Download Genome-wide Investigation of Cellular Functions for tRNA Nucleus

Genome-wide Investigation of Cellular Functions for tRNA NucleusCytoplasm Trafficking in the Yeast Saccharomyces cerevisiae
DISSERTATION
Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy
in the Graduate School of The Ohio State University
By
Hui-Yi Chu
Graduate Program in Molecular, Cellular and Developmental Biology
The Ohio State University
2012
Dissertation Committee:
Anita K. Hopper, Advisor
Stephen Osmani
Kurt Fredrick
Jane Jackman
Copyright by
Hui-Yi Chu
2012
Abstract
In eukaryotic cells tRNAs are transcribed in the nucleus and exported to the
cytoplasm for their essential role in protein synthesis. This export event was thought to be
unidirectional. Surprisingly, several lines of evidence showed that mature cytoplasmic
tRNAs shuttle between nucleus and cytoplasm and their distribution is nutrient-dependent.
This newly discovered tRNA retrograde process is conserved from yeast to vertebrates.
Although how exactly the tRNA nuclear-cytoplasmic trafficking is regulated is still under
investigation, previous studies identified several transporters involved in tRNA
subcellular dynamics. At least three members of the β-importin family function in tRNA
nuclear-cytoplasmic intracellular movement: (1) Los1 functions in both the tRNA
primary export and re-export processes; (2) Mtr10, directly or indirectly, is responsible
for the constitutive retrograde import of cytoplasmic tRNA to the nucleus; (3) Msn5
functions solely in the re-export process. In this thesis I focus on the physiological role(s)
of the tRNA nuclear retrograde pathway. One possibility is that nuclear accumulation of
cytoplasmic tRNA serves to modulate translation of particular transcripts. To test this
hypothesis, I compared expression profiles from non-translating mRNAs and
polyribosome-bound translating mRNAs collected from msn5Δ and mtr10Δ mutants and
wild-type cells, in fed or acute amino acid starvation conditions. Microarray data revealed
that several amino acid biosynthetic pathways, including the sulfur assimilation, arginine
ii
biosynthesis, and leucine biosynthesis pathways, are primary targets of the tRNA
trafficking processes. I confirmed the microarray data by both Northern and Western blot
analyses. Levels of all tested target proteins involved in such amino acid biogenesis
pathways are down-regulated when the tRNA nuclear import or re-export is disrupted.
The steady state levels of target total RNAs are similar between wild-type cells and tRNA
trafficking defective mutants. The data suggest that the reduction of target proteins most
likely results from translation defects of the target mRNAs. This study provides
information that tRNA nuclear-cytoplasmic dynamics is connected to amino acid
biosynthesis via control at the level of translation.
iii
This thesis is dedicated to my family and the memory of my dear mother.
iv
Acknowledgements
First and foremost I want to thank my advisor Anita K. Hopper, for her warm
encouragement and advice. From her I have learned how to enjoy the research life and
open my mind for every possibility. She is always patient, optimistic, and enthusiastic,
even during difficult moments. I appreciate all her supports and contributions of time,
ideas, and funding in my Ph.D pursuits. When I lose my confidence, she always believed
me more than myself. I thank her wide knowledge and logical way of thinking, which
made this thesis possible. I am grateful for the excellent role model which she provided
as a woman scientist. It is my honor to be one of her students.
I am acknowledged my thesis committee, Professor Stephen Osmani, Professor
Kurt Fredrick, and Professor Jane Jackman, for their interests, professional comments,
and personal encouragements. I am also grateful that my previous advisor in the
Nationwide Children Hospital, Dr. Akihira Otoshi, for his giving me the chance coming
to the United States. I want to thank the director of MCDB graduate program, Professor
David Bisaro, for his understanding and decision of accepting me, which made me get the
opportunity to join in this wonderful lab.
Being part of the Hopper lab would definitely become a beautiful memory in my
life. It was my pleasure to work with such nice lab members. I thank our post-docs
Rebecca, for her good ideas and always willing to help us whenever we have questions,
v
and Emily, for her nice communication skills. Thanks to Greetchen, Nripesh, Tsung-Po,
Hsiao-Yun (Ivy), Jingyan, and Marina. When I became too serious or too panic, they
provided laughs and supports. When I had successful experiments, they shared the joyful
moments.
My life in the OSU was fulfilling and the learning experience was most
comprehensive in my study journey. As a hearing impaired foreigner, I sincerely thank
Cindy Knecht and Andrea Crago from the disability service that was provided by the
OSU and the Professional Reporters, Inc. Their amazing real-time transcribing work truly
helped me overcome the double barriers of disability and language. Thank to OSU
provided such a friendly campus. I thank people in the department of Molecular Genetics,
in particular Professor Jim Hopper, Professor Paul Herman, and their lab members.
In these years of joys and frustrations, thanks for all the supports my friends in
Columbus. Thanks to Rosa, Keith and their dog Bailey, for their generosity and warm
supports. Thanks to I-Ju, Liang-Chun, and Yuh-Ying, for banding together over food and
life. I also thank Kuo-Fang and Shu-Hao, studying together with them was a different and
great experience. Also thanks to many old friends in Taiwan, they keep caring about me
no matter the distance.
Finally, and most importantly, thanks to my parents for their nurture and
education. Their unconditional love made me brave to face the challenges and was the
motivation of my pursuits. Thanks to my sister and brother, and their families, for their
understanding and supports. And last, but not least, to Yuan-Sheng, thank you for the
love and consistent being there for me.
vi
Vita
March 1978 ....................................................Born−Taipei, Taiwan
2000...............................................................B.S. Biology, National Taiwan Normal
University, Taiwan
2003................................................................M.S. Genetics, National Yang-Ming
University, Taiwan
2006 to present ..............................................Graduate Research Associate, Molecular,
Cellular, and Developmental Biology
Program, The Ohio State University
Publication
Lai, Y.-S., Murali, S., Ju, H. Y., Wu, M. F., Guo, I. C., Chen, S. C., Fang, K. and Chang, C. Y.
Two iridovirus-susceptible cell lines established for kidney and liver of grouper,
Epinephelus awoara, and partial characterization of grouper iridovirus. Journal of fish
disease 23, 379-338, 2000.
vii
Lai, Y.-S., Murali, S., Chiu, H. C., Ju, H. Y., Lin, Y. S., Chen, S. C., Guo, I. C., Fang, K. and
Chang, C. Y. Preparation of yellow grouper nervous necrosis virus in a new nodavirussusceptible cell lines from yellow grouper, Epinephelus awoara brain tissue. Journal of fish
disease 24,299-309, 2001.
Chu, H. Y. Phenotypic Analysis of the Aurora-A Transgenic Mice. Master Thesis. Institute of
Genetics, National Yang Ming University, July, 2003.
Chu, H. Y. and Otoshi, A. Cloning and functional analysis of hypothalamic homeobox gene
Bsx1a and its isoform, Bsx1b., Mol Cell Biol. 27(10), 3743-9, 2007.
