• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
S C  T
S C T

... A detailed topology mapping is also reported for the Escherichia coli inner membrane chloride channel YadQ, a protein for which the X-ray structure is known. Our results provide a critical test of the reporter fusion approach and offer new insights into the YadQ folding pathway. In summary, the resu ...
Predicting Protein Stability Changes upon Mutation Using Database
Predicting Protein Stability Changes upon Mutation Using Database

Mechanisms of potential novel antimalarials and Plasmodium falciparum  Denise Steyn
Mechanisms of potential novel antimalarials and Plasmodium falciparum Denise Steyn

... highest number of global deaths occurring in Africa, India and Southeast Asia. Even though artemisinin-derivative combination therapies are readily available in Africa there are numerous reports of poor quality products which may lead to the development of drug resistance in Plasmodium parasites. Ot ...
FOG1 recruits the NuRD repressor complex to mediate
FOG1 recruits the NuRD repressor complex to mediate

LIPID METABOLISM - Orange Coast College
LIPID METABOLISM - Orange Coast College

... Transported to liver or kidney  Converted to dihydroxyacetone ...
Auxin and other signals on the move in plants Auxins are a class of
Auxin and other signals on the move in plants Auxins are a class of

... development of the plant itself. Without hormonal regulation and organization, plants would be merely proliferating heaps of similar cells. Auxin employment begins in the embryo of the plant, where directional distribution of auxin ushers in subsequent growth and development of primary growth poles, ...
Brucella Quorum Sensing: much more than
Brucella Quorum Sensing: much more than

... carrier protein (ACP) conjugates (Schaefer et al., 1996). LuxI enzymes use SAM, not as methyl donor, but as provider of the homoserine lactone ring. In brief, binding of SAM by LuxI initiates the reaction. Subsequently, acyl-ACP binds to the enzyme complex, followed by amide bond formation and the r ...
REVIEWS
REVIEWS

... global regulators. Recent work has established that some of these global regulators are also integrated into a larger regulatory scheme by which the cell (Bacillus subtilis in this Review) coordinates the flow through key metabolic intersections in response to a small number of specific signalling m ...
Ribosomes slide on lysine-encoding homopolymeric A stretches
Ribosomes slide on lysine-encoding homopolymeric A stretches

... eLife digest Genes provide the instructions to assemble proteins from smaller molecules called amino acids. When a gene is ‘switched on’, the DNA that makes up the gene is copied into messenger ribonucleic acid (or mRNA) molecules, composed of building blocks called nucleotides. There are four types ...
amino-acids - ChemConnections
amino-acids - ChemConnections

... light to the left is called L- (laevus = “left”) and the other enantiomer is called D- (dexter = right). Enantiomers have identical physical and chemical properties. They only differ in their interaction with ...
Single Processing Center Models for Human Dicer and Bacterial
Single Processing Center Models for Human Dicer and Bacterial

... processing of both strands in the central region of the substrate has taken place. The requirement for the primary processing event explains why no labeled products diagnostic of the cleavage at complementary sites on opposite RNA strands could be identified (Supplemental Figure S3 available on Cell ...
The Presence and Function of Cytochromes in
The Presence and Function of Cytochromes in

Analysis of the Role of Mitochondria of Sake in Fermentation Technologies
Analysis of the Role of Mitochondria of Sake in Fermentation Technologies

... some fungi, nitrate and nitrite are used as electron acceptors to produce mitochondrial electron potential, which leads to ATP synthesis through complex V (Takaya 2009). In Saccharomyces cerevisiae, cytochrome oxidase has been reported to reduce nitrite, which produces nitric oxide (NO) and mitochon ...
Solution Structure of the Tandem Acyl Carrier Protein Domains from
Solution Structure of the Tandem Acyl Carrier Protein Domains from

... ACP5, was found to have a lower UMA score although it was identified in the BLASTP search, possibly suggesting that the fifth ACP domain may not be as conserved or may be more hydrophobic than the other domains. Interestingly, the UMA bioinformatic tool identified a region (residues H1771–R1791) wit ...
The green fluorescent protein: discovery
The green fluorescent protein: discovery

