• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Transamination and asymmetry in glutamate transport across the
Transamination and asymmetry in glutamate transport across the

... Alanine washout from the vascularly preloaded epithelium (mean Kexit [fast, unstripped] = 0.181 + 0.051 min -t) is similar to exit from t h e e p i t h e l i u m a f t e r loading from the lumen (mean Kexit [fas% unstripped] = 0.150 + 0.008 min-t). However~ glutamate washout from t h e v a s c u l a ...
Characters of Chymosin Gene Isolated from Different Animal A. G. Attallah
Characters of Chymosin Gene Isolated from Different Animal A. G. Attallah

... of buffalo chymosin may be presumed to be caused by the presence of similar of isozymes, where buffaloes and cattle are close to each other on the evolutionary ladder, and belonging to the same family. Other investigators have also observed that the presence of different electrophoretically distingu ...
ENZYMES - Victor Temple
ENZYMES - Victor Temple

Mitochondrial trans-2-Enoyl-CoA Reductase of Wax Ester
Mitochondrial trans-2-Enoyl-CoA Reductase of Wax Ester

... (Mini-Prepcell, Bio-Rad), electrophoresed at 250 V, and proteins were eluted at 100 ␮l/min in buffer G (50 mM Tris, 25 mM borate, pH 8.7, 1 mM EDTA, 1 mM DTT, 1 ␮M FAD). Fractions of 200 ␮l were collected, fractions with TER activity were dialyzed against buffer H (10 mM Tris-HCl, pH 8.0, 150 mM NaC ...
Deciphering the molecular basis of the specificity of protein
Deciphering the molecular basis of the specificity of protein

... determine their amino acid preferences. Two datasets have been examined. Firstly, one composed of non-covalently bound carbohydrates ligands. The results of this analysis is compared to the second dataset, obtained from the study of the spatial vicinity of the monosaccharides that form the common st ...
Soybean Meal – An Exceptional Protein Source
Soybean Meal – An Exceptional Protein Source

... Soybean meal has long been considered an outstanding source of supplemental protein in diets for livestock and poultry. In fact, soybean meal is sometimes referred to as the "gold standard" because other protein sources are often compared to it. Soybean meal is rich in highly digestible protein, and ...
Chapter 10 Enzymes - Angelo State University
Chapter 10 Enzymes - Angelo State University

Malonate decarboxylase of Pseudomonas putida is composed of
Malonate decarboxylase of Pseudomonas putida is composed of

... enzyme protein composed of the ¢ve subunits from the inactive form composed of the four subunits. These phenomena account for 83% loss of the cyclic decarboxylation activity at the step of the ButylToyopearl 650S column chromatography. In the earlier report from this laboratory [2], the subunit comp ...
Purification and Characterization of
Purification and Characterization of

... agarose-Reactive Green 19 (Fig. 1B). This last step in PRK isolation resulted in a highly enriched preparation (218 units mg21 protein) that was stored under N2 at 270°C in the presence of glycerol, leupeptin, and DTT for at least 1 month without appreciable loss of activity. All PRK enzymes observe ...
The Role in Translation of Editing and Multi
The Role in Translation of Editing and Multi

... that MSCs may interact directly with translating ribosomes. In support of this hypothesis, the aaRS activities of the MSC were enriched in isolated T. kodakarensis polysome fractions. These in vivo data indicate that components of the archaeal protein synthesis machinery associate into macromolecul ...
Some Structural and Kinetic Aspects of L
Some Structural and Kinetic Aspects of L

... binding of PEP to A domain of PK subunit. Also M2, R and L isoenzymes exhibit a sigmoidal kinetics toward the substrate PEP. This means that this substrate is at the same time homotropic cooperativity effector (Munoz & Ponce, 2003; Gunasekaran et al., 2004; Koshland & Hamadani, 2002; Ainslie et al., ...
Conclusion - Federal Register of Legislation
Conclusion - Federal Register of Legislation

... to compare it to conventional corn under typical cultivation conditions. No differences of biological significance were observed between MIR162 corn and its conventional counterpart. Food from insect-protected MIR162 corn is therefore considered to be compositionally equivalent to food from conventi ...
Structural and Biochemical Characterization of a Bifunctional
Structural and Biochemical Characterization of a Bifunctional

... AAACTCGAGGTTTTGTCTCATTTGTTTAAAAGTTGAATAATCACGAATGTAATCATCAGAATCATAGTAATGAG added NdeI and XhoI cloning sites, respectively. The purified PCR product was subsequently Atailed and ligated into the pGEM-T vector (Promega), which was used to transform DH5-α Escherichia coli cells for subsequent screening ...
DOC-file of additional text
DOC-file of additional text

... IV. Receiver Operating Characteristic Curve (ROC) method Two values were assigned to each E. coli metabolic gene: a binary variable representing presence or absence of the gene in a given Buchnera genome, and the number of occurrences of the gene in 500 simulated reduced genomes. For each cut-off ( ...