Li, C.C., Chu, H.Y., Yang, C.W., Chou, C.K. and Tsai, T.F. Aurora-A overexpression in mouse
liver causes p53-dependent premitotic arrest during liver regeneration. Mol Cancer Res.
7(5), 678-88, 2009.
Chu, H. Y. and Hopper, A. K. Genome-wide investigation of the cellular functions for tRNA
nucleus-cytoplasm trafficking in S. cerevisiae. (in prep.)
Fields of Study
Major Field: Molecular, Cellular and Developmental Biology
viii
Table of Contents
Abstract ............................................................................................................................... ii Acknowledgements ............................................................................................................. v Vita .................................................................................................................................... vii Fields of Study ................................................................................................................. viii Table of Contents ............................................................................................................... ix List of Tables ................................................................................................................... xiv List of Figures .................................................................................................................. xvi Chapter 1 Introduction.................................................................................................. 1 1.1 Nucleocytoplasmic transport ................................................................................ 1 1.2 tRNA biology in yeast .......................................................................................... 5 1.2.1 The life of tRNA: biogenesis, maturation, and turnover ........................... 5 1.2.2 tRNA subcellular dynamics..................................................................... 10 1.3 Amino acid stress responses ............................................................................... 12 1.4 Microarray analysis ............................................................................................ 14 1.4.1 Microarray general applications and advanced usage for translational
profiling ................................................................................................... 14 1.4.2 Data analysis............................................................................................ 16 1.5 Aim of this study ................................................................................................ 21 ix
Chapter 2 Materials and Methods.............................................................................. 22 2.1 Yeast growth conditions and strain construction ............................................... 22 2.1.1 Media and growth conditions .................................................................. 22 2.1.2 Yeast strain construction ......................................................................... 23 2.1.3 Growth assay ........................................................................................... 25 2.2 Polysome profiles and RNA isolation ................................................................ 25 2.2.1 Polysome profiles .................................................................................... 25 2.2.2 Quantification of polysome profiles ........................................................ 27 2.2.3 RNA extraction........................................................................................ 28 2.3 Microarray data analysis .................................................................................... 28 2.3.1 Pre-processing of raw data ...................................................................... 29 2.3.2 Identification of significant differentially-expressed genes .................... 29 2.3.3 Hierarchical clustering of significantly changed target transcripts ......... 30 2.4 Northern blot analysis ........................................................................................ 30 2.4.1 Preparation of DNA probes ..................................................................... 31 2.5 Western blot analysis ......................................................................................... 31 2.5.1 Protein extraction .................................................................................... 31 2.5.2 Western blot and quantification .............................................................. 32 2.6 Cis-regulatory element analyses of targets......................................................... 33 2.6.1 Codon bias and amino acid usage ........................................................... 33 Chapter 3 Genome-wide investigations of cellular functions for tRNA nuclearcytoplasmic trafficking in regulation of translation .................................................... 43 x
3.1 Introduction ........................................................................................................ 43 3.2 Results ................................................................................................................ 48 3.2.1 Polysome profiles analysis ...................................................................... 48 3.2.2 Microarray data pre-processing ............................................................... 49 3.2.3 Identification of significant differentially-expressed genes (DEGs) ....... 57 3.2.4 Transcriptional control and RNA stability of target mRNAs are not
affected .................................................................................................... 60 3.2.5 Verification of microarray data by western blot analyses ....................... 61 3.2.6 tRNA subcellular trafficking affects translation regulation of amino acid
biosyntheses transcripts ........................................................................... 77 3.2.7 Cis-regulatory elements analysis of tRNA trafficking targets ................ 85 3.3 Discussion .......................................................................................................... 86 Chapter 4 Transcriptional analysis of mtr10Δ cells .................................................. 96 4.1 Introduction ........................................................................................................ 96 4.2 Results ................................................................................................................ 97 4.2.1 Microarray analysis of transcription profiles in msn5∆ cells .................. 98 4.2.2 Microarray analysis of transcription profiles in mtr10∆ cells ................. 98 4.2.3 Confirmations of selected target mRNA expressions by Northern blot
analysis .................................................................................................. 104 4.2.4 Phenotypic analyses by growth assays .................................................. 105 4.3 Discussion ........................................................................................................ 112 Chapter 5 Summary and future directions ............................................................. 115 xi
APPENDIX A: Tested possibilities for mechanism of down-regulated translation of the
target mRNAs involved in the Met, Arg, and Leu biosynthetic pathways ..................... 117 APPENDIX B: Transcripts with decreased translation activity index in fed mtr10Δ cells
......................................................................................................................................... 121 APPENDIX C: Transcripts with increased translation activity index in fed mtr10Δ cells
......................................................................................................................................... 129 APPENDIX D: Transcripts with changed translation activity index in mtr10Δ cells in
amino acid starvation condition ...................................................................................... 136 APPENDIX E: Transcripts with decreased translation activity index in fed msn5Δ cells
......................................................................................................................................... 138 APPENDIX F: Summary tables of functional catalogue analysis for affected transcripts
in mtr10Δ cells in fed or amino acid starvation conditions............................................. 140 APPENDIX G: Down-regulated genes in mtr10Δ cells in fed condition ...................... 145 APPENDIX H: Up-regulated genes in mtr10Δ cells in fed condition ........................... 157 APPENDIX I: Down-regulated genes in mtr10Δ cells in amino acid starvation condition
......................................................................................................................................... 178 APPENDIX J: Up-regulated genes in mtr10Δ cells in amino acid starved condition ... 212 APPENDIX K: Summary tables of functional catalogue analysis for affected transcripts
in msn5Δ cells in fed or amino acid starvation conditions.............................................. 251 APPENDIX L: Down-regulated genes in msn5Δ cells in fed condition........................ 256 APPENDIX M: Up-regulated genes in msn5Δ cells in fed condition ........................... 264 xii
APPENDIX N: Down-regulated genes in msn5Δ cells in amino acid starvation condition
......................................................................................................................................... 275 APPENDIX O: Up-regulated genes in msn5Δ cells in amino acid starvation condition290 APPENDIX P: R codes for microarray data analysis .................................................... 302 References ....................................................................................................................... 326 xiii
List of Tables
Table 2. 1. Yeast strains used in this study .................................................................... 34 Table 2. 2. Oligonucleotides used in this study ............................................................. 38 Table 3. 1. Summary tables of numbers of differentially expressed genes in mtr10Δ or
msn5Δ cells in fed or starved conditions. ......................................................................... 67 Table 4. 1. Numbers of significant differentially transcriptionally expressed genes from
total mRNA samples of msn5Δ or mtr10Δ cells in fed or amino acid starvation
conditions.. ...................................................................................................................... 103 Table 4. 2. GO term enrichment analysis and FunCat analysis of genes with significant
changed in mtr10Δ cells in fed condition........................................................................ 107 Table 4. 3. GO term enrichment analysis and FunCat analysis of genes with significant
changed in mtr10Δ cells in acute amino acid starved condition.. ................................... 108 Table F. 1. FunCat analysis of down-regulated transcripts in mtr10Δ cells in fed
condition. ........................................................................................................................ 140 Table F. 2. FunCat analysis of up-regulated transcripts in mtr10Δ cells in fed condition.
