CHROMOTHRIPSIS FROM DNA DAMAGE IN MICRONUCLEI The
									
... We developed a method to determine loss-of-heterozygosity (LOH) in single-cell genomes (Methods) that is insensitive to the amplification bias inherent to MDA20. This analysis confirmed genuine monosomy of chromosomes in the minus daughters of 2:1 missegregations (Extended Data Fig. 2a-c). From the ...
                        	... We developed a method to determine loss-of-heterozygosity (LOH) in single-cell genomes (Methods) that is insensitive to the amplification bias inherent to MDA20. This analysis confirmed genuine monosomy of chromosomes in the minus daughters of 2:1 missegregations (Extended Data Fig. 2a-c). From the ...
									Characterization of the chimeric seven
									
... Recently, many PR-like genes were found in non-marine environments. The goal of this study is to explore the function of rhodopsins that exist only as partial proteoopsin genes using chimeras with marine green PR (GPR). We isolated nine partial genes of PR homologues using polymerase chain reaction ...
                        	... Recently, many PR-like genes were found in non-marine environments. The goal of this study is to explore the function of rhodopsins that exist only as partial proteoopsin genes using chimeras with marine green PR (GPR). We isolated nine partial genes of PR homologues using polymerase chain reaction ...
									Introduction
									
... The primary aim of this project is to investigate the functions of two possible pollen specific genes, AT1G10090 and AT1G03250, in A. thaliana using SALK insertion lines. Following the more general aims described above I would then go on to say…more specifically in this project I aim to …then bullet ...
                        	... The primary aim of this project is to investigate the functions of two possible pollen specific genes, AT1G10090 and AT1G03250, in A. thaliana using SALK insertion lines. Following the more general aims described above I would then go on to say…more specifically in this project I aim to …then bullet ...
									transposon
									
... is given the prefix IS, followed by a number that identifies the type.  The IS elements are normal constituents of bacterial chromosomes and plasmids. To describe an insertion into a particular site, a double colon is used; so λ::IS1 describes an IS1 element inserted into phage lambda.  The IS ele ...
                        	... is given the prefix IS, followed by a number that identifies the type.  The IS elements are normal constituents of bacterial chromosomes and plasmids. To describe an insertion into a particular site, a double colon is used; so λ::IS1 describes an IS1 element inserted into phage lambda.  The IS ele ...
									Control of DNA excision efficiency in Paramecium
									
... micronuclei undergo meiosis, whereas the macronuclei degenerate. The fusion of two gametic nuclei produces a zygotic nucleus. This nucleus divides twice and the daughter nuclei then differentiate into a micronucleus or a macronucleus. In the second case, the whole genome is processed through chromos ...
                        	... micronuclei undergo meiosis, whereas the macronuclei degenerate. The fusion of two gametic nuclei produces a zygotic nucleus. This nucleus divides twice and the daughter nuclei then differentiate into a micronucleus or a macronucleus. In the second case, the whole genome is processed through chromos ...
									Taxonomic characterization of Ochrobactrum sp. isolates from soil
									
... from isolate 1a, SCII24T, OgA9aT, OiC8a, OiC8-6, LMG 5140, CLM14 and CLM18 was amplified by PCR using primers rD1 and fD1 (Weisburg et al., 1991). Amplificates of isolate 1a, SCII24T, OgA9aT, OiC8a and OiC8-6 were purified by low-melting agarose gel electrophoresis and sequenced following the dideox ...
                        	... from isolate 1a, SCII24T, OgA9aT, OiC8a, OiC8-6, LMG 5140, CLM14 and CLM18 was amplified by PCR using primers rD1 and fD1 (Weisburg et al., 1991). Amplificates of isolate 1a, SCII24T, OgA9aT, OiC8a and OiC8-6 were purified by low-melting agarose gel electrophoresis and sequenced following the dideox ...
									phylogenetic analysis of the rompb genes of rickettsia felis and
									
