Transport of proteins across mitochondrial membranes
... the very abundant IM proteins ADP/ATP carrier (AAC) and phosphate carrier (PiC) [12, 29, 64]. In the absence of MOM72 these proteins can be imported via MOM19. Deletion of MOM72 in yeast had very little effect on the growth of cells or the formation of mitochondria [66]. Thus, the mitochondrial surf ...
... the very abundant IM proteins ADP/ATP carrier (AAC) and phosphate carrier (PiC) [12, 29, 64]. In the absence of MOM72 these proteins can be imported via MOM19. Deletion of MOM72 in yeast had very little effect on the growth of cells or the formation of mitochondria [66]. Thus, the mitochondrial surf ...
A mutation in the Zn-finger of the GAL4 homolog
... four possible combinations of two LAC9 gene copies as outlined in Figure 5A. The Southern blot (Figure 5B) shows that not more than one plasmid copy had been integrated since the intensity of the HindUl fragment of 2.7 kb and 3.1 kb resulting from plasmid and flanking sequences, respectively, were a ...
... four possible combinations of two LAC9 gene copies as outlined in Figure 5A. The Southern blot (Figure 5B) shows that not more than one plasmid copy had been integrated since the intensity of the HindUl fragment of 2.7 kb and 3.1 kb resulting from plasmid and flanking sequences, respectively, were a ...
Protein structure-function relationship: Recognition
... 5. This variation is common among antibody molecules. ...
... 5. This variation is common among antibody molecules. ...
Nucleotide sequence of a cytomegalovirus single
... herpes simplex virus type 1 (HSV-1) major DNAbinding protein (ICP8) (Anders et al., 1986, 1987) and have mapped its gene near the centre of the long unique component of the viral genome (Anders & Gibson, 1988; Kemble et al., 1987). The CMV strain Colburn protein (DB129) has an estimated Mr of 129000 ...
... herpes simplex virus type 1 (HSV-1) major DNAbinding protein (ICP8) (Anders et al., 1986, 1987) and have mapped its gene near the centre of the long unique component of the viral genome (Anders & Gibson, 1988; Kemble et al., 1987). The CMV strain Colburn protein (DB129) has an estimated Mr of 129000 ...
The mystery of aging and rejuvenation—a budding topic
... segregation requires the protein disaggregase Hsp104 [15,16,17] and Sir2 [14,15,18,19]. The role of both these proteins in establishing damage asymmetry has been linked to actin cable-dependent processes and the polarisome [16,17]; a complex at the tip of the daughter cell required for actin cable n ...
... segregation requires the protein disaggregase Hsp104 [15,16,17] and Sir2 [14,15,18,19]. The role of both these proteins in establishing damage asymmetry has been linked to actin cable-dependent processes and the polarisome [16,17]; a complex at the tip of the daughter cell required for actin cable n ...
Structural organization of the endoplasmic reticulum
... from SER, rather than being found at lower levels throughout the ER? One proposed explanation is that the functions associated with bound ribosomes (translocation and modification of newly synthesized proteins) are more efficient if the proteins performing them are concentrated in one part of the me ...
... from SER, rather than being found at lower levels throughout the ER? One proposed explanation is that the functions associated with bound ribosomes (translocation and modification of newly synthesized proteins) are more efficient if the proteins performing them are concentrated in one part of the me ...
Global Proteomics of the Extremophile Black Fungus Cryomyces
... due to rigid cell wall and melanin content, also DNA extraction and purification have not been convenient to obtain genomic data of MCFs [15]. Up to now whole genome sequences of only two strains of black microclonial fungi—Coniosporium apollinis and Cryomyces antarcticus—exist in the public databas ...
... due to rigid cell wall and melanin content, also DNA extraction and purification have not been convenient to obtain genomic data of MCFs [15]. Up to now whole genome sequences of only two strains of black microclonial fungi—Coniosporium apollinis and Cryomyces antarcticus—exist in the public databas ...
The YidC/Oxa1/Alb3 protein family Saller, Manfred J.
... N-terminal domain is composed of an additional TMS followed by a large periplasmatic loop. Recently, the crystal structure of the periplasmatic domain of E. coli YidC was solved (Oliver and Paetzel, 2008; Ravaud et al., 2008). It confirmed the α-helical conformation of the functionally essential reg ...
... N-terminal domain is composed of an additional TMS followed by a large periplasmatic loop. Recently, the crystal structure of the periplasmatic domain of E. coli YidC was solved (Oliver and Paetzel, 2008; Ravaud et al., 2008). It confirmed the α-helical conformation of the functionally essential reg ...
traffic jams affect plant development and signal transduction
... fuse to form one central vacuole 25. It is possible that these pathways overlap and share common components. The amino-acid sequences of protein families that mediate protein trafficking are conserved in plants, animals and yeast; however, it is not possible to predict their functions solely on the ...
... fuse to form one central vacuole 25. It is possible that these pathways overlap and share common components. The amino-acid sequences of protein families that mediate protein trafficking are conserved in plants, animals and yeast; however, it is not possible to predict their functions solely on the ...
Axon and dendritic trafficking
... (Pctaire-kinase) displayed mislocalized AZs, SVPs and DCVs into the dendrite. In double mutants, SVs and AZs are completely mislocalized to the dendrite leaving the axon devoid of any presynaptic specializations. Interestingly these double mutant animals do not show a lack of SVP transport into the ...
... (Pctaire-kinase) displayed mislocalized AZs, SVPs and DCVs into the dendrite. In double mutants, SVs and AZs are completely mislocalized to the dendrite leaving the axon devoid of any presynaptic specializations. Interestingly these double mutant animals do not show a lack of SVP transport into the ...