......................................................................................................................................... 141 xiv
Table F. 3. FunCat analysis of down-regulated transcripts in mtr10Δ cells in amino acid
starved condition. ............................................................................................................ 142 Table F. 4. FunCat analysis of up-regulated transcripts in mtr10Δ cells in amino acid
starved condition. ............................................................................................................ 143 Table K. 1. FunCat analysis of down-regulated transcripts in msn5Δ cells in fed
condition. ........................................................................................................................ 251 Table K. 2. Up-regulated transcripts in msn5Δ cells in fed condition. ......................... 252 Table K. 3. FunCat analysis of down-regulated transcripts in msn5Δ cells in amino acid
starvation condition......................................................................................................... 254 Table K. 4. FunCat analysis of up-regulated transcripts in msn5Δ cells in amino acid
starvation condition......................................................................................................... 255 xv
List of Figures
Figure 1. 1. Ran Cycle and Ran-dependent nuclear export and import. ........................... 4 Figure 1. 2. Summary of tRNA processing pathways.. .................................................... 8 Figure 1. 3. Probe and probesets. .................................................................................... 19 Figure 2. 1. Illustration of quantification method. .......................................................... 27 Figure 3. 1. Current model of tRNA subcellular movement in yeast.. ........................... 46 Figure 3. 2. Flowchart of experimental designs.. ............................................................ 47 Figure 3. 3. Polysome profiles of wild-type, mtr10Δ, and msn5Δ cells collected from fed
or 30-min amino acid starved conditions.. ........................................................................ 51 Figure 3. 4. Polysome profiles of wild-type, los1Δ, and los1Δ msn5Δ cells collected
from fed or 30-min amino acid starved condition. ........................................................... 52 Figure 3. 5. Quantification of polysome profiles of tRNA trafficking mutants in fed (AC) or amino acid starved (D-F) conditions. ...................................................................... 54 Figure 3. 6. Summary of microarray experiments.. ........................................................ 55 Figure 3. 7. Global assessment of microarray raw data set from fractionated RNA
samples by using principle component analysis (PCA). ................................................... 56 Figure 3. 8. Box plot of raw microarray data. ................................................................. 64 xvi
Figure 3. 9. Box plot of RMA normalized microarray data............................................ 65 Figure 3. 10. Volcano plot showing differential expressed genes selected by P/NP index
compared from mtr10Δ to wild-type cells. ....................................................................... 66 Figure 3. 11. Heat map of hierarchical clustering results of gene expression profiles
from translational DEGs in mtr10Δ cells versus wild-type cells in fed condition............ 68 Figure 3. 12. Heat map of hierarchical clustering results of translational DEGs from
msn5Δ cells compared to wild-type cells in fed condition................................................ 69 Figure 3. 13. Venn diagram of DEGs which were decreased in translation activity index
in both mtr10Δ and msn5Δ cells. ...................................................................................... 70 Figure 3. 14.
Amino acid biosynthesis pathways affected in tRNA trafficking mutants.
........................................................................................................................................... 72 Figure 3. 15. Expression profile of MET3 transcript among all microarray samples. .... 74 Figure 3. 16. Northern blot analysis of total RNA collected from wild-type and tRNA
trafficking mutants in fed condition. ................................................................................. 75 Figure 3. 17. Growth assay of tRNA trafficking mutants on SC, SC-arginine and SCmethionine plates. ............................................................................................................. 76 Figure 3. 18. Growth assays of cells with Met22-3HA fusion protein.. ......................... 79 Figure 3. 19. Western blot analysis of endogenously 3HA- or GFP- tagged target
proteins.. ............................................................................................................................ 81 Figure 3. 20. Western blot analysis of protein levels in tRNA trafficking mutants
harboring recovery plasmids.. ........................................................................................... 82 xvii
Figure 3. 21. Immunoblot analyses of Met3-, Arg3-, and Leu4-3HA fusion proteins in
wild-type cells and dhh1Δ pat1Δ cells. ............................................................................. 83 Figure 3. 22. Heat map of hierarchical clustering of codon occurrence frequency for
DEGs with decreased translation activity index in mtr10Δ cells. ..................................... 84 Figure 4. 1. PCA analysis of transcription profiles of total mRNAs from wild-type,
msn5Δ, and mtr10Δ cells in fed or acute amino acid starvation condition.. ................... 101 Figure 4. 2. Volcano plots showing differential expressed genes at transcriptional level
in mtr10Δ cells versus wild-type cells.. .......................................................................... 102 Figure 4. 3. Venn diagram of differentially expressed genes from mtr10Δ cells relative
to wild-type cells in fed and amino acid starved conditions. .......................................... 109 Figure 4. 4. Northern blot analysis of total mRNAs collected from wild-type, mtr10Δ,
and msn5Δ cells grown in fed condition. ........................................................................ 110 Figure 4. 5. Growth assay to assess the function of Mtr10 in DNA damage response. 111 Figure A. 1. Growth assay of mutants defective in tRNA export and modifications.. . 118 Figure A. 2. Growth assay of mutants defective in tRNA import and modifications... 119 Figure A. 3. Western blot analysis of Arg3-3HA in tRNA modification mutants. ...... 120 xviii
CHAPTER 1
Introduction
Eukaryotic cells contain a variety of lipid bilayer membrane-surrounded organelles. One
of these organelles, the nucleus, is the genetic information center that controls biological
activities. An important issue in eukaryotic cell biology concerns the coordination of
cellular process via spatial and temporal regulation. The nucleus communicates with the
cytoplasm via nuclear pores through which macromolecules flow. DNA contains the
genetic information which is transcribed into RNAs and translated into proteins. Transfer
RNA (tRNA) is one of three main forms of RNAs. tRNAs function by delivering amino
acids to the protein synthesis machinery in the cytoplasm. Nuclear-cytoplasmic cross-talk
involving tRNAs is of particular interest to our laboratory. To investigate such questions,
we employ the powerful genetic tool, the budding yeast Saccharomyces cerevisiae, which
has been broadly used for biological research, as our model system.
1.1 Nucleocytoplasmic transport
The traffic between nucleus and cytoplasm occurs through nuclear pores. Nuclear pores
are composed of nuclear pore complexes (NPCs) which are organized into channel
structures that cross the inner and outer nuclear membranes. NPCs allow diffusion of
1
small molecules (< 40 kDa). In contrast, macromolecules (large proteins or
ribonucleoproteins [RNPs]) contain specific sequences (nuclear export sequences, NES;
or nuclear localization sequences, NLS) that are recognized and actively translocated in
and out of the NPCs by transport receptors in an energy dependent manner (for review,
see Aitchison and Rout, 2012).
