• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Plant aromatic amino acid decarboxylases
Plant aromatic amino acid decarboxylases

... divergent AAAD-like proteins. For example, an expansion of the AAAD gene within insect and plant species results in a multiplicity of functionally diverse AAAD enzymes. A single AAAD annotation does not accurately represent the selection of activities and substrate specificities. This can be illustr ...
Emergent Neutrality in Adaptive Asexual Evolution
Emergent Neutrality in Adaptive Asexual Evolution

... The key derivation of this article concerns the effects of interference interactions on the evolution of the genome state. We develop an approximate calculus for multiple simultaneous mutations. Specifically, we determine how the fixation probability of a specific target mutation is affected by positi ...
Resolving Individuals Contributing Trace Amounts of DNA to Highly
Resolving Individuals Contributing Trace Amounts of DNA to Highly

... components of the mixture [8]. Nevertheless, these methods based on STRs expectedly suffer from limited power when using severely degraded DNA [8,9]. Mitochondrial DNA (mtDNA) based on hypervariable region sequencing is useful when analyzing degraded DNA due to its high copy number and improved stab ...
Oxidation reactions on neutral cobalt oxide clusters: experimental and theoretical studies
Oxidation reactions on neutral cobalt oxide clusters: experimental and theoretical studies

... (TPR and TPO), infrared spectroscopy (IR), thermogravimetric analysis (TGA), mass spectrometry (MS), and by other techniques, as well. Reaction mechanisms for carbon monoxide oxidation on cobalt oxide catalysts are still unclear even through many efforts have been focused on this issue. Only a very s ...
Spring 2016 Biology Item Release Scoring Guide
Spring 2016 Biology Item Release Scoring Guide

... knowledge. Communicate with clarity, focus and organization using rich, investigative scenarios, real-world data and valid scientific information. ...
Iduence of Dilution Rate on Enzyme Synthesis in
Iduence of Dilution Rate on Enzyme Synthesis in

Iduence of Dilution Rate on Enzyme Synthesis in
Iduence of Dilution Rate on Enzyme Synthesis in

THE ATP SYNTHASE—A SPLENDID MOLECULAR MACHINE
THE ATP SYNTHASE—A SPLENDID MOLECULAR MACHINE

... Electron microscopy has played an important role in structural studies of the ATP synthase (see 46 for review), as illustrated by the following examples: 1. Fragments of monoclonal antibodies bound to the α- and ε-subunits of the EcF1 allowed detection of three types of subunit assemblies in which a ...
Single-Molecule Fluorescence Resonance Energy Transfer
Single-Molecule Fluorescence Resonance Energy Transfer

... Since DNA or RNA oligonucleotides can be synthesized, it is relatively straightforward to attach dyes to them. A number of dyes are available in phosphoramidite form and can be readily incorporated during nucleic acid synthesis. Alternatively, amine-reactive dyes can be attached to an amino group in ...
Biochemical, or Molecular, Genetics
Biochemical, or Molecular, Genetics

... • Determinants of Phenotypes (Blood Groups) in the ABO System – Insert Figure 4.4 ...
Unit 5 Chemical Kinetics Section 5.1 Rates of Chemical Reaction
Unit 5 Chemical Kinetics Section 5.1 Rates of Chemical Reaction

... The most significant method to make reactions go faster is to heat the reactants. An increase in temperature increases the number of reactant particles having energy greater than the activation energy of the reaction, thus producing more fruitful collisions. Moreover, the increase in temperature als ...
Document
Document

... blue l(570nm) ...
Slides - Edwards Lab
Slides - Edwards Lab

... Control Flow: if statement # The input DNA sequence seq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg' # Remove the initial Met codon if it is there if seq.startswith('atg'): print "Sequence without initial Met:",seq[3:] ...
Slides - Edwards Lab
Slides - Edwards Lab

... Control Flow: if statement # The input DNA sequence seq = 'atggcatgacgttattacgactctgtgtggcgtctgctggg' # Remove the initial Met codon if it is there if seq.startswith('atg'): print "Sequence without initial Met:",seq[3:] ...
Cell Chemistry and Structure
Cell Chemistry and Structure

... Be able to give examples of energy requiring processes driven by ATP. Know that some reactions involve removal of hydrogen from compounds in the pathway. Know that hydrogen combines with NAD, forming NADH2. Know that the first stage in respiration is glycolysis. Know and understand the events taking ...
HL7 V2.5.1 Genetic Test Result Message - HL7 Wiki
HL7 V2.5.1 Genetic Test Result Message - HL7 Wiki

... The HL7 Version 2.5.1 Implementation Guide: Clinical Genomics; Genetic Test Result Reporting to EHR (US Realm) details structuring a genetic test results into the electronic health record utilizing HL7 version 2.5.1. This implementation guide is modeled after the HL7 Version 2.5.1 Implementation Gui ...
Creation/Evolution
Creation/Evolution

