• Study Resource
  • Explore
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
PowerPoint
PowerPoint

... First, we need a way to assign numbers to “shades of grey” matches. Genetic code scoring system – This assumes that changes in protein sequence arise from mutations. If only one point mutation is needed to change a given AA to another (at a specific position in alignment), the two amino-acids are mo ...
Cross-Merchandising Tips for a Food Shelf
Cross-Merchandising Tips for a Food Shelf

... is helpful to provide recipes using all of the ingredients being placed ...
Characterization of Tbc2, a nucleus
Characterization of Tbc2, a nucleus

... polypeptide, which is encoded by psbC and is the homologue of CP43 in vascular plants (G314, Fig. 1 A; B23, unpublished data). These results were confirmed with a pulselabeling time of 5 min using total cell proteins from F64 (Fig. 1 B) containing a mutation that is allelic to those of G314 and B23 ...
19 Cell Signaling 10 17 05
19 Cell Signaling 10 17 05

... • The different combinations of proteins in a cell – Give the cell great specificity in both the signals it detects and the responses it carries out ...
The Nhal antiporter of Saccharomyces cerevisiae mediates sodium
The Nhal antiporter of Saccharomyces cerevisiae mediates sodium

... The complete NHAl ORF was amplified using primers 1 (5' GCTCTAGATATTATGGCTATCTG 3') and 2 (5' GCTCTAGAAATTACTTATTGAGACCAAG 3'), and a DNA fragment corresponding to the last 2098 nucleotides of the truncated ORF was obtained with primers 3 (5' GGTTATGTAGGCAGAATCAC 3') and 4 (5' CCATCGATCTAAGGAATCTTGA ...
Chapter 9a - Richsingiser.com
Chapter 9a - Richsingiser.com

... Mark Bretscher showed that N-terminus of glycophorin is extracellular whereas Cterminus is intracellular • Transverse asymmetry of lipids In most cell membranes, the composition of the outer monolayer is quite different from that of the inner monolayer ...
Citrátový cyklus a dýchací řetězec
Citrátový cyklus a dýchací řetězec

... Figure was assumed from http://www.biocarta.com/pathfiles/h_etcPathway.asp ...
Pinar Tulay membrane_17
Pinar Tulay membrane_17

... Hydrophobic regions of these membrane components are oriented inward and hydrophilic regions oriented outward.  Biological membranes are based on a fluid phospholipid bilayer in which phospholipids can diffuse laterally. Membrane fluidity is dependent on the lipid composition of the membrane and on ...
Co-translational, Intraribosomal Cleavage of Polypeptides by the
Co-translational, Intraribosomal Cleavage of Polypeptides by the

... gap will occur in the polypeptide. The translocon may then “detect” this discontinuity in the nascent chain as it does the normal termination of translation, closing, and excluding the downstream protein from the ER. In contrast addition of a signal sequence to the N terminus of protein downstream o ...
POSTER Vp-1
POSTER Vp-1

... exit of AreA from the nucleus, consistent with the lower transcriptional activity of AreA observed during nitrogen sufficiency and limitation compared with nitrogen starvation. We have shown that AreA nuclear hyperaccumulation and nuclear exit are nmrA-independent and do not require residues 60-423 ...
TRANSPORT PROCESSES
TRANSPORT PROCESSES

... signal sequence is cleaved from the protein while it is still growing on the ribosome; thus, signal sequences are usually not present in the “mature” proteins found in cells. The hydrophobic residues in the core of ER signal sequences form a binding site that is critical for the interaction of signa ...
pptx
pptx

... for 30 min with transport buffer (Hank’s Balanced Salt Solution with 10 mM HEPES) with or without 5 mM metformin. To initiate uptake, 2DG solution (10mM) was added to the donor Schematic of Caco-2 Transwell System compartment. After 10 minutes, cells were washed with ice cold transport buffer three ...
Cloning and characterization of CmGPD1, the Candida magnoliae
Cloning and characterization of CmGPD1, the Candida magnoliae

... metabolism. A genomic CmGPD1 gene encoding NADH-dependent GPDH was isolated from Candida magnoliae producing a significant amount of glycerol. The gene encodes a polypeptide of 360 amino acids, which shows high homology with known NADH-dependent GPDHs of other species. The CmGPD1 gene was expressed ...
Michael Z. Lin and Lei Wang
Michael Z. Lin and Lei Wang

... high (~10 pM) affinity vs. interactions that involve only one arsenic atom (1). Recently, sequences surrounding the CCXXCC core have been optimized for improved ReAsH and FlAsH affinity, with their effects presumably being mediated by increased hydrophobic contacts between peptide and ligand outside ...
Electron Transport Oxidative Phosphorylation Control
Electron Transport Oxidative Phosphorylation Control