In the S. cerevisiae genome, there are 14 nuclear transport receptors that are
members of karyopherin β family (Stewart, 2003). According to the direction in which
they move their cargos, the receptors are referred to as exportins (nucleus to cytoplasm)
or importins (cytoplasm to nucleus). The process of nuclear transport is controlled by the
small GTPase, Ran. There are two forms of Ran, the GTP-bound form, which is primarily
located in the nucleus, or the GDP-bound form, which is primarily located in the
cytoplasm (Kuersten et al., 2001). This asymmetric distribution results from the distinct
subcellular localizations of the Ran cycle regulators, the cytoplasmic GTPase-activating
protein (RanGAP, encoded by RNA1) and the nuclear guanine nucleotide exchange factor
(RanGEF, encoded by RCC1), which are responsible for the conversion of Ran-GTP and
Ran-GDP states (top panel of Figure 1. 1) (for reviews, see Nakielny and Dreyfuss, 1999;
Rodriguez et al., 2004). The exportin receptors bind Ran-GTP and the cargo in the
nucleus, and the complex moves via the nuclear pore to the cytoplasm where the complex
disassociates upon Ran-GTP hydrolysis to Ran-GDP by RanGAP (middle panel of Figure
1. 1). Ran-GDP returns to the nucleus by the aid of NTF2 (Ribbeck et al., 1998), and is
converted to Ran-GTP form again by RanGEF. The importin receptors bind the cargo
(directly or adaptor-mediated) in the cytoplasm in a Ran-GTP independent manner. The
2
importin-cargo complex translocates to the nucleus where importin encounters Ran-GTP,
and this leads to the release of cargo and importin returns to the cytoplasm for next cycle
(bottom panel of Figure 1. 1) (for review, see Chook and Süel, 2011).
As the molecular size of tRNA is ~25 kDa which is theoretically able to leave the
nucleus by diffusion, its export requires the Ran pathway and the functions of
karyopherin.
3
Figure 1. 1. Ran Cycle and Ran-dependent nuclear export and import.
4
1.2 tRNA biology in yeast
1.2.1 The life of tRNA: biogenesis, maturation, and turnover
tRNA biogenesis
tRNA is an essential adaptor molecule composed 73 to 93 nucleotides that fold into Lshaped tertiary structures. tRNAs function to translate genetic information encoded in
mRNAs to proteins by delivering the appropriate amino acids during translation at the
ribosome. In yeast tRNA transcription occurs in the nucleolus, a sub-compartment in the
nucleus (Thompson et al., 2003). tRNA genes (tDNAs) are transcribed by RNA
polymerase III (Pol III), which recognizes the promoter sequences within tRNA genes
(Dieci et al., 2007). Transcriptional control of tRNAs is regulated by Pol III via the
master regulator, Maf1 (for reviews, see Ciesla and Boguta, 2008; Willis and Moir, 2007).
tRNA processing
Since the initial tRNA transcripts contain extra nucleotides at 5’and 3’ ends and
some of tRNA precursors have intervening sequences (IVS, or introns) between exons,
the tRNA transcripts need to be processed to mature sized molecules. tRNAs are also
highly modified in post-transcriptional steps. The processing events, including removal of
5’ and 3’ termini, CCA addition, and intron splicing, generally occur in a specific order.
The leader sequence is cleaved from pre-tRNAs to generate a mature 5’ end by the
ribonucleoprotein endonuclease (RNase P). RNase P is composed of a RNA molecule
and protein subunits (for reviews, see Esakova and Krasilnikov, 2010; Walker and
Engelke, 2006). The 3’ end of pre-tRNA is processed by removal of the trailer sequence
5
and the subsequent addition of CCA nucleotides after the residue N73. The former
reaction is catalyzed by the yeast endoribonuclease tRNase Z (Trz1) and exonuclease
Rex1, which is balanced by the presence of Lhp1 (yeast La protein, which is a chaperon
required for tRNA maturation) (for reviews, see Nakanishi and Nureki, 2005; Phizicky
and Hopper, 2010). Addition of nucleotides C74, C75, and A76 is required for subsequent
amino
acid
attachment.
This
reaction
is catalyzed by
the
enzyme
tRNA
nucleotidyltransferase, encoded by CCA1 in yeast. CCA1 is an essential gene, but there is
a temperature-sensitive mutant of this gene, cca1-1. Cells with this mutation cca1-1 have
a phenotype that is associated with incompletely-processed tRNAs. Interestingly, yeast
Cca1 is an isozyme which has three ATGs. The multiple transcripts result in the
production of three proteins that are differentially distributed to nucleus, cytoplasm, and
mitochondria (Chen et al., 1992b; Wolfe et al., 1994).
Among the total of 286 nuclear tRNA genes in yeast, 59 encode introns. Introns
are located between the 3’ end of the anticodon after nucleotide 37 and the loop 1. Intron
lengths vary from 14 to 60 nucleotides. The intron-containing tRNAs belong to 10
different tRNA families (for reviews, see Hopper and Phizicky, 2003; Abelson et al.,
1998; Hani and Feldmann, 1998). tRNA intron removal is catalyzed by the
heterotetrameric splicing endonuclease complex (SEN). Although the SEN complex is
essential, a previous study demonstrated that the intron of one tRNA, tRNATrp(CCA), is
unnecessary in translation and cell growth (Mori et al., 2011). In yeast, the pre-tRNA
splicing reaction includes three steps. First, the intron-containing tRNAs are cleaved at
both ends of the intron by SEN. Second, the subsequently generated two halves are
6
ligated by tRNA ligase Trl1 and 2’-phosphate is formed at the splice junction. Removal
of the 2’ phosphate at the splice junction is catalyzed by the 2’ phosphotransferase Tpt1
(for review, see Hopper and Phizicky, 2003). SEN is functionally conserved from yeast to
vertebrates; however, its subcellular localization is not. The work from Yoshihisa showed
that the yeast SEN is located at mitochondria surface (Yoshihisa et al., 2003), but
vertebrate SEN is in the nucleus (Paushkin et al., 2004). A recent study reveals that SEN
possesses a novel function unrelated to splicing that requires all four subunits to be
located on the mitochondria (Dhungel and Hopper, 2012).
tRNA modification
To date, more than 100 post-transcriptional modified nucleotides have been described in
tRNAs (Cantara et al., 2011). Although the biological function(s) of many tRNA
modifications are not completely understood, some of them have been shown to play a
role in stabilizing tRNA tertiary structure, facilitating tRNA folding, and preventing
translation frameshift to increase the accuracy of protein synthesis (for review, see
Gustilo et al., 2008). tRNA modification enzymes locate at different subcellular
compartments, including nucleolus, nucleoplasm, the inner nuclear membrane, the
cytoplasm, and mitochondria (for review, see Hopper and Phizicky, 2003).
7
Figure 1. 2. Summary of tRNA processing pathways. tRNA modification pathways are
not included.
8
tRNA aminoacylation
Before binding to ribosomes, tRNAs are aminoacylated, or charged, at their 3’ end of the
CCA sequence. Charging is catalyzed by aminoacyl tRNA synthetases (aaRS). There are
20 aaRSs, each corresponding to a single amino acid. Since there are multiple tRNAs for
given amino acids, one enzyme generally recognize more than one tRNA substrate.