Differentially Expressed Proteins in Sugarcane Leaves
... to identify proteins that were differentially expressed in sugarcane leaves in response to a water deficit treatment to describe the sugarcane responses at the cellular and molecular levels. Drought-tolerant sugarcane cultivar Khon Kaen 3 stalk cuttings were grown under a controlled environment in a ...
... to identify proteins that were differentially expressed in sugarcane leaves in response to a water deficit treatment to describe the sugarcane responses at the cellular and molecular levels. Drought-tolerant sugarcane cultivar Khon Kaen 3 stalk cuttings were grown under a controlled environment in a ...
... low-cost methods for protein purification are sorely needed, particularly at small scales where automation can accelerate the purification cycle time. Additionally, even at large-scale, low cost techniques that minimize the number of separation stages will increase yield and decrease overall process ...
The Effects of Whey Supplementation and Natural Diet on Protein
... Many looking to build muscle have one question in common: what is the most beneficial source of protein out there to gain muscle? Although there are many different types of protein available, eggs seem to lead the way. It is known that without protein, your muscles will not grow, and those looking t ...
... Many looking to build muscle have one question in common: what is the most beneficial source of protein out there to gain muscle? Although there are many different types of protein available, eggs seem to lead the way. It is known that without protein, your muscles will not grow, and those looking t ...
Carrier Proteins - HCC Learning Web
... • The passage of water through the membrane is facilitated by channel proteins known as aquaporins. • Each aquaporin allows entry of as many as 3 billion (109) water molecules per second, passing single file through its central channel, which fits 10 at a time. • Without aquaporins, only a tiny frac ...
... • The passage of water through the membrane is facilitated by channel proteins known as aquaporins. • Each aquaporin allows entry of as many as 3 billion (109) water molecules per second, passing single file through its central channel, which fits 10 at a time. • Without aquaporins, only a tiny frac ...
21 О О О Termination of Polypeptide Synthesis Requires a Stop
... have a hydrophobic signal peptide, usually at or near their amino terminus. There is no unique signal peptide sequence, but its characteristics include a positively charged N terminus, a core of 8–12 hydrophobic amino acids, and a more polar C-terminal segment that eventually serves as a cleavage si ...
... have a hydrophobic signal peptide, usually at or near their amino terminus. There is no unique signal peptide sequence, but its characteristics include a positively charged N terminus, a core of 8–12 hydrophobic amino acids, and a more polar C-terminal segment that eventually serves as a cleavage si ...
gfp - Ana Maria Caputo
... size. However, the band of the cloned sample was much thicker signifying that several copies of the same gene were present. . ...
... size. However, the band of the cloned sample was much thicker signifying that several copies of the same gene were present. . ...
The Plant Journal
... signi®cant amount of endogenous CaM in our preparations (Figure 6b), and thus led us to investigate whether soluble LeCBDGK interacted with CaM in vivo. In coimmunoprecipitation experiments, anti-DGK antiserum was able to precipitate CaM from the soluble fraction of tomato cell extracts, whereas pre ...
... signi®cant amount of endogenous CaM in our preparations (Figure 6b), and thus led us to investigate whether soluble LeCBDGK interacted with CaM in vivo. In coimmunoprecipitation experiments, anti-DGK antiserum was able to precipitate CaM from the soluble fraction of tomato cell extracts, whereas pre ...
The proteome of Saccharomyces cerevisiae mitochondria
... currently available information, however, only ⬇50–60% of all presumed mitochondrial proteins have been identified so far (8–20). Thus, our knowledge about the physiological functions of mitochondria is limited, and many mitochondrial diseases cannot be analyzed on a molecular level. The Saccharomyc ...
... currently available information, however, only ⬇50–60% of all presumed mitochondrial proteins have been identified so far (8–20). Thus, our knowledge about the physiological functions of mitochondria is limited, and many mitochondrial diseases cannot be analyzed on a molecular level. The Saccharomyc ...
TALKING POINT The origin of the eukaryotic cell
... not support or refute either phylogeny. However, it is significant to note that none of the proteins supported the third phylogeny (P,E)(N,A), which groups the Gram-positive bacteria with the eucarya. This result provides strong evidence that the methods are not generating false significance scores, ...
... not support or refute either phylogeny. However, it is significant to note that none of the proteins supported the third phylogeny (P,E)(N,A), which groups the Gram-positive bacteria with the eucarya. This result provides strong evidence that the methods are not generating false significance scores, ...
1 - Nature
... RNAi analysis PCR products corresponding to predicted C. elegans genes were synthesized using Ahringer Lab RNAi feeding vectors as templates16,17. Primers used to amplify ORFs were: DT7 ForA (TGCGTTATCCCCTGATTCTG) and DT7 RevB (GTAAAACGACGGCCAGTGAG). Alternatively, PCR products were generated by inc ...
... RNAi analysis PCR products corresponding to predicted C. elegans genes were synthesized using Ahringer Lab RNAi feeding vectors as templates16,17. Primers used to amplify ORFs were: DT7 ForA (TGCGTTATCCCCTGATTCTG) and DT7 RevB (GTAAAACGACGGCCAGTGAG). Alternatively, PCR products were generated by inc ...
The ACT Domain: A Small Molecule Binding Domain
... This is the only known case of an ACT domain binding more than one kind of ligand. These three proteins are also the only ones that exhibit the extended 8-stranded  sheet structure and possess a conserved glycyl residue in the 1-␣1 loop region. Threonine deaminase, which has an ACT-like side-by-si ...
... This is the only known case of an ACT domain binding more than one kind of ligand. These three proteins are also the only ones that exhibit the extended 8-stranded  sheet structure and possess a conserved glycyl residue in the 1-␣1 loop region. Threonine deaminase, which has an ACT-like side-by-si ...