Structure and function of nucleases in DNA repair: shape
... many nucleases have been studied extensively. However, in some cases, it is very difficult to identify the actual functional targets of the nucleases, because of their broad substrate specificity. Nevertheless, many candidates for nucleases are available from various genome sequences, and their func ...
... many nucleases have been studied extensively. However, in some cases, it is very difficult to identify the actual functional targets of the nucleases, because of their broad substrate specificity. Nevertheless, many candidates for nucleases are available from various genome sequences, and their func ...
Identification of genes that are associated with DNA repeats in
... contrast, cas homologues were absent from any of the completely sequenced CRISPR-negative genomes, illustrating the strong association of cas genes and CRISPR loci (see Table 1). No CRISPR loci were identified in eukaryotic genomes and, as expected, no homologues of the cas genes were found in these ...
... contrast, cas homologues were absent from any of the completely sequenced CRISPR-negative genomes, illustrating the strong association of cas genes and CRISPR loci (see Table 1). No CRISPR loci were identified in eukaryotic genomes and, as expected, no homologues of the cas genes were found in these ...
Consensus Clustering for Binning Metagenome Sequences
... Binning methods has the task to group (bin) reads or contigs into their corresponding phylogenetic group. It is can divided into two categories based on the information to group the sequences: composition-based and similarity-based methods. Similarity- or homology-based binning use alignment tools a ...
... Binning methods has the task to group (bin) reads or contigs into their corresponding phylogenetic group. It is can divided into two categories based on the information to group the sequences: composition-based and similarity-based methods. Similarity- or homology-based binning use alignment tools a ...
`Candidatus Midichloria mitochondrii`, an endosymbiont of the tick
... chondrii’ was subjected to BLAST analysis and closely related, nearly full-length sequences were aligned, taking into account secondary structure, at the Ribosomal Database Project website (Cole et al., 2003). Phylogenetic analysis was performed under Bayesian Inference criteria using the MrBayes pr ...
... chondrii’ was subjected to BLAST analysis and closely related, nearly full-length sequences were aligned, taking into account secondary structure, at the Ribosomal Database Project website (Cole et al., 2003). Phylogenetic analysis was performed under Bayesian Inference criteria using the MrBayes pr ...
Complete Mitochondrial DNA Sequences of Six
... 2002; Vidal and Hedges 2002; Wilcox et al. 2002; Vidal and David 2004). These previous studies based on a few mitochondrial or nuclear genes, as well as immunological data partly confirmed the morphological view on snake phylogeny, but disagreed with it or with each other in several respects. There s ...
... 2002; Vidal and Hedges 2002; Wilcox et al. 2002; Vidal and David 2004). These previous studies based on a few mitochondrial or nuclear genes, as well as immunological data partly confirmed the morphological view on snake phylogeny, but disagreed with it or with each other in several respects. There s ...
Biological Natural Kinds
... biology. Ecologists often generalize over the kind predator. Yet there is no sense in which all predators form an individual. Predators are not predators in virtue of their integration with all other predators, nor are they localized or continuous in any interesting way. The same is true of all adre ...
... biology. Ecologists often generalize over the kind predator. Yet there is no sense in which all predators form an individual. Predators are not predators in virtue of their integration with all other predators, nor are they localized or continuous in any interesting way. The same is true of all adre ...
Borrelia burgdorferi sensu lato, the agent of Lyme
... (1996) were the first to demonstrate the feasibility to identify host DNA in ticks by using a PCR targeting part of the cytochrome B gene. Later, studies targeting the nuclear 18S rRNA gene (Pichon et al., 2003) and the 12S rDNA mitochondrial gene (Humair et al., 2007) were developed. The method bas ...
... (1996) were the first to demonstrate the feasibility to identify host DNA in ticks by using a PCR targeting part of the cytochrome B gene. Later, studies targeting the nuclear 18S rRNA gene (Pichon et al., 2003) and the 12S rDNA mitochondrial gene (Humair et al., 2007) were developed. The method bas ...
