* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Figure 1 - York College of Pennsylvania
Genetic engineering wikipedia , lookup
Genetically modified organism wikipedia , lookup
Gene desert wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Genetic code wikipedia , lookup
Node of Ranvier wikipedia , lookup
Transposable element wikipedia , lookup
Gene regulatory network wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Point mutation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Genomic imprinting wikipedia , lookup
Genomic library wikipedia , lookup
Ridge (biology) wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Community fingerprinting wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Zebrafish (Danio rerio) as a Proposed Model Organism to Study The Expression of Ankyrin-3 and its Link to Bipolar Disorder http://zdmsociety.org/zebrafish-and-human-disease/ • • Introduction Bipolar disorder is a debilitating brain disorder that causes extreme mood swings and abnormal shifts in energy and activity levels. It affects 2.6% of the adult American population (Luessis, et al. 2013). There is a strong association between bipolar disorder and mutations in a gene called Ankyrin 3, also known as ANK 3 in humans (Luessis, et al. 2013). • Ankyrin 3 is a scaffold protein located in the brain and is responsible for the formation and maintenance of the axon hillock and at the nodes of Ranvier (Roberto, et al. 2011). • Ankyrin 3 links voltage-gated sodium and potassium channels to the cytoskeleton and is required for the production and propagation of action potentials mediated by these channels (Luessis, et al. 2013). • Alicia Dillman York College of Pennsylvania, Department of Biological Sciences Table 1. Primer sets for Ankyrin 3A and B Ankyrin 3A Primer 1 Forward: ATGCAGCAACCAAGAAAGGAA Reverse: AAGAGTGTCGCTACGTTGATG Size: 484 base pairs Ankyrin 3B Primer 1 Forward: GACTGGTGTGGACATCAACAT Reverse: CGTTGTGGTCGTTCTGCAGGA Size: 497 base pairs Primer 2 Forward: ATGTCAGCATTCAAGTAGGTA Reverse: AACTCGATGTAAGCTATACGT Size: 480 base pairs Primer 2 Forward: ATCAAGAGATTCTTAAGGATG Reverse: CACCAAGATCATTCATTAAGT Size: 417 base pairs Primer 3 Forward: ATAGAAGAGCATAAGAGTCCT Reverse: TGCATTGGCATTGGATGTCTC Size: 480 base pairs Primer 3 Forward: CCTTGGAATCCTCCAGTACAT Reverse: CTTCCAGCAATGTCACAATAT Size: 419 base pairs Zebrafish are small, freshwater, tropical fish that are advantageous animal models compared to the traditional lab rat due to the low cost, fully sequence genome, transparency during development and are amenable to genetic, behavioral, Ankyrin 3A physiological, pharmaceutical, and developmental studies (Nguyen, et al. 2014). Zebrafish contain two Ankyrin 3 genes, Ankyrin 3A and B. It is believed that the zebrafish genome went through a duplication during evolution and the functions of the genes were split between the genes (Postlethwait, et al. 2000). 318 13,766 STOP 571 9,061 1,055 1 12,801 2 9,541 13,181 3 Ankyrin 3B 1 Objective Clone and investigate the expression of Ankyrin 3A and B genes in adult zebrafish tissue. STOP 425 EA2 EB3 GA2 GB3 HA2 HB3 Conclusions Figure 4. RT-PCR analysis of Ankyrin 3A and B in eye, gut, and heart tissue . The Ankyrin 3A and B genes were amplified using adult zebrafish eye (E), gut (G), and heart (H) cDNA. The 500 base pair ladder is represented with BP and the Ankyrin 3A and B primers are represented as A or B, respectively. BP A1 A2 A3 B1 B3 B2 Figure 5. RT-PCR analysis of Ankyrin 3A and B in muscle tissue. The Ankyrin 3A and B genes were amplified using adult zebrafish eye (E), gut (G), and heart (H) cDNA. The 500 base pair ladder is represented with BP and the Ankyrin 3A and B primers are represented as A or B, respectively. 