Although the classical view was that tRNA aminoacylation solely occurs in the
cytoplasm, several aminoacyl tRNA synthetases are located in the nucleus in vertebrates
and yeast, and tRNA charging has been shown to occur in the nucleus (Lund and
Dahlberg, 1998; Sarkar and Hopper, 1998).
tRNA turnover/degradation
As tRNAs are long-lived relative to mRNAs and are recycled for multiple rounds of
tRNA charging, it is not surprising that there are at least two quality control pathways
that function in repairing or degrading damaged tRNAs (for reviews, see Hopper et al.,
2010; Phizicky and Hopper, 2010; Thompson and Parker, 2009). The yeast TRAMP
complex, that includes Trf4/5, Air1/Air2, and Mtr4, was the first discovered mechanism
to monitor the integrity of pre-tRNA during tRNA biogenesis (Kadaba et al., 2004;
Kadaba et al., 2006). This pathway recognizes hypomodified nuclear tRNAs, such as
tRNAiMet at m1A58, caused by mutation of Trm6. Substrates of the TRAMP pathway are
poly-adenylated and subjected to degradation from their 3’ end by the nuclear exosome.
Other studies demonstrated that additional tRNA substrates, for example, pre-tRNA
transcript (LaCava et al., 2005), tRNAAla with a structural defect (Vanacova et al., 2005),
9
U6 small nuclear RNA, or 3’ truncated 5S rRNA (Kadaba et al., 2006), are also checked
by this pathway.
In contrast to the TRAMP pathway which is restricted to the nucleus, the second
surveillance mechanism, the rapid tRNA decay (RTD) pathway, is located in both the
nucleus and the cytoplasm. The RTD pathway acts on mature tRNAs from the 5’ end (for
review, see Phizicky and Hopper, 2010). Cells with defective Trm8 and Trm4, which
normally modify tRNAs at m7G46 and m5C49, respectively, exhibit elevated temperaturesensitive growth, caused by the rapid degradation of hypomodified tRNAVal(AAC) by the
RTD pathway (Alexandrov et al., 2006). Furthermore, tRNA substrates with different
modification defects are also RTD targets (Chernyakov et al., 2008). The same study
reported a similar rate of tRNA substrate degradation after addition of transcription
inhibitor thiolutin, showing that the degradation targets mature tRNAs, rather than pretRNAs (Chernyakov et al., 2008). Two 5’−3’ exonucleases were identified to function in
the RTD pathway by suppressor analysis, Rat1, which locates in the nucleus, and Xrn1,
which locates in the cytoplasm. Both of them require Met22 activity since a MET22-null
mutant leads to accumulation of the substrate pAp that subsequently inhibits the activities
of Xrn1 and Rat1 (Chernyakov et al., 2008; Dichtl et al., 1997).
1.2.2 tRNA subcellular dynamics
Transfer RNAs must exit the nucleus to the cytoplasm to function in protein synthesis;
therefore, it has been thought for a long time that tRNAs move one-way into the
cytoplasm. However, surprisingly, it was subsequently learned that cytoplasmic mature
10
tRNAs re-visit the nucleus, a process referred to as retrograde tRNA nuclear import
(Shaheen and Hopper, 2005; Takano et al., 2005). Imported cytoplasmic tRNAs return
back to the cytoplasm via a process termed tRNA re-export (Shaheen and Hopper, 2005;
Takano et al., 2005; Whitney et al., 2007). This retrograde process is conserved from
yeast to vertebrates (Barhoom et al., 2011; Shaheen et al., 2007; Zaitseva et al., 2006).
In vertebrate cells, tRNA nuclear export is mediated by Exportin-t (Exp-t), a
member of the Ran-binding karyopherins (Arts et al., 1998a; Kutay et al., 1998). The
orthologue of Exp-t in fungi, Xpo-t or Los1, is so far the only known tRNA exporter able
to bind to end-processed intron-containing tRNAs in a Ran-GTP dependent manner. The
crystal structure showed that Xpo-t from S. pombe binds tRNAs directly by contacting
the acceptor arm, TψC and D loops (Cook et al., 2009). The data support the early
observations that Exp-t prefers tRNAs with 5’ and 3’ matured ends but has no preference
for intron-containing or intron-less tRNAs. (Arts et al., 1998b; Lipowsky et al., 1999;
Lund and Dahlberg, 1998).
In yeast, los1Δ cells are viable, suggesting that there are tRNA export pathway(s)
in addition to Los1 (Hurt et al., 1987). Exp-5 (Msn5 in yeast) was identified as a tRNA
exporter and functions in parallel with Los1. However, there must exist additional export
pathway because los1Δ msn5Δ mutant is still viable (Takano et al., 2005).
Exportin-5 (Exp-5), or yeast orthologue Msn5, functions in exporting double
strand miRNA in mammalian cells (Bohnsack et al., 2004; Gwizdek et al., 2003; Lund et
al., 2004; Yi et al., 2003) and plants (Bollman et al., 2003). In yeast, Msn5 exports
phosphorylated nuclear proteins to cytoplasm such as transcription factors Pho4 and Far1
11
(Blondel et al., 1999; Kaffman et al., 1998). The role of Msn5 in tRNA subcellular
dynamics is solely in re-exporting back to the cytoplasm, as msn5Δ cells accumulate
mature tRNAs but not precursor tRNAs in the nucleus (Murthi et al., 2010). Since it has
been shown that the nuclear import process is constitutive, but tRNA nuclear
accumulation is dependent on nutrient availability, it has been proposed that tRNA
nuclear-cytoplasmic trafficking is most likely regulated at the re-export process in
response to nutrient availability (Murthi et al., 2010).
Spliced tRNAs are found to accumulate in the nucleus upon nutrient starvation
(Hurto et al., 2007; Shaheen and Hopper, 2005; Takano et al., 2005; Whitney et al., 2007).
One β-importin member, Mtr10 (vertebrate TRN-SR2), is responsible for tRNA nuclear
accumulation upon nutrient deprivation and for the constitutive retrograde nuclear
transport, directly or indirectly (Murthi et al., 2010). Relative to other members, there is
limited understanding of the mechanism by which Mtr10 functions in tRNA
nucleocytoplasmic dynamics. It is not known if Mtr10 binds tRNAs directly or adaptor
mediated, and it is conceivable that Mtr10 functions in tethering tRNAs in the nucleus,
therefore further studies on Mtr10 are necessary.
1.3 Amino acid stress responses
Yeast cells rapidly respond to changing environments by reprogramming gene expression.
Several studies have described the changes in global gene expression when the
availability of nutrient, such as amino acids, carbon source, or phosphate, are limited
(Castelli et al., 2011; Gasch et al., 2000; Kuhn et al., 2001; Natarajan et al., 2001; Ogawa
12
et al., 2000). Amino acid starvation is of particular interest in this work. It is known that
amino acid deprivation results in global translation repression, which has been thought to
inhibit general protein synthesis by which cells can save energy. Moreover, amino acid
stress also causes induced translation of the central positive transcription regulator Gcn4.