... (TCTGGTCCCGGTAACGTAGTGGT, positions 2759– 2902) and Rp 2902r (ATACTGTTATCACTTCCAAGCGAT, positions 2925–2902); and Rp 2902f (ATCGCTTGGAAGTGATAACAGTAT, positions 2902–2925) and Rp 5003r (CTTTTAAAGTACCTTGATGTGC, positions 5024–5003). We also used a R. felis-specific primer, Rfe 5049 (GTCTTATAATATAGGCTT ...
                        	... (TCTGGTCCCGGTAACGTAGTGGT, positions 2759– 2902) and Rp 2902r (ATACTGTTATCACTTCCAAGCGAT, positions 2925–2902); and Rp 2902f (ATCGCTTGGAAGTGATAACAGTAT, positions 2902–2925) and Rp 5003r (CTTTTAAAGTACCTTGATGTGC, positions 5024–5003). We also used a R. felis-specific primer, Rfe 5049 (GTCTTATAATATAGGCTT ...
									PDF
									
... In this study, we employed several methods to minimize the frequency of incorrect alignments. These included amino acid-guided methods (see methods section) to anchor the coding regions of a paralogous gene pair (TCOFFEE), alignment using explicit models of indel evolution (MCALIGN2), and the use of ...
                        	... In this study, we employed several methods to minimize the frequency of incorrect alignments. These included amino acid-guided methods (see methods section) to anchor the coding regions of a paralogous gene pair (TCOFFEE), alignment using explicit models of indel evolution (MCALIGN2), and the use of ...
									A versatile toolbox for PCR-based tagging of yeast genes: new
									
... used and fast method to label proteins in vivo in the yeast Saccharomyces cerevisiae. This strategy directs the amplified tags to the desired chromosomal loci due to flanking homologous sequences provided by the PCR-primers, thus enabling the selective introduction of any sequence at any place of a ...
                        	... used and fast method to label proteins in vivo in the yeast Saccharomyces cerevisiae. This strategy directs the amplified tags to the desired chromosomal loci due to flanking homologous sequences provided by the PCR-primers, thus enabling the selective introduction of any sequence at any place of a ...
									Analysis of acid-induced asr gene promoter of Enterobacteriaceae
									
... Deletion analysis of asr promoter region upstream the proposed pho box. In order to identify potential cis-regulatory sites in the asr promoter, deletion analysis of the DNA region upstream the –40 position was performed. The consecutive promoter deletions (p∆70, p∆37, p∆20, p∆21, p∆10, p∆4, p∆1 in ...
                        	... Deletion analysis of asr promoter region upstream the proposed pho box. In order to identify potential cis-regulatory sites in the asr promoter, deletion analysis of the DNA region upstream the –40 position was performed. The consecutive promoter deletions (p∆70, p∆37, p∆20, p∆21, p∆10, p∆4, p∆1 in ...
									ARTICLES - Weizmann Institute of Science
									
... Eukaryotic genomes are packaged into nucleosome particles that occlude the DNA from interacting with most DNA binding proteins. Nucleosomes have higher affinity for particular DNA sequences, reflecting the ability of the sequence to bend sharply, as required by the nucleosome structure. However, it ...
                        	... Eukaryotic genomes are packaged into nucleosome particles that occlude the DNA from interacting with most DNA binding proteins. Nucleosomes have higher affinity for particular DNA sequences, reflecting the ability of the sequence to bend sharply, as required by the nucleosome structure. However, it ...
									Molecular Identification of Vibrio harveyi From Larval Stage of
									
... Because of the very close phylogenetic relationship of V. harveyi to other Vibrio Downloaded from jifro.ir at 19:45 +0430 on Wednesday May 3rd 2017 ...
                        	... Because of the very close phylogenetic relationship of V. harveyi to other Vibrio Downloaded from jifro.ir at 19:45 +0430 on Wednesday May 3rd 2017 ...
									Compaction of Duplex Nucleic Acids upon Native
									