... the chemotactic swimming responses of bacteria (Kalir et al., 2001). By expressing full-length GFP-tagged proteins from their endogenous chromosomal locations at natural levels, it has become feasible to monitor the intracellular location and concentration spectrum of the whole proteasome of differe ...
Chemistry 1010
Chemistry 1010

... – 9000 different proteins in a cell – Individual human being >100,000 different – Fibrous Protein • Insoluble in H2O • Used mainly for structural purposes ...
Biochemical, biophysical and interaction studies of the stress
Biochemical, biophysical and interaction studies of the stress

pdf file - John Innes Centre
pdf file - John Innes Centre

... The template was pJT5, and after digestion with NdeI and BstXI, the mutated fragment was cloned into NdeI–BstXI-cut pJT5 to give pJT6. To construct pESV2, first the DraI fragment from pSU18 (16) replaced the equivalent fragment in pACYC184 to obtain an “EcoRI-free” version of the vector, designated ...
EnvZ is not essential for the upregulation of OmpC following
EnvZ is not essential for the upregulation of OmpC following

Brief Report - The Journal of Cell Biology
Brief Report - The Journal of Cell Biology

... 738 of TRAP onwards, and 39 primer P012 (59 CGCTTAATTAACAACAATACCCTTTTCATCATCTGC 39) that hybridizes at the 39 end of TRAP and introduces a stop codon as well as a PacI restriction site (bolded). The resulting PCR product was then cloned into plasmid pCRScriptSK, yielding plasmid pDS1. The 39 UTR of ...
A Simple and Rapid Protocol for Producing Yeast Extract from
A Simple and Rapid Protocol for Producing Yeast Extract from

... for the complete removal of the cell debris. The supernatant was applied to spray dryer to obtain powdered yeast extract. Assessment of bacterial cell growth in solid and liquid media E. coli DH5α and Staphylococcus aureus, as the representatives for gram negative and gram positive bacterial types, ...
Substrate recognition by nonribosomal peptide
Substrate recognition by nonribosomal peptide

A fluxsensing mechanism could regulate the switch between
A fluxsensing mechanism could regulate the switch between

... have not yet identified specific sensors. The question is whether we simply do not know them yet or whether cells recognize these metabolites in a different way. An alternative way to sense the presence of a certain carbon source would be by measuring the metabolic flux that is derived from its degr ...
Comparison of Methods for Estimating Unbound Intracellular
Comparison of Methods for Estimating Unbound Intracellular

Endoplasmic Reticulum Export Sites and Golgi Bodies Behave as
Endoplasmic Reticulum Export Sites and Golgi Bodies Behave as

... characterized. A widely accepted model for ER-to-Golgi transport is based on the sequential action of COPII and COPI coat complexes. The COPII complex assembles by the ordered recruitment of cytosolic components on the ER membrane. Here, we have visualized two early components of the COPII machinery ...
< 1 ... 20 21 22 23 24 25 26 27 28 ... 399 >

Magnesium transporter

This page links directly from the magnesium in biological systems page.Magnesium transporters are proteins that transport magnesium across the cell membrane. All forms of life require magnesium, yet the molecular mechanisms of Mg2+ uptake from the environment and the distribution of this vital element within the organism are only slowly being elucidated.In bacteria, Mg2+ is probably mainly supplied by the CorA protein and, where the CorA protein is absent, by the MgtE protein. In yeast the initial uptake is via the Alr1p and Alr2p proteins, but at this stage the only internal Mg2+ distributing protein identified is Mrs2p. Within the protozoa only one Mg2+ transporter (XntAp) has been identified. In metazoa, Mrs2p and MgtE homologues have been identified, along with two novel Mg2+ transport systems TRPM6/TRPM7 and PCLN-1. Finally, in plants, a family of Mrs2p homologues has been identified along with another novel protein, AtMHX.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report