... bone metastases. The degree of expression of BSP by the tumor closely correlates With the severity of the cancer (Wal tregny D. et al., Increased expression ofbone sialoprotein in ...
Bacillus cereus
Bacillus cereus

... B. megaterium has often been used in the laboratory, and is used as an industrial organism that is able to produce a variety of proteins and sources of bioremediation. Bacillus megaterium is a good source of industrial proteins because it is both a desirable cloning host and produces a large variat ...
FORMATTED - revised ENZYMology
FORMATTED - revised ENZYMology

... in the active site. The range of specificity varies between enzymes. Some enzymes show group specificity i.e. they catalyze a reaction involving particular chemical group e.g. alcohol dehydrogenase, which will catalyze the oxidation of a variety of alcohols e.g. ethanol, acetaldehyde,lactic acid etc ...
Limonene_Synthase-Plant Physiol.-1999-Turner-879-86
Limonene_Synthase-Plant Physiol.-1999-Turner-879-86

... The plasmid pLC 5.2 encoding the presumptive limonene synthase preprotein (Colby et al., 1993) was linearized and transcribed with T3 RNA polymerase. Limonene synthase was then translated in the presence of [35S]Met using a nuclease-treated rabbit reticulocyte lysate system according to the manufact ...
Leukaemia Section t(2;19)(p12;q13) IGK/BCL3, t(14;19)(q32;q13) IGH/BCL3, t(19;22)(q13;q11) BCL3/IGL Atlas of Genetics and Cytogenetics
Leukaemia Section t(2;19)(p12;q13) IGK/BCL3, t(14;19)(q32;q13) IGH/BCL3, t(19;22)(q13;q11) BCL3/IGL Atlas of Genetics and Cytogenetics

... COMPLEX TRANSLOCATIONS: Three way "variants" are relatively frequent, compared to variants in other recurrent translocations. t(14;17;19) and t(7;19;14) were described. ...
Diversity of Amyloid Motifs in NLR Signaling in Fungi
Diversity of Amyloid Motifs in NLR Signaling in Fungi

... activity in contrast to TIR and death-fold family domains which function as adaptor domains. NB-ARC and NACHT domains can be found in almost all combinations with the various types of N-terminal effector domains and WD, ANK or TPR domains, suggesting that the different domain architectures arise fro ...
Cloning and sequence analysis of cnaA gene encoding the catalytic
Cloning and sequence analysis of cnaA gene encoding the catalytic

... to study its function in detail. While earlier reports of calcineurin A from ¢lamentous fungi suggested its requirement for hyphal growth and cell cycle regulation [5,6], a putative role of this protein phosphatase in sporulation, salt stress response and the alkaline pH-mediated signal transduction ...
Early events in protein folding
Early events in protein folding

... polypeptide chain searches out its final native conformation from an inconceivably large number of available conformations. A polypeptide chain of 101 amino acid residues would have to sample 3100 = 5 × 1047 conformations, if each bond connecting two consecutive residues has only three possible conf ...
The Emerging Role of Branched-Chain Amino Acids in Insulin
The Emerging Role of Branched-Chain Amino Acids in Insulin

ARIUS MACULATUS EAST COAST OF INDIA
ARIUS MACULATUS EAST COAST OF INDIA

... Heussen and Dowdle [16]. Briefly, 2 mg/ml (w/v) substrate was incorporated in the 10% resolving gel with a 4% stacking gel. The sample (10 mg) was loaded in non-reducing sample buffer. After electrophoresis the SDS was removed by washing the gel twice for 20 min in 2.5% Triton X-100 before incubatio ...
Isoenzymes in Clinical Diagnosis
Isoenzymes in Clinical Diagnosis

... Downloaded from http://circ.ahajournals.org/ by guest on June 14, 2017 ...
< 1 ... 18 19 20 21 22 23 24 25 26 ... 592 >

Western blot



The western blot (sometimes called the protein immunoblot) is a widely used analytical technique used to detect specific proteins in a sample of tissue homogenate or extract. It uses gel electrophoresis to separate native proteins by 3-D structure or denatured proteins by the length of the polypeptide. The proteins are then transferred to a membrane (typically nitrocellulose or PVDF), where they are stained with antibodies specific to the target protein. The gel electrophoresis step is included in western blot analysis to resolve the issue of the cross-reactivity of antibodies.There are many reagent companies that specialize in providing antibodies (both monoclonal and polyclonal antibodies) against tens of thousands of different proteins. Commercial antibodies can be expensive, although the unbound antibody can be reused between experiments. This method is used in the fields of molecular biology, immunogenetics and other molecular biology disciplines. A number of search engines, such as CiteAb, Antibodypedia, and SeekProducts, are available that can help researchers find suitable antibodies for use in western blotting.Other related techniques include dot blot analysis, immunohistochemistry and immunocytochemistry where antibodies are used to detect proteins in tissues and cells by immunostaining, and enzyme-linked immunosorbent assay (ELISA).The method originated in the laboratory of Harry Towbin at the Friedrich Miescher Institute. The name western blot was given to the technique by W. Neal Burnette and is a play on the name Southern blot, a technique for DNA detection developed earlier by Edwin Southern. Detection of RNA is termed northern blot and was developed by George Stark at Stanford.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report