... duplex, the major charge states are 4- for the 10-bp, 5for the 12-bp, 7- for the 24-bp, 8- and 9- for the 36-bp duplexes. Higher charge states were generated by adding 0.2% to 0.75% sulfolane to the solution. ESI-IMSMS experiments were recorded on an Agilent 6560 IMS-Q-TOF, with the drift tube opera ...
                        	... duplex, the major charge states are 4- for the 10-bp, 5for the 12-bp, 7- for the 24-bp, 8- and 9- for the 36-bp duplexes. Higher charge states were generated by adding 0.2% to 0.75% sulfolane to the solution. ESI-IMSMS experiments were recorded on an Agilent 6560 IMS-Q-TOF, with the drift tube opera ...
									International Journal of Antimicrobial Agents ksgA mutations confer
									
... the growth of a wide variety of microorganisms, with reported low toxicity against plants, humans and other animals [2,4,5]. However, as an aminoglycoside, some degree of nephrotoxicity and ototoxicity is expected. Several Gram-negative bacteria, including Pseudomonas spp. and Escherichia coli strai ...
                        	... the growth of a wide variety of microorganisms, with reported low toxicity against plants, humans and other animals [2,4,5]. However, as an aminoglycoside, some degree of nephrotoxicity and ototoxicity is expected. Several Gram-negative bacteria, including Pseudomonas spp. and Escherichia coli strai ...
									IMPROVE SMALL RNA-MEDIATED GENE SILENCING
									
... piece of RNA silencing puzzle in plants (Baumberger and Baulcombe 2005; Eamens et al. 2008): that is, following the formation of dsRNA from single-stranded sense RNA by RNA-dependent RNA polymerase (RdRP), a Dicer-like (DCL) protein recognize and process that dsRNA into different classes of siRNAs f ...
                        	... piece of RNA silencing puzzle in plants (Baumberger and Baulcombe 2005; Eamens et al. 2008): that is, following the formation of dsRNA from single-stranded sense RNA by RNA-dependent RNA polymerase (RdRP), a Dicer-like (DCL) protein recognize and process that dsRNA into different classes of siRNAs f ...
									Epigenetic inheritance of acquired traits through sperm RNAs and
									
... Acquisitive sperm — information flow The production of functional sperm begins with spermatogenesis in the testis, which is followed by matur ation in the epididymis; each stage involves complex Box 2 | Transvection and paramutation in mice Transvection occurs during chromosome pairing such as dur ...
                        	... Acquisitive sperm — information flow The production of functional sperm begins with spermatogenesis in the testis, which is followed by matur ation in the epididymis; each stage involves complex Box 2 | Transvection and paramutation in mice Transvection occurs during chromosome pairing such as dur ...
									Proof-of-principle rapid noninvasive prenatal diagnosis
									
... take hold in the clinical setting, it will be necessary to develop universal methodologies that apply to the diagnosis of any mutation, maternal or paternal, regardless of inheritance. Although some universal techniques for NIPD have already been described, each one requires time-consuming and sophi ...
                        	... take hold in the clinical setting, it will be necessary to develop universal methodologies that apply to the diagnosis of any mutation, maternal or paternal, regardless of inheritance. Although some universal techniques for NIPD have already been described, each one requires time-consuming and sophi ...
									mMESSAGE mMACHINE® Kit User Guide
									
... mMESSAGE mMACHINE® Kits are designed for the in vitro synthesis of large amounts of capped RNA. Capped RNA mimics most eukaryotic mRNAs found in vivo, because it has a 7-methyl guanosine cap structure at the 5' end. mMESSAGE mMACHINE® Kit reactions include cap analog [m7G(5')ppp(5')G] in an ultra hi ...
                        	... mMESSAGE mMACHINE® Kits are designed for the in vitro synthesis of large amounts of capped RNA. Capped RNA mimics most eukaryotic mRNAs found in vivo, because it has a 7-methyl guanosine cap structure at the 5' end. mMESSAGE mMACHINE® Kit reactions include cap analog [m7G(5')ppp(5')G] in an ultra hi ...
									Designing synthetic MLPA probes - MRC
									