Gcn4 is a transcription activator that stimulates the transcription of several amino acid
biosynthesis pathways upon amino acid deprivation (for review, see Hinnebusch, 2005).
Signaling pathways involved in translation regulation for amino acid-starved cells
are well-studied (for reviews, see Gasch and Werner-Washburne, 2002; Wilson and
Roach, 2002). Uncharged tRNAs increase when cells are deprived for amino acids which
subsequently activates the protein kinase Gcn2. Gcn2 phosphorylates the translation
initiation factor eIF2-α, which prevents the regulatory circuit of eIF2 and initiation
complex formation. Phosphorylation of eIF2α subsequent leads to general translation
inhibition. Interestingly, although the global translation is inhibited, starvation of amino
acids, purine, or glucose, activates the translation of Gcn4 mRNA (for review, see
Hinnebusch, 2005). Gcn4 is regulated at multiple levels. There are four small uORFs in
the upstream sequence of the Gcn4 transcript. They serve to negatively regulate
translation of Gcn4. Under nutrient starvation, the ribosome bypasses the uORFs and thus
derepresses the translation of Gcn4 in a Gcn2-dependent manner (Hinnebusch, 1997).
Moreover, there are also several reports demonstrating that the derepression of Gcn4 can
also be regulated in a Gcn2-independent fashion (for review, see Hinnebusch, 2005).
Finally, Gcn4 can be regulated at the level of protein stability. The half-life of Gcn4 is 2
minutes when cells are grown in rich media, however, in cells deprived of amino acids
13
the half-life of Gcn4 increased to 10 minutes. Phosphorylation of Gcn4 by cyclin
dependent kinase Pho85 is required before it is degraded by Rad6 and Cdc34 (Kornitzer
et al., 1994; Shemer et al., 2002).
1.4 Microarray analysis
1.4.1 Microarray general applications and advanced usage for
translational profiling
Microarray technology is a very powerful approach to examine gene expression levels on
large or genome-wide scale. Arrays are created by thousands of probes robotically
spotted and immobilized on microscope glass slides or silicon chips (Affymetrix). The
probes can be DNA, cDNA, or oligonucleotides, and they are designed to hybridize to
specific fluorophore-labeled targets in samples. Thus the abundance of targets can be
detected and quantified based on fluorescence signal levels.
There are two basic types of arrays for expression analysis, dual channel (twocolor) and single channel (one-color). Two-color microarray (also called cDNA or
spotted array) was first developed by the Patrick Brown laboratory (Schena et al., 1995);
these arrays are generated by spotting cDNA probes on to the solid supports. The
experiment design typically compares two biological samples, for example, reference
(control) versus drug-treatment, and is thus measuring the relative abundance of targets
between samples. The two samples are usually labeled with two different dyes, such as
Cy3 (green) and Cy5 (red), and then mixed and hybridized to one array. During image
analysis, the ratio of the two dye intensities is calculated for each spot and thus represents
14
the relative amount of each target. The advantages of this technology are that the probes
can be customized for only a set of genes of interest (for example, immune-response
related genes, Kim et al., 2005) and the cost is relatively inexpensive.
Single-channel arrays, or high-density arrays, contain short-oligonucleotides (for
example, in Affymetrix GeneChip®, probes are 25 nucleotides in length), these are
designed to match part of each single dye-labeled target and thus are referred as
“probeset”. These oligonucleotides are produced directly on silicon chips by
photolithography technique (Fodor et al., 1991). A large number of different probesets
can be synthesized on a single chip, (for example, the Affymetrix Human Genome U133
Plus 2.0 Array is comprised of more than 54,000 probesets, http://www.affymetrix.com/)
and thus it is also called high-density array. This array generally provides “absolute”
intensity of each labeled target, so two chips are needed to compare the expression level
of a gene from two biological conditions.
To date, many microarray experiments are utilized for various applications.
Different experimental designs provide different kinds of information. In the last few
years, a growing number of studies combined technology of translation status and
microarray analysis to analyze translation profiles in a genome-wide scale under many
different conditions, such as environmental stress (Arava et al., 2003; Blais et al., 2004;
Kuhn et al., 2001; Shenton et al., 2006; Smirnova et al., 2005). The sucrose gradient
sedimentation of mRNA is affected by its ribosome occupancy and that is an indicator of
translational status as ribosome binding (initiation), moving along the coding region
(elongation), and falling off (termination). Thus, the distribution pattern of ribosome
15
becomes an important indicator for analyzing global translation profiles or translational
status of genes of interest. Different organization of ribosome association on an mRNA
can reflect its translation efficiency; for example, high occupancy on polysomes of a
particular transcript usually correlates with high efficiency of translation and may
generate high levels of protein products (Tuller et al., 2007).
In this study, Affymetrix GeneChip arrays (Yeast Genome 2.0 arrays) are used,
so the experiment and data analysis are specific to these arrays. RNA was extracted from
the biological samples, converted to cDNA, and then labeled with Biotin. The labeled
cDNAs were hybridized to the surface of the arrays, followed by washing and processing.
The arrays were scanned by a laser to generate the digital image files and the raw
intensity data were obtained.
1.4.2 Data analysis
After scanning the hybridized array an image file is created (.dat). Software provided by
Affymetrix, GeneChip Operating System (GCOS), computes the signal intensity from
image file and subsequently creates .cel files. The files need further processing before
being subjected to statistic analysis and selection of differentially expressed genes.
Although commercial software from microarray companies is costly, there are other
open-source programs in various platforms that are freely available. These programs
include Significance Analysis of Microarrays (SAM, which can be executed in Excel,
Tusher
et
al.,
2001),
http://www.bioconductor.org/),
Bioconductor
and
(Gentleman
GenePattern
16
(Reich
et
al.,
2004,
et
al.,
2006,
http://www.broadinstitute.org/cancer/software/genepattern/). In this project all of the
microarray data analyses were executed by employing the Bioconductor in R
environment or the GenePattern web-interface platform. Bioconductor uses the R
statistical programming language and provides various packages not only for microarray
analysis, but also for sequence data and other high-throughput data assays (554 software
packages while writing the thesis). There are also several diagnostic plots that can be
utilized to visualize the data set and to assess data quality for each step of data analysis.
For example, box plots and principle component analysis (PCA) can be applied as a
general assessment of microarray data. Scatter plots and volcano plots provide
comparison results of two samples. GenePattern is another useful platform for genomic
analysis, which offers many tools to analyze large-scale data in web-based interface or
the user’s computer.
There is no standard procedure for analyzing microarray data. Therefore, each
step of analyzing decisions leads to non-identical results. Generally, the pipeline of
microarray data analysis includes pre-processing of raw data, identification of significant
differential genes, visualization, and interpretation. Each of the steps is briefly described
below and the details are written with R language in Appendix P.
