Katie-Arabidopsis
... with tiny, white, four-petalled flowers • Six week lifespan • No immediate agricultural importance and is not thought to cure any disease • Prolific seed production and easy cultivation in restricted space • A large number of mutant lines and genomic resources ...
... with tiny, white, four-petalled flowers • Six week lifespan • No immediate agricultural importance and is not thought to cure any disease • Prolific seed production and easy cultivation in restricted space • A large number of mutant lines and genomic resources ...
Study Guide: Chapter 2
... 32. Why is the enzyme RNA polymerase important in transcription? 33. What is the purpose of a promoter? 34. What would the mRNA product of transcription be for the template DNA strand: CTA GGA? 35. What are introns and exons? 36. What are some functions of proteins in the cell? (Think back to our mo ...
... 32. Why is the enzyme RNA polymerase important in transcription? 33. What is the purpose of a promoter? 34. What would the mRNA product of transcription be for the template DNA strand: CTA GGA? 35. What are introns and exons? 36. What are some functions of proteins in the cell? (Think back to our mo ...
2nd problem set
... 1. Imagine you are sequencing the DNA molecule shown above. Assume the primer 5’ GATGCCT 3’ is used to initiate DNA synthesis. You have a tube containing template, primer, millions of ACGT nucleotides and millions of dideoxyC nucleotides. (p. 387-393 of your textbook has a good review if you are hav ...
... 1. Imagine you are sequencing the DNA molecule shown above. Assume the primer 5’ GATGCCT 3’ is used to initiate DNA synthesis. You have a tube containing template, primer, millions of ACGT nucleotides and millions of dideoxyC nucleotides. (p. 387-393 of your textbook has a good review if you are hav ...
Genetic Engineering
... 1. Isolate the foreign DNA by using _____restriction enzymes___ that cleave (cut) the donor DNA at very specific places 2. Vectors transfer the donor DNA into the host a. mechanical vectors = Carry DNA into a cell, micropipette or metal bullet b. biological vectors = virus or bacterial plasmid (____ ...
... 1. Isolate the foreign DNA by using _____restriction enzymes___ that cleave (cut) the donor DNA at very specific places 2. Vectors transfer the donor DNA into the host a. mechanical vectors = Carry DNA into a cell, micropipette or metal bullet b. biological vectors = virus or bacterial plasmid (____ ...
Mutations
... D. Regulation and Development- especially important in shaping the way a complex organism develops from single fertilized cell. 1. Hox genes- controls organs and tissues that develop in various parts of the embryo a. Mutation in one of these “master control genes” can completely change organs that ...
... D. Regulation and Development- especially important in shaping the way a complex organism develops from single fertilized cell. 1. Hox genes- controls organs and tissues that develop in various parts of the embryo a. Mutation in one of these “master control genes” can completely change organs that ...
Lecture
... E. coli; this permits cloning of larger DNA fragments (up to 45kb) than can be introduced into bacterial hosts in plasmid vectors. ...
... E. coli; this permits cloning of larger DNA fragments (up to 45kb) than can be introduced into bacterial hosts in plasmid vectors. ...
Answers to Biological Inquiry Questions – Brooker et al ARIS site
... have variation in their total amount of DNA? ANSWER: One reason is that more complex species tend to have more genes. A second reason is that species vary with regard to the amount of repetitive DNA that is found in their genome. Figure 21.6 BIOLOGICAL INQUIRY QUESTION: Based on their mechanism of m ...
... have variation in their total amount of DNA? ANSWER: One reason is that more complex species tend to have more genes. A second reason is that species vary with regard to the amount of repetitive DNA that is found in their genome. Figure 21.6 BIOLOGICAL INQUIRY QUESTION: Based on their mechanism of m ...
Lesson Plan
... Opening: Study for Test (Jeopardy Review) Students take DNA, RNA Test New Material: Gene expression (introns, exons, lac genes) Guided Practice: Gene expression handout Assessment and Closing: Explain gene expression in 1 paragraph using important terms from your notes. New Material: Meiosis Notes ...
... Opening: Study for Test (Jeopardy Review) Students take DNA, RNA Test New Material: Gene expression (introns, exons, lac genes) Guided Practice: Gene expression handout Assessment and Closing: Explain gene expression in 1 paragraph using important terms from your notes. New Material: Meiosis Notes ...
glossary of technical terms
... Deoxyribonucleic acid, a complex molecule found in the chromosomes of almost all organisms, made up of four different kinds of bases, which are abbreviated A, C, T and G. A DNA fragment that is ten bases long might have a base sequence of, for example, ATCGTTCCTG. The particular sequence of bases en ...
... Deoxyribonucleic acid, a complex molecule found in the chromosomes of almost all organisms, made up of four different kinds of bases, which are abbreviated A, C, T and G. A DNA fragment that is ten bases long might have a base sequence of, for example, ATCGTTCCTG. The particular sequence of bases en ...
DNA Structure copy
... DNA made up of repeating “building blocks” called NUCLEOTIDES. Three parts of a DNA Nucleotide: 1. Deoxyribose Sugar 2. Phosphate Group 3. Nitrogen Base ...
... DNA made up of repeating “building blocks” called NUCLEOTIDES. Three parts of a DNA Nucleotide: 1. Deoxyribose Sugar 2. Phosphate Group 3. Nitrogen Base ...
Genetics
... Relate the concept of the gene to the sequences of nucleotides in DNA Sequence the steps involving protein synthesis Categorize the different kinds of mutations that can occur in DNA Compare the effects of different kinds of mutations on cells and organisms. ...