3 2 ATG 285 13,355 BP 5,881 11,581 Table 2. Amino acid alignments between human Ankyrin 3 and zebrafish Ankyrin 3A and B sequences. Amino Acid Sequences 921 1 6,297 2 12,000 3 Figure 1. ANK 3A and B genes and primer sets. Ankyrin 3A and B genes from start to stop codons. Primer sets are labeled 1-3 with forward and reverse primers indicated by the arrows. Zebrafish ANK 3A Amino Acid Sequence Zebrafish ANK 3B Amino Acid Sequence Human ANK 3 Amino Acid Sequence 59% identical Leussis, M.P., Berry-Scott, E.M., Saito, M., Jhuang, H., Hann, G., Alkan, O., Luce, C.J., Madison, J.M., Sklar, P., Serre, T., Root, D.E., and Petryshen, T.L. 2013. The ANK3 Bipolar Disorder Gene Regulates Psyciatric-Related Behaviors That Are Modulated by Lithium and Stress. Biological Psychiatry. 73: 683-690. 3.85 kb Postlethwait, J.H., Woods, I.G., Ngo-Hazelett, P., Yan, Y., Kelly, P.D., Chu, F., Huang, H., Hill-Force, A., and Talbot, W.S. Zebrafish Comparative Genomics and the Origins of Vertebrate Chromosomes. Genome Research. 10:18901902. Primers were designed to target a 500 base pair sequence of each gene (Table 1) Nguyen, M., Stewart, A.M., Kalueff, A.V. 2014. Aquatic blues: Modeling depression and antidepressant action in zebrafish. Progress in Neuro-Psychopharmacology and Biological Psychiatry. 55: 26-39. Figure 2. pDrive vector. Plasmid used with space for the 500 base pair insert. Results RNA Extraction BP A1 A2 A3 B1 B3 Ruberto, G., Vassos, E., Lewis, C.M., Tatarelli, R., Girardi, P., Collier, D., and Frangou, S. 2011. The Cognitive Impact of the ANK3 Risk Variant for Bipolar Disorder: Initial Evidence of Selectivity to Signal Detection during Sustained Attention. PLoS ONE. 6:1-7. B2 Woods, I.G., Wilson, C., Friedlander, B., Chang, P., Reyes, D.K., Nix, R., Kelly, P.D., Postlethwait, J.H., and Talbot, W.S. 2005. The zebrafish gene map defines ancestral vertebrate chromosomes. Genome Research.15:1307-1314. PCR (Figure 1) PCR product was ligated into a pDrive vector and transformed into E. coli (Figure 2) Plasmids from the bacteria containing the Ankryin 3A and B DNA were isolated by mini prep and sequenced • Isolate, clone, and investigate the expression of Ankyrin 3A and B in zebrafish embryo brain tissue • Complete an Ankyrin 3A and B knockdown References Predicted mRNA sequence for ANK 3A and B were identified by searching NCBI’s Gene Database Reverse Transcription Future Directions 58% identical Methods Adult Zebrafish Tissue Dissection (muscle, gut, brain, heart, and eyes) • Ankyrin 3A and B were successfully extracted and cloned from adult zebrafish brain tissue • Amino acid identities and synteny support this Is the homologous gene to human Ankryin 3 • This suggests that zebrafish may be a promising model organism to study the involvement of Ankyrin 3 in the development of bipolar disorder 3 2 1 ATG • https://www.premedhq.com/nodes-of-ranvier-propagation-of-nerve-impulses-along-the-axon Figure 3. RT-PCR analysis of Ankyrin 3A and B in brain tissue . The Ankyrin 3A and B genes were amplified using adult zebrafish brain cDNA. The 500 base pair ladder is represented with BP and the Ankyrin 3A and B primers are represented with A and B, respectively. Figure 6. Synteny chart from Woods, and colleagues showing synteny conservation between zebrafish and human chromosomes (2005). Ankyrin 3A is present on zebrafish chromosome 17 and shares 6 genes with human chromosome 10. Ankyrin 3B is present on zebrafish chromosome 12 and shares 27 genes with human chromosome 10. Acknowledgements I would like to thank Dr. Wendy Boehmler for her mentorship and patience throughout the duration of this project.