Different Species Common Arthritis Quantitative Trait Loci in High
... defined as a QTL. Therefore, the number of susceptibility genes could be much larger than the number of the identified QTLs. On the other hand, identification of susceptibility genes within the QTLs is still a challenging task, with the exceptions of few genes with very strong effect on the disease, ...
... defined as a QTL. Therefore, the number of susceptibility genes could be much larger than the number of the identified QTLs. On the other hand, identification of susceptibility genes within the QTLs is still a challenging task, with the exceptions of few genes with very strong effect on the disease, ...
Extraction of correlated gene clusters from multiple genomic data by
... biological phenomenon. Moreover, by selecting the genes responsible for the correlation, one can expect to select groups of genes which play a special role in or are affected by the underlying biological phenomenon. As an example, the existence of operons in prokaryotes is responsible for a form of ...
... biological phenomenon. Moreover, by selecting the genes responsible for the correlation, one can expect to select groups of genes which play a special role in or are affected by the underlying biological phenomenon. As an example, the existence of operons in prokaryotes is responsible for a form of ...
Sex-linked dosage-sensitive modifiers as imprinting
... result of dosage-sensitive modifier genes located on the sex chromosomes. Parallels between variegating position-effects in Drosophila, the phenotype elicited by transgenes in the mouse and data from several pediatric tumors indicate that the net result of the activity of such modifier genes is ofte ...
... result of dosage-sensitive modifier genes located on the sex chromosomes. Parallels between variegating position-effects in Drosophila, the phenotype elicited by transgenes in the mouse and data from several pediatric tumors indicate that the net result of the activity of such modifier genes is ofte ...
SI - Evolocus LLC
... The Christian interpretation, being expressed in modern biological terms, implies that the following generations are involved: P (“parental” generation), F1, F2, F3 and F4 (four “filial” generations, i.e. generations of descendants). This interpretation was obtained by means of blind simplification ...
... The Christian interpretation, being expressed in modern biological terms, implies that the following generations are involved: P (“parental” generation), F1, F2, F3 and F4 (four “filial” generations, i.e. generations of descendants). This interpretation was obtained by means of blind simplification ...
Mutations in SIN4 and RGR1 Cause Constitutive Expression of MAL
... Our previous work reported that the role of maltose permease in induction is the accumulation of intracellular maltose but the means of sensing the presence of intracellular maltose remain undetermined (Wang et al. 2002). It is possible that the MAL-activator itself is the maltose-binding sensor. Al ...
... Our previous work reported that the role of maltose permease in induction is the accumulation of intracellular maltose but the means of sensing the presence of intracellular maltose remain undetermined (Wang et al. 2002). It is possible that the MAL-activator itself is the maltose-binding sensor. Al ...
Comparison between Human and Mouse genomes
... Can introduce early stop codons, resulting in truncated proteins or unstable mRNAs It can modify the activity of the transcription factors, affecting the expression of genes It is observed nearly in all metazoans Estimated to occur in 30%-40% of human ...
... Can introduce early stop codons, resulting in truncated proteins or unstable mRNAs It can modify the activity of the transcription factors, affecting the expression of genes It is observed nearly in all metazoans Estimated to occur in 30%-40% of human ...
1 Objectives
... TTTCTTTTGCCAGTGGTTGGTCTGTGCTTTTTT GTCTAAATAACATTGTACAAGATGGTTCAATATT CGACAGCATGATTTGAACTTTTGAAAAAAAAAA AAAAAAAA Features of Raw sequence data: contains 140 nucleotides primer location:1-21(red) poly A tail: 124-140 termination signal (green) possible adenylation signal (underlined) ...
... TTTCTTTTGCCAGTGGTTGGTCTGTGCTTTTTT GTCTAAATAACATTGTACAAGATGGTTCAATATT CGACAGCATGATTTGAACTTTTGAAAAAAAAAA AAAAAAAA Features of Raw sequence data: contains 140 nucleotides primer location:1-21(red) poly A tail: 124-140 termination signal (green) possible adenylation signal (underlined) ...
PDF
... selective preservation in multiple species across ~300 million years of sex chromosome evolution to prevent male-female dosage disparity, (ii) the breadth of their tissue expression from both sex chromosomes; and (iii) their key regulatory roles in transcription and translation8,9 (Figure S1E). Broa ...
... selective preservation in multiple species across ~300 million years of sex chromosome evolution to prevent male-female dosage disparity, (ii) the breadth of their tissue expression from both sex chromosomes; and (iii) their key regulatory roles in transcription and translation8,9 (Figure S1E). Broa ...
Sex Chromosome Dosage Effects On Gene Expression In
... selective preservation in multiple species across ~300 million years of sex chromosome evolution to prevent male-female dosage disparity, (ii) the breadth of their tissue expression from both sex chromosomes; and (iii) their key regulatory roles in transcription and translation8,9 (Figure S1E). Broa ...
... selective preservation in multiple species across ~300 million years of sex chromosome evolution to prevent male-female dosage disparity, (ii) the breadth of their tissue expression from both sex chromosomes; and (iii) their key regulatory roles in transcription and translation8,9 (Figure S1E). Broa ...
Poster Patrocles_V3
... Using positional cloning, we have recently identified the mutation responsible for muscular phenotype of the Texel sheep. It is located in the 3’UTR of the GDF8 gene - a known developmental repressor of muscle growth - and creates an illegitimate target site for miRNA expressed in the same tissue. T ...
... Using positional cloning, we have recently identified the mutation responsible for muscular phenotype of the Texel sheep. It is located in the 3’UTR of the GDF8 gene - a known developmental repressor of muscle growth - and creates an illegitimate target site for miRNA expressed in the same tissue. T ...