... Relate the concept of the gene to the sequences of nucleotides in DNA Sequence the steps involving protein synthesis Categorize the different kinds of mutations that can occur in DNA Compare the effects of different kinds of mutations on cells and organisms. ...
Introduction to Agriculture, Food, and Natural Resources
... follows: • Cytosine (C) combines with Guanine (G) • Adenine (A) combines with Thymine (T) ...
... follows: • Cytosine (C) combines with Guanine (G) • Adenine (A) combines with Thymine (T) ...
Recombinant DNA - Richmond School District
... 3. A bacterial plasmid is also “cut” with the SAME restriction enzyme. (this leaves the human DNA and the plasmid DNA with the same “sticky ends”) ...
... 3. A bacterial plasmid is also “cut” with the SAME restriction enzyme. (this leaves the human DNA and the plasmid DNA with the same “sticky ends”) ...
Tutorial_12 (2014)
... track name=unknown description="unknown genomic element" color=255,0,0, chr17 ...
... track name=unknown description="unknown genomic element" color=255,0,0, chr17 ...
Protein Synthesis Review Concepts • Protein synthesis occurs in two
... 2. How does your genotype determine your phenotype (include DNA, RNA & protein)? 3. Use the following DNA sequence to go through the steps of finding the amino acid sequence (show all your work and look for a start codon): GACTACAAATTTCCCGGGATCGAC 4. How are codons and anticodons related? 5. What is ...
... 2. How does your genotype determine your phenotype (include DNA, RNA & protein)? 3. Use the following DNA sequence to go through the steps of finding the amino acid sequence (show all your work and look for a start codon): GACTACAAATTTCCCGGGATCGAC 4. How are codons and anticodons related? 5. What is ...
Ch. 13 Genetic Engineering, Chapter Summary Date
... 6. a techniques scientist used to make many copies of a certain gene. 8. produced by combining DNA from different species or different sources. 14. a technique that breed specific animals and plants with desired traits. This technique takes advantage of naturally occurring genetic variation in a gro ...
... 6. a techniques scientist used to make many copies of a certain gene. 8. produced by combining DNA from different species or different sources. 14. a technique that breed specific animals and plants with desired traits. This technique takes advantage of naturally occurring genetic variation in a gro ...
Notes 4-4
... 2. Describe how a cell produces proteins. 3. Identify how mutations can affect an organism. 4-4 The DNA Connection A. The Genetic Code 1. The main function of genes is to control the production of proteins in an organism. Proteins help to determine the size, shape, color, and many other traits. 2. G ...
... 2. Describe how a cell produces proteins. 3. Identify how mutations can affect an organism. 4-4 The DNA Connection A. The Genetic Code 1. The main function of genes is to control the production of proteins in an organism. Proteins help to determine the size, shape, color, and many other traits. 2. G ...
Competency Goal # 3: DNA, Protein Synthesis, Genetics
... 17. ___________________________ - allele which masks the phenotype of other alleles. 18. ___________________________ - allele that will not be expressed if dominant allele is present 19. ___________________________ - (hybrid) – the genes in the gene pair are different. 20. __________________________ ...
... 17. ___________________________ - allele which masks the phenotype of other alleles. 18. ___________________________ - allele that will not be expressed if dominant allele is present 19. ___________________________ - (hybrid) – the genes in the gene pair are different. 20. __________________________ ...
Competency Goal # 3: DNA, Protein Synthesis
... 17. ___________________________ - allele which masks the phenotype of other alleles. 18. ___________________________ - allele that will not be expressed if dominant allele is present 19. ___________________________ - (hybrid) – the genes in the gene pair are different. 20. __________________________ ...
... 17. ___________________________ - allele which masks the phenotype of other alleles. 18. ___________________________ - allele that will not be expressed if dominant allele is present 19. ___________________________ - (hybrid) – the genes in the gene pair are different. 20. __________________________ ...
Systematic Implications of DNA variation in subfamily
... Should be present in all taxa to be compared Must have some knowledge of the gene or other genomic region to develop primers, etc. Evolutionary rate of sequence changes must be appropriate to the taxonomic level(s) being investigated; “slow” genes versus “fast” genes It is desirable that sequences c ...
... Should be present in all taxa to be compared Must have some knowledge of the gene or other genomic region to develop primers, etc. Evolutionary rate of sequence changes must be appropriate to the taxonomic level(s) being investigated; “slow” genes versus “fast” genes It is desirable that sequences c ...
Changes in DNA can produce variation
... • There is a large number of DNA bases in any organism that need to be copied • Errors can occur when DNA is copied or affected by environment – UV radiation – X-rays – Toxins ...
... • There is a large number of DNA bases in any organism that need to be copied • Errors can occur when DNA is copied or affected by environment – UV radiation – X-rays – Toxins ...
DNA * History, Structure, and Functions
... There are 23 chromosomes in a gamete (sex cell) - haploid Mitosis takes 1 body cell (diploid) and makes 2 identical ...
... There are 23 chromosomes in a gamete (sex cell) - haploid Mitosis takes 1 body cell (diploid) and makes 2 identical ...
The discovery:DNA
... The discovery:DNA .The Swiss biochemist Friedrich Miescher (18441895) discovered the nucleic acids in 1868. His experiment: ...
... The discovery:DNA .The Swiss biochemist Friedrich Miescher (18441895) discovered the nucleic acids in 1868. His experiment: ...