... Methylation-specific MLPA (MS-MLPA) probes are similar to the normal DNA probes, but contain a Hha1 restriction site in their hybridising sequence. The Hha1 enzyme cuts DNA at GCGC unless the first C of the CGCG restriction site of the target DNA is methylated. By adding the HhaI enzyme together wit ...
                        	... Methylation-specific MLPA (MS-MLPA) probes are similar to the normal DNA probes, but contain a Hha1 restriction site in their hybridising sequence. The Hha1 enzyme cuts DNA at GCGC unless the first C of the CGCG restriction site of the target DNA is methylated. By adding the HhaI enzyme together wit ...
									A RARE KEL17/KEL(IVS3+1G>A) COMPOUND HETEROZYGOUS
									
... groups know. Among them Kell(KEL1), Kp (KEL3), and Js (KEL6) are well known. The antithetic antigens KEL11/17 further contribute to this list. However, KEL17 is considered as very rare, with an approximte frequency of one KEL17 homozygote among 30’000 Europeans only (Daniels G, Human Blood Groups, 2 ...
                        	... groups know. Among them Kell(KEL1), Kp (KEL3), and Js (KEL6) are well known. The antithetic antigens KEL11/17 further contribute to this list. However, KEL17 is considered as very rare, with an approximte frequency of one KEL17 homozygote among 30’000 Europeans only (Daniels G, Human Blood Groups, 2 ...
									reproductive cell fate transition in plants - Development
									
... at 18-20°C in a plant growth chamber or greenhouse, except for the mutants ago9-4, sgs3-11 and rdr6-2 (Olmedo-Monfil et al., 2010), which were grown at 23°C in a growth incubator (Percival). The GFP lines shown Fig. 2 and supplementary material Fig. S1 are the following: HTR5-GFP is pHTR5::HTR5-GFP ...
                        	... at 18-20°C in a plant growth chamber or greenhouse, except for the mutants ago9-4, sgs3-11 and rdr6-2 (Olmedo-Monfil et al., 2010), which were grown at 23°C in a growth incubator (Percival). The GFP lines shown Fig. 2 and supplementary material Fig. S1 are the following: HTR5-GFP is pHTR5::HTR5-GFP ...
									Chapter 4 - DORAS
									
... by the transconjugants. A 1/50 dilution of E. coli overnight cultures, which had been grown in LB broth and the appropriate antibiotics, was used to inoculate 5 ml aliquots of M63 minimal media (section 2.2). These M63 cultures were then incubated at 37oC overnight and used to seed the M63 bioassays ...
                        	... by the transconjugants. A 1/50 dilution of E. coli overnight cultures, which had been grown in LB broth and the appropriate antibiotics, was used to inoculate 5 ml aliquots of M63 minimal media (section 2.2). These M63 cultures were then incubated at 37oC overnight and used to seed the M63 bioassays ...
Bisulfite sequencing
                        Bisulphite sequencing (also known as bisulfite sequencing) is the use of bisulphite treatment of DNA to determine its pattern of methylation. DNA methylation was the first discovered epigenetic mark, and remains the most studied. In animals it predominantly involves the addition of a methyl group to the carbon-5 position of cytosine residues of the dinucleotide CpG, and is implicated in repression of transcriptional activity.Treatment of DNA with bisulphite converts cytosine residues to uracil, but leaves 5-methylcytosine residues unaffected. Thus, bisulphite treatment introduces specific changes in the DNA sequence that depend on the methylation status of individual cytosine residues, yielding single- nucleotide resolution information about the methylation status of a segment of DNA. Various analyses can be performed on the altered sequence to retrieve this information. The objective of this analysis is therefore reduced to differentiating between single nucleotide polymorphisms (cytosines and thymidine) resulting from bisulphite conversion (Figure 1).