Excel spreadsheet
... indistiguishable from 5 for this calculation. A transcript was considered increased at 6 hours if the data satisifed the following queries. For a given transcript, each probe pair was scored as increased in sample A relative to sample B if (PM-MM)A-(PM-MM)B > 30 and (PM-MM)A >1.3x(PM-MM)B and decrea ...
... indistiguishable from 5 for this calculation. A transcript was considered increased at 6 hours if the data satisifed the following queries. For a given transcript, each probe pair was scored as increased in sample A relative to sample B if (PM-MM)A-(PM-MM)B > 30 and (PM-MM)A >1.3x(PM-MM)B and decrea ...
-Chain Gene Promoter ζ Antigen Receptor Elf
... To determine the role of the two Ets binding sites in transcription from the full-length z promoter (2307/158), one or both elements were mutated to generate FLDzEBS1, FLDzEBS2, and FLDzEBS112, respectively. While mutation of either zEBS1 or zEBS2 had no effect on promoter activity in Jurkat cells, ...
... To determine the role of the two Ets binding sites in transcription from the full-length z promoter (2307/158), one or both elements were mutated to generate FLDzEBS1, FLDzEBS2, and FLDzEBS112, respectively. While mutation of either zEBS1 or zEBS2 had no effect on promoter activity in Jurkat cells, ...
幻灯片 1
... development, vascular remodeling promoters are critical for uterus function and fertility. VEGF as a major factor promotes endothelial cell growth and blood vessel development. • In addition, VEGF has been found playing major roles in non-endothelial cells. ...
... development, vascular remodeling promoters are critical for uterus function and fertility. VEGF as a major factor promotes endothelial cell growth and blood vessel development. • In addition, VEGF has been found playing major roles in non-endothelial cells. ...
RNA Processing
... DNA sequences in addition to genes • The bulk of most eukaryotic genomes – Consists of noncoding DNA sequences, often described in the past as “junk DNA” ...
... DNA sequences in addition to genes • The bulk of most eukaryotic genomes – Consists of noncoding DNA sequences, often described in the past as “junk DNA” ...
The regulation of expression of the porin gene ompC
... The regulation of expression of the porin genes of Escherichiu cofiby acid pH was investigated using reporter gene fusions. The ompC-ZacZ gene fusion was expressed in response to acidification of the external medium. The kinetics of P-galactosidase synthesis under acid-induction differed significant ...
... The regulation of expression of the porin genes of Escherichiu cofiby acid pH was investigated using reporter gene fusions. The ompC-ZacZ gene fusion was expressed in response to acidification of the external medium. The kinetics of P-galactosidase synthesis under acid-induction differed significant ...
AnnotatorsInterface-GUS
... Provide alignment of features on genomic sequence – could potentially display any feature type currently stored in GUS3.0 – features can be selected and used to generate “curated” features – similar to display and functionality in Apollo ...
... Provide alignment of features on genomic sequence – could potentially display any feature type currently stored in GUS3.0 – features can be selected and used to generate “curated” features – similar to display and functionality in Apollo ...
KIR3DL1 Phenotype Variation?
... 19), and the relative strength of the competing promoters may affect the frequency of NK cells expressing a given KIR within a given individual (S. K. Anderson, manuscript in preparation). Also, the proximal promoter of KIR3DL1 is polymorphic at transcription factor binding sites known to affect pro ...
... 19), and the relative strength of the competing promoters may affect the frequency of NK cells expressing a given KIR within a given individual (S. K. Anderson, manuscript in preparation). Also, the proximal promoter of KIR3DL1 is polymorphic at transcription factor binding sites known to affect pro ...
draft - University of Michigan
... be attributed to trans-regulatory differences (Wittkopp et al. 2004), suggesting that transregulatory divergence might also contribute substantially to the faster-X pattern of expression divergence. Consistent with this hypothesis, overall trans-regulatory divergence (1 - ρ) was significantly higher ...
... be attributed to trans-regulatory differences (Wittkopp et al. 2004), suggesting that transregulatory divergence might also contribute substantially to the faster-X pattern of expression divergence. Consistent with this hypothesis, overall trans-regulatory divergence (1 - ρ) was significantly higher ...
Translation
... • RNA polyadenylation: repeated adenine nucleotides (100-200) are bound to the 3´end (poly-A end). These two modifications increase the stability of mRNA. RNA splicing: noncoding sequenses (introns) are removed from primary transcript and codding sequenses (exons) are joined in given order. [FIG.] [ ...
... • RNA polyadenylation: repeated adenine nucleotides (100-200) are bound to the 3´end (poly-A end). These two modifications increase the stability of mRNA. RNA splicing: noncoding sequenses (introns) are removed from primary transcript and codding sequenses (exons) are joined in given order. [FIG.] [ ...
Dosage Compensation: Transcription-Level Regulation of X
... and females) is explained by this formulation if one considers that, since the cells and their nuclei are proportionately larger, the concentration of the inhibitor in these forms is two-thirds of its value in diploids. One extreme version of this model would have separate regulatory elements for ea ...
... and females) is explained by this formulation if one considers that, since the cells and their nuclei are proportionately larger, the concentration of the inhibitor in these forms is two-thirds of its value in diploids. One extreme version of this model would have separate regulatory elements for ea ...
The RNAi mechanism
... • See which genes can be knocked out to effect tumor growth • Paper describing this: “RNA interference microarrays: High-throughput loss-offunction genetics in mammalian cells” available from pubmed From Gene To Bio Function, Fall 04 ...
... • See which genes can be knocked out to effect tumor growth • Paper describing this: “RNA interference microarrays: High-throughput loss-offunction genetics in mammalian cells” available from pubmed From Gene To Bio Function, Fall 04 ...