Pre-processing
On Affymetrix GeneChips, there are many probes (short oligonucleotides), referred as a
probeset, designed for targeting a single gene (Figure 1. 3). The .cel file contains signal
intensity data of each probe. Therefore, it is necessary to process the intensities of those
17
probesets into gene expression values for each target. This step is called normalization. In
addition, there are other factors that must be considered such as technical artifacts. Thus
the purpose of normalization is not only to process expression values, but also to remove
these artificial effects and to correct backgrounds among chips. In this procedure, the cdf
(chip description file) file, which is provided from Affymetrix, is required because it
offers the identity of the probe information. There are several methods to perform
normalization. One of them, Robust Multiarray Average (RMA), available in a package
called “affy” from Bioconductor, is currently most commonly used for microarray
normalization (Bolstad et al., 2003; Irizarry et al., 2003). RMA is an algorithm and the
assumption of RMA is that usually only a small percentage of genes are altered in
different conditions. Thus RMA uses quantile normalization and median polish (an
alternative way to get median value) to calculate the expression values by using all
probesets (the log2-converted perfect-match intensities) across all chips. In this way it
provides sensitive detection of differential expressed genes with statistical tests.
Identification of differential expressed genes
The main purpose of microarray analysis is to identify the genes which are differentially
expressed in different conditions or treatments. Numerous statistical strategies are
designed and developed for selecting those expression-changed genes; most of them use
variants of t-test to take sample size and variations into account. Since the traditional
multiple tests is not appropriate for the genome-wide scale data, several alternative
methods for permutation of p-value are developed for more accurate selection of genes of
18
interest, for example, the Bonferroni correction or false discovery rate (FDR). In this
project, the package of “Linear Models for Microarray data analysis” (limma) in
Bioconductor was used to select significant differentially expressed genes (DEGs).
Employing limma analysis, DEGs can be ranked by both fold-change and Bonferroniadjusted p-value (Smyth, 2004). Once the list of significant differentially expressed genes
is created, the data can be used for a variety of following analyses, such as hierarchical
clustering and pattern recognition.
Figure 1. 3. Probe and probesets.
Hierarchical clustering
When significant differentially expressed genes are selected, the next challenge is how to
focus on real genes of interest. One approach is clustering, which is widely used in
microarray analysis. Based on various algorithms, the produced clusters can have
19
differences in properties. For example, hierarchical, k-means, and self-organizing map
(SOM), etc., are common methods for analyzing microarray data (Sherlock, 2000). The
hierarchical clustering model is generated based on distance connectivity. Briefly, the
algorithm calculates the distance of each gene expression value and returns groups of
genes or samples with similar expression profiles. Additionally, there are various ways to
measure distances and to cluster groups. Moreover, the input files can be normalized
expression values from genome-wide array without statistical analysis or only the
expression profiles from differential expression genes. Therefore, each choice in
measurement and in clustering would give different results. In this project, the
hierarchical analysis and the visualization of the results were generated from GenePattern.
GO term enrichment analysis and FunCat
Other approaches to focus on genes of interest are by employing the Gene Ontology (GO)
enrichment
analysis
bin/amigo/term_enrichment?session_id=)
(http://amigo.geneontology.org/cgior
MIPS
FunCat
analysis
(Functional
Catalogue, http://mips.helmholtz-muenchen.de/proj/funcatDB/search_main_frame.html)
(Ruepp et al., 2004). GO is a biological database that provides information of gene
products within defined categories (for review, see Rhee et al., 2008). FunCat provides
such information in a different way. Using similar concepts like clustering, GO term
enrichment analysis and FunCat group genes associated with similar phenotypes and
compare the occurrence frequency with genome frequency by statistical analysis. In this
work both tools are performed to gain more insight of the gene list.
20
1.5 Aim of this study
The major goal of this study is to investigate the potential role(s) of tRNA nuclearcytoplasmic trafficking in translation regulation, globally and specifically, by analyzing
the polysome profiles and by employing microarrays of mRNAs that are or are not
associated with polysomes. I compared the translation profiles by microarray analysis of
mRNAs isolated from wild-type cells to mRNAs isolated from cells defective in tRNA
nuclear import (mtr10Δ) or re-export (msn5Δ) grown in fed condition or acutely starved
by removal of all amino acids (Chapter 3). In addition, since little is known about the
importer Mtr10, a minor aim of this work was to analyze transcriptional profiles of
mtr10Δ cells, which could provide insights into its cellular function(s) (Chapter 4).
21
CHAPTER 2
Materials and Methods
2.1 Yeast growth conditions and strain construction
Most Saccharomyces cerevisiae strains employed in this study were derived from haploid
BY4742 (MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0, from Open Biosystems (Winzeler et al.,
1999) or are otherwise indicated. All of the strains are listed in Table 2. 1.
2.1.1 Media and growth conditions
Yeast cells were grown in either YEPD (yeast extract/peptone medium with 2 %
glucose/dextrose) or SC medium (Synthetic Complete defined medium; Difco yeast
nitrogen base without amino acids, supplemented with amino acids, adenine [0.04 g/L],
uracil [0.04 g/L], and 2 % glucose as carbon source) at 23°C or 30°C in an air shaker
with speed of 220 rpm. Amino acids in SC medium included L-arginine (0.02 g/L), Laspartic acid (0.1 g/L), L-glutamic acid (0.1 g/L), L-histidine (0.02 g/L), L-isoleucine
(0.06 g/L), L-leucine (0.06 g/L), L-lysine (0.03 g/L), L-methionine (0.02 g/L), Lphenylalanine (0.05 g/L), L-serine (0.375 g/L), L-threonine (0.2 g/L), L-tryptophan (0.02
22
g/L), L-tyrosine (0.05 g/L), L-valine (0.15 g/L). For amino acid starvation experiments,
pre-warmed SC medium without addition of amino acids was used.
2.1.2 Yeast strain construction
Oligonucleotides
DNA oligonucleotides were synthesized by SIGMA-ALDRICH. The sequences of all
employed oligonucleotides are in Table 2. 2.
High efficiency yeast transformation
Double deletion and genomic C-terminal 3HA- or GFP-tag strains were generated by
introducing PCR fragments with selection marker using a Lithium acetate (LiOAc)
transformation method (Chen et al., 1992a; Longtine et al., 1998). Yeast cells were grown
overnight in 50 ml of rich YEPD media until OD600 reached 1-3. Cells were harvested,
washed twice with 1X TE/LiOAc solution (1M LiOAc and TE buffer containing 10 mM
Tris-HCl, pH7.4, and 1mM of EDTA, pH8.0, served as 10X stocks), and then
resuspended in 0.7-1 ml of 1X TE/LiOAc solution. For each reaction, 100 µl of yeast
competent cells were then mixed with 10 µl of PCR products of replacement cassettes
after ethanol-precipitated or column-purified, and 10 µl of denatured salmon-sperm DNA,
followed with addition of 650 µl transformation solution (ratio of 60% PEG: LiOAc: TE:
H2O as 7:1:1:1). The mixtures were incubated at 23°C or 30°C in an air shaker for 1 hr,
followed by heat-shock in a 42°C water bath for 15 min. Cells were then collected by
centrifugation for 10 seconds and then plated onto selective solid media and incubated for
23
2 or more days. Colonies were then picked and grown on new selective solid media for a
second round of selection. For drug-selective media, such as Hygromycin B, cells were
grown in YEPD media for 6 hr or overnight prior to plating.
