrovirally transduced CT26 and
HCT 116 cells were selected in puromycin-containing medium and, after 1–2 weeks, reduced
expression of CD9 protein and mRNA was assessed by flow cytometry and RT-PCR,
respectively. Next, silenced CT26 were stably transfected with EGFP (106 cells) and mixed
with silenced CT26 stably transfected with RFP (106 cells) in the presence of geneticin. The
same procedure was used with HCT116 cells. Fused cells were identified by dual color
FACScan.