A new drug inactivates the helicase enzyme by binding to its active
... produced, but does not understand that the percentage of original DNA decreases after each subsequent round of replication. The student does not understand that the reason why the semi-conservative model of replication (diagram B) more accurately transmits heritable material is that separation of th ...
... produced, but does not understand that the percentage of original DNA decreases after each subsequent round of replication. The student does not understand that the reason why the semi-conservative model of replication (diagram B) more accurately transmits heritable material is that separation of th ...
Origin of Species - Biology Junction
... • The Hawaiian Archipelago, 3,500 miles from the nearest continent and composed of “young” volcanic islands, has experienced several examples of adaptive radiations by colonists. • Individuals were carried by ocean currents and winds from distant continents and islands or older islands in the archi ...
... • The Hawaiian Archipelago, 3,500 miles from the nearest continent and composed of “young” volcanic islands, has experienced several examples of adaptive radiations by colonists. • Individuals were carried by ocean currents and winds from distant continents and islands or older islands in the archi ...
Basic sequence analyses and submission
... Repeat the same process with the M13_R sequence. The other sequences (F1, F2, F3, R1 and R2) do not have vector because the primers were designed within the cloned segment. 5. Use BLAST 2 sequences to Align M13_F with F1 http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi (create a bookmark for thi ...
... Repeat the same process with the M13_R sequence. The other sequences (F1, F2, F3, R1 and R2) do not have vector because the primers were designed within the cloned segment. 5. Use BLAST 2 sequences to Align M13_F with F1 http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi (create a bookmark for thi ...
What Is a Species?
... 1. Allopatric speciation: geographic barriers can lead to the origin of species: • Several geological processes can fragment a population into two or more isolated populations. • Mountain ranges, glaciers, land bridges, or splintering of lakes may divide one population into isolated groups. ...
... 1. Allopatric speciation: geographic barriers can lead to the origin of species: • Several geological processes can fragment a population into two or more isolated populations. • Mountain ranges, glaciers, land bridges, or splintering of lakes may divide one population into isolated groups. ...
PDF - Timetree.org
... to tracheophytes, derived from the age of the oldest fossil pertaining to that divergence (2). The impact of different gene and codon position partitions, and that of including or excluding fossil-derived constraints on the ages of 20 nodes, was evaluated. Estimates were found to vary substantially ...
... to tracheophytes, derived from the age of the oldest fossil pertaining to that divergence (2). The impact of different gene and codon position partitions, and that of including or excluding fossil-derived constraints on the ages of 20 nodes, was evaluated. Estimates were found to vary substantially ...
METHODS TO DETECT SELECTION IN POPULATIONS WITH
... at the level of DNA is the challenge of finding its signal in a leaky, lossy medium. This chapter provides an overview of statistical approaches for detecting natural selection in DNA sequences. As already indicated, the distinction between a nucleotide variation that distinguishes two alleles from ...
... at the level of DNA is the challenge of finding its signal in a leaky, lossy medium. This chapter provides an overview of statistical approaches for detecting natural selection in DNA sequences. As already indicated, the distinction between a nucleotide variation that distinguishes two alleles from ...
Complete mitochondrial genome of a natural triploid
... a standard set of 22 tRNAs, 2 rRNAs, and 13 typical vertebrate protein-coding genes, as well as a putative non-coding control region (Figure 1, Table 2). Most of the genes were encoded on the heavy strand (H-strand), only ND6 and eight tRNA genes (tRNAPhe, tRNAGlu, tRNASer, tRNATyr, tRNACys, tRNAAsn ...
... a standard set of 22 tRNAs, 2 rRNAs, and 13 typical vertebrate protein-coding genes, as well as a putative non-coding control region (Figure 1, Table 2). Most of the genes were encoded on the heavy strand (H-strand), only ND6 and eight tRNA genes (tRNAPhe, tRNAGlu, tRNASer, tRNATyr, tRNACys, tRNAAsn ...
Structural analysis of both products of a reciprocal translocation
... c-rayc-IgH translocation s i t e s . A) Genoraic DNA from normal human polymorphonuclear c e l l s (control) and the B u r k i t t lymphona cell l i n e BL22 was d i gested with EcoRl, b l o t t e d , and hybridized with either a 5' break or c-myc probe. The map positions of these two probes on the ...