Strain construction
To select deletion strains, yeast cells were mixed with an appropriate DNA replacement
cassette, natMX4, hphMX4 (Goldstein and McCusker, 1999), or Kleuyveromyces lactis
LEU2 (Gueldener et al., 2002), followed by high efficiency transformation, and grown on
solid media containing the appropriate drugs: YEPD + clonNAT (100 mg/L; Werner
BioAgents, Jena, Germany), YEPD + hygromycin B (300 mg/L, Calbiochem, La Jolla,
CA), or SC-Leu, respectively. For construction of genomic C-terminal 3HA- or GFP-tag
strains, yeast cells were incubated with knock-in cassette (pFA6a-3HA-His3 or pFA6aGFP-His3) and were grown and selected on the SC-his solid media.
Preparation of yeast genomic DNA
For deletion strains, yeast cells were confirmed by PCR analysis of genomic DNA with
primers complementary with an upstream region of the target gene and with selection
marker. To confirm C-terminal tagging, primers complementary with middle of the
particular coding region and with epitope were used. To extract genomic DNA, one
colony (or more than one) with size of approximately 1 mm was picked from plates,
transferred into a microfuge tube containing 100 µl of zymolyase digestion solution, and
incubated at 37°C for 30 min. 1/10 volume of 10% SDS and 2 volumes of
24
phenol/chloroform were added followed by vigorously shaking. After centrifugation,
supernatants were transferred and the nucleic acids were precipitated with 2 volumes of
ethanol and 1/10 volume of 3M sodium acetate in -80°C. DNA pellets were then
collected, washed by 70 % ethanol, and dissolved in 20 µl of sterile H2O.
2.1.3 Growth assay
Yeast cells were cultured overnight in YEPD medium prior to the growth assay. Cells
were adjusted to same starting OD600 and then 10-fold serial dilutions in sterile H2O were
prepared. 5 µl aliquots of each dilution was spotted on the indicated solid media, such as
SC, SC-met, or SC-arg, followed by incubated at indicated temperatures for 2 or more
days and then photographed.
2.2 Polysome profiles and RNA isolation
For microarray analysis, wild-type (BY4742), msn5Δ, and mtr10Δ cells were used; for
polysome profile analysis, additional tRNA retrograde mutants, los1Δ and los1Δ msn5Δ,
were used.
2.2.1 Polysome profiles
One liter of cell culture was grown in synthetic complete media at 30°C in an air shaker
to early logarithmic phase (A600 around 0.35). The culture was divided into two bottles;
after centrifuging (~ 2,700
g, room temperature, 5 min) the cultures were resuspended
with 500 ml of 30°C pre-warmed SC and SC-aa (SC medium lacks all amino acids)
25
medium, respectively, and the two cultures were returned to the shaker for 30 min.
Cycloheximide was added to each culture to final concentration 100 µg/ml for two
minutes before cultures were harvested. Cultures were cooled on ice less than 5 min, and
cells were harvested and washed with 20 ml of cold freshly-prepared lysis buffer (20 mM
Tris-HCl with pH 8.0, 140 mM KCl, 1.5 mM MgCl2, 0.5 mM dithiothreitol, 100 µg/ml
cycloheximide, 1 mg/ml heparin). After the culture was washed, the cells were
transferred to 15 ml conical tubes and then resuspended in 750 µl of lysis buffer. ~350 µl
of cold acid-washed glass beads (0.4-0.6 mm diameter, Thomas Scientific) were added
and then cells were disrupted by vortexing in cold room with 10 cycles of 30 seconds
burst and 30 seconds ice. The clear crude lysate was obtained after centrifugation at ~
12,600
g for 5 min at 4°C. 5 µl of lysate was transferred into 995 µl of water for A260
measurement to estimate the RNA concentration.
Twenty A260 units of cell extract with the addition of Triton X-100 to final
concentration 1 % were loaded onto an 11ml gradient (Polyallomer tube, Beckman
Coulter) composed with five layers of 10%, 20%, 30%, 40%, and 50% sucrose (w/v) in
gradient buffer (20 mM Tris-HCl with pH 8.0, 140 mM KCl, 5 mM MgCl2, 0.5 mM
dithiothreitol, 100 µg/ml cycloheximide, 0.5 mg/ml heparin). Gradients were centrifuged
in SW41 Ti rotor (Beckman Coulter) at 39,000 rpm for 2.5 hr in 4°C. Gradient was
fractionated into 14 tubes (~0.9 ml) using ISCO UA-6 collection system (Brandel,
Gaithersburg, MD) with UV254 recorder. During the process of fractionation polysome
profiles were monitored and traced continuously.
26
2.2.2 Quantification of polysome profiles
The scanned polysome profiles were analyzed using an area measurement tool in Adobe
Acrobat 8 Professional version. Statistical significant analyses were conducted in
Microsoft Excel with two tail t test. Figure 2. 1 shows how each peak was selected in the
polysome profiles in fed or starved conditions. In fed condition, the areas of 40S and 80S
peaks are measured separately. This sum of 40S and 80S area represented non-translating
pool. In amino acid starved cells, there was a large increase in the non-translating region
and usually above the range of UV254 detector. Therefore, the area of 40S + 80S was
estimated by projecting (the shading region of right panel in Figure 2. 1). Profiles shown
in Figure 2. 1 are representatives from more than three repeated experiments.
Fed
Starved
Figure 2. 1. Illustration of quantification method.
27
2.2.3 RNA extraction
For microarray experiments, polysomal RNA isolation procedures were similar as
previously described (Arava et al., 2003; Coller and Parker, 2005). Briefly, fractions 5 to
8 (non-polysomal RNA samples) and 10 to 14 (polysomal RNA samples) were pooled
together in 30 ml glass tubes. Fractions were then mixed with 2-fold volumes (2V) of 8M
Guanidine-HCl; the RNAs were then precipitated in 100% ethanol. The nucleic acid
pellets were obtained by centrifugation using JA-17 rotor (~13,800
g, for 20 min at
4°C). The pellets were washed once with 85% ethanol, dissolved in 400 µl of TE buffer,
and then transferred into 2 ml microfuge tube following by phenol/chloroform extraction.
After centrifugation (~ 12,600
g for 10 min at 4°C), the supernatant was transferred to
a new 1.5 ml microfuge tube and 200 µl of 7.5 M LiCl (to final concentration 2.5M) was
added to precipitate the RNAs after stored at -20°C overnight. RNA samples were
collected at ~ 12,600
g for 20 min at 4°C and they were washed with 85% ethanol
followed with dissolving in sterile H2O. To remove LiCl, RNA samples were precipitated
again by ethanol/NaOAc and resuspended in 7 to 15 µl of nuclease-free water.
Unfractionated RNA samples were directly extracted from the lysates for “total RNA”.
Concentrations of RNA samples were measured by A260.
2.3 Microarray data analysis
The quality of total, polysomal, or non-polysomal RNAs from BY4742, msn5Δ, and
mtr10Δ cells grown in