... Mechanisms of ATP synthesis Proton-translocating ATP synthase (proton pumping ATPase and F1F0-ATPase) multisubunit transmembrane protein F0 water insoluble transmembrane protein 10 to 12 subunit types channel for proton translocation Oligomycin inhibits ATP synthesis by binding and interfering with ...
Chapter 9
Chapter 9

... only a structural role in ribosomes. It was later shown that rRNA has catalytic activity. Noller and colleagues in 1992 showed that the large ribosomal subunit can catalyze formation of peptide bonds even after 90% of ribosomal proteins have been removed. ...
Amino Acids
Amino Acids

... synthesis of important biological compounds by: Incorporation as Entire Molecule. Donating Amino Group. Donating entire or partial Carbon Skeleton. ...
AMINO ACIDS & PEPTIDES (BIO MEDICAL IMPORTANCE)
AMINO ACIDS & PEPTIDES (BIO MEDICAL IMPORTANCE)

... synthesis of important biological compounds by: Incorporation as Entire Molecule. Donating Amino Group. Donating entire or partial Carbon Skeleton. ...
Polymers for Protein Conjugation
Polymers for Protein Conjugation

... success reside in many advantageous properties, such as its hydrophilicity, non-toxicity and non-immunogenicity. The approval of PEG use in humans by Food and Drug Administration marked the beginning of its safe use in clinical practice. Researchers have continued to consider PEG the first choice to ...
Second
Second

... ∆GH+ = ∆G0ATP + RT ln[ATP]/[ADP][PI] (5.52 x3) kcal = 7.5 kcal + 0.6 ln [ATP]/[ADP][PI] [ATP]/[ADP][PI] = e9.06/0.6 = 3.6 x10 6/1 ...
mHDA1/HDAC5 Histone Deacetylase Interacts with and
mHDA1/HDAC5 Histone Deacetylase Interacts with and

... the protein was almost as efficient in repressing the MEF2A transcriptional activity as the fulllength HDAC5 (Fig. 3D, compare 1-1113 and 123-673 constructs). This repression was found to be dependent on MEF2A-HDAC5 interaction, since a deletion mutant lacking the Nterminal region, defined to be the ...
novel 4E-interacting protein in Leishmania is involved in stage
novel 4E-interacting protein in Leishmania is involved in stage

... and subjected to western blot analysis with specific antibodies against the different LeishIF4F subunits. Mass spectrometry analysis Proteins that were pulled down with the tagged LeishIF4E-1 of LeishIF4E-4 from L. amazonensis cell lines (3–4  109 cells) were precipitated by TCA and further resolved ...
Systematic Analysis of Arabidopsis Organelles
Systematic Analysis of Arabidopsis Organelles

... To visualize protein localization and expression within individual cells and tissues in situ or in planta, proteins are usually detected by specific antibodies (Li et al., 2001) or are labeled by genetic fusion to antigentic tags (Dyer and Mullen, 2001), enzyme reporters such as b-glucuronidase (GUS ...
Poster for RCPSC mee.. - University of Alberta
Poster for RCPSC mee.. - University of Alberta

... Ceramide is a sphingolipid second messenger produced in response to cellular stress via activation of sphingomyelinases. Agonists that cause cellular production of ceramide include cytokines (TNF, Fas), agents of environmental stress (heat, UV irradiation), and chemotherapeutic agents. The accumulat ...
The potential use of single-particle electron microscopy as a tool for
The potential use of single-particle electron microscopy as a tool for

... developed to improve this, with some success in the use of crystallization techniques such as lipidic cubic phase, it still proves a major challenge to reliably crystallize numerous membrane-protein families (Caffrey, 2015). This lack of structural information in turn limits the use of structure-bas ...
< 1 ... 176 177 178 179 180 181 182 183 184 ... 399 >

Magnesium transporter

This page links directly from the magnesium in biological systems page.Magnesium transporters are proteins that transport magnesium across the cell membrane. All forms of life require magnesium, yet the molecular mechanisms of Mg2+ uptake from the environment and the distribution of this vital element within the organism are only slowly being elucidated.In bacteria, Mg2+ is probably mainly supplied by the CorA protein and, where the CorA protein is absent, by the MgtE protein. In yeast the initial uptake is via the Alr1p and Alr2p proteins, but at this stage the only internal Mg2+ distributing protein identified is Mrs2p. Within the protozoa only one Mg2+ transporter (XntAp) has been identified. In metazoa, Mrs2p and MgtE homologues have been identified, along with two novel Mg2+ transport systems TRPM6/TRPM7 and PCLN-1. Finally, in plants, a family of Mrs2p homologues has been identified along with another novel protein, AtMHX.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report