1 - IPPC
1 - IPPC

... indicated in Figures 1 and 2 are the minimum requirements for the diagnosis, but further tests may be required by the national plant protection organization (NPPO), especially for the first report in a country. For example, serological tests may facilitate a presumptive diagnosis of symptomatic plan ...
Visualization, description and analysis of the Drosophila melanogaster
Visualization, description and analysis of the Drosophila melanogaster

... evolutionary process. On one hand, the molecule is intrinsically mutable, being this the origin of genetic variation. On the other hand, it allows the replication of old and new variants from one generation to another. The reproductive or survival advantage or disadvantage an individual has for carr ...
Differential Regulation of a-Lactalbumin and
Differential Regulation of a-Lactalbumin and

... aLA). Rat casein (Protein C) purified to homogeneity on DEAE-cellulose and a-Iactalbumin were iodinated with Na'25l by means of the chloramine-T procedure (4). Increasing quantities of specific antiserum raised in rabbits were added to 3.8 ng of 125I-casein,227,000 cpm (A), and to 5.3 ng of ‘25I.. ...
Probing the mechanism of the bifunctional enzyme
Probing the mechanism of the bifunctional enzyme

... with a kcat value substantially less than those of its lower and high homologues. However, it should be noted that this compound is the only 2-ketoacid tested that has a chiral centre and we have found (data not shown) that both enantiomers are active. Misorientation of one of the enantiomers might ...
Inquiry into Life Twelfth Edition
Inquiry into Life Twelfth Edition

... • cAMP added to E. coli can overcome catabolite repression of lac operon • Addition of cAMP lead to activation of the lac gene even in the presence of glucose • Positive controller of lac operon has 2 parts: – cAMP – Protein factor is known as: • Catabolite activator protein or CAP ...
The Role of Causal Processes in the Neutral and Nearly Neutral
The Role of Causal Processes in the Neutral and Nearly Neutral

... both played significant roles. While the early nearly neutral theory agreed with the strictly neutral or “simple neutral theory” that selected mutants could be advantageous or deleterious, she emphasized that most selected mutants, including nearly neutral mutants, were in fact deleterious to some d ...
Novel targets for tuberculosis drug discovery
Novel targets for tuberculosis drug discovery

Biochemical Thermodynamics - Research Centers | Center for
Biochemical Thermodynamics - Research Centers | Center for

... small molecules that serve in some functional role in biological organisms. Many are vitamins or are derived from vitamins; a vitamin is defined as an organic molecule that is necessary for metabolism but cannot be synthesized by the organism. Thus the same compound may be a vitamin for one organism ...
< 1 ... 16 17 18 19 20 21 22 23 24 ... 1026 >

Deoxyribozyme



Deoxyribozymes, also called DNA enzymes, DNAzymes, or catalytic DNA, are DNA oligonucleotides that are capable of catalyzing specific chemical reactions, similar to the action of other biological enzymes, such as proteins or ribozymes (enzymes composed of RNA).However, in contrast to the abundance of protein enzymes in biological systems and the discovery of biological ribozymes in the 1980s,there are no known naturally occurring deoxyribozymes.Deoxyribozymes should not be confused with DNA aptamers which are oligonucleotides that selectively bind a target ligand, but do not catalyze a subsequent chemical reaction.With the exception of ribozymes, nucleic acid molecules within cells primarily serve as storage of genetic information due to its ability to form complementary base pairs, which allows for high-fidelity copying and transfer of genetic information. In contrast, nucleic acid molecules are more limited in their catalytic ability, in comparison to protein enzymes, to just three types of interactions: hydrogen bonding, pi stacking, and metal-ion coordination. This is due to the limited number of functional groups of the nucleic acid monomers: while proteins are built from up to twenty different amino acids with various functional groups, nucleic acids are built from just four chemically similar nucleobases. In addition, DNA lacks the 2'-hydroxyl group found in RNA which limits the catalytic competency of deoxyribozymes even in comparison to ribozymes.In addition to the inherent inferiority of DNA catalytic activity, the apparent lack of naturally occurring deoxyribozymes may also be due to the primarily double-stranded conformation of DNA in biological systems which would limit its physical flexibility and ability to form tertiary structures, and so would drastically limit the ability of double-stranded DNA to act as a catalyst; though there are a few known instances of biological single-stranded DNA such as multicopy single-stranded DNA (msDNA), certain viral genomes, and the replication fork formed during DNA replication. Further structural differences between DNA and RNA may also play a role in the lack of biological deoxyribozymes, such as the additional methyl group of the DNA base thymidine compared to the RNA base uracil or the tendency of DNA to adopt the B-form helix while RNA tends to adopt the A-form helix. However, it has also been shown that DNA can form structures that RNA cannot, which suggests that, though there are differences in structures that each can form, neither is inherently more or less catalytic due to their possible structural motifs.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report