... c-rayc-IgH translocation s i t e s . A) Genoraic DNA from normal human polymorphonuclear c e l l s (control) and the B u r k i t t lymphona cell l i n e BL22 was d i gested with EcoRl, b l o t t e d , and hybridized with either a 5' break or c-myc probe. The map positions of these two probes on the ...
Acanthamoeba mitochondrial 16S rDNA sequences: inferred
... with the large majority of AK cases. This genotype encompasses at least five species that have been differentiated largely on the basis of morphology. However, because it is generally agreed that morphology alone is unreliable for classification of this organism, there is a need for other markers th ...
... with the large majority of AK cases. This genotype encompasses at least five species that have been differentiated largely on the basis of morphology. However, because it is generally agreed that morphology alone is unreliable for classification of this organism, there is a need for other markers th ...
doc
... A. Number of matches one can expect due to chance. B. Probability of obtaining a match of that quality due to chance. C. Number of standard deviations a match is above mean, generated by randomizing sequences. D. The measure derived from primary sequence similarity divided by the length of the matc ...
... A. Number of matches one can expect due to chance. B. Probability of obtaining a match of that quality due to chance. C. Number of standard deviations a match is above mean, generated by randomizing sequences. D. The measure derived from primary sequence similarity divided by the length of the matc ...
Diversity within the current algal species Prototheca zopfii: a
... were originally isolated by R. Blaschke-Hellmessen. In addition, one strain (LZ 5) was isolated from a clinical case of severe mastitis in a lactating cow. More recently, this strain has been used as an ELISA antigen for the serological diagnosis of bovine protothecal mastitis (Roesler et al., 2001) ...
... were originally isolated by R. Blaschke-Hellmessen. In addition, one strain (LZ 5) was isolated from a clinical case of severe mastitis in a lactating cow. More recently, this strain has been used as an ELISA antigen for the serological diagnosis of bovine protothecal mastitis (Roesler et al., 2001) ...
Molecular Evolution of the CMT1A-REP Region: A Human
... 1A (CMT1A) and hereditary neuropathy with liability to pressure palsies (HNPP). Previous molecular hybridization studies with CMT1A-REP sequences suggested that two copies of the repeat are also found in the chimpanzee, raising the possibility that this unique repeat arose during primate evolution. ...
... 1A (CMT1A) and hereditary neuropathy with liability to pressure palsies (HNPP). Previous molecular hybridization studies with CMT1A-REP sequences suggested that two copies of the repeat are also found in the chimpanzee, raising the possibility that this unique repeat arose during primate evolution. ...
molecular phylogeny of the haplosporidia based on
... SSU rRNA gene sequence for Haplosporidium pickfordi required several amplifications using specific primers: HAP-F1 (Renault et al., 2000) and 16S-B; 16S-A and MpickSSU391 (GCTTATTCAATCGGTAGGAGC); 16S-A and MpickSSU280 (CAATCGTCTATCCCCACTTG); Mpick125F (AACCGTGGTAACTCCAGGG) and Mpick1450R (TTATTGCCCC ...
... SSU rRNA gene sequence for Haplosporidium pickfordi required several amplifications using specific primers: HAP-F1 (Renault et al., 2000) and 16S-B; 16S-A and MpickSSU391 (GCTTATTCAATCGGTAGGAGC); 16S-A and MpickSSU280 (CAATCGTCTATCCCCACTTG); Mpick125F (AACCGTGGTAACTCCAGGG) and Mpick1450R (TTATTGCCCC ...
Phylogenetic history underlies elevational biodiversity patterns in
... present a new phylogeny for the group based on DNA sequences from all 13 genera and 137 species. Using this phylogeny, we find no relationship between rates of diversification of clades and their elevational distribution, and no evidence for a rapid ‘species pump’ in tropical montane regions. Instea ...
... present a new phylogeny for the group based on DNA sequences from all 13 genera and 137 species. Using this phylogeny, we find no relationship between rates of diversification of clades and their elevational distribution, and no evidence for a rapid ‘species pump’ in tropical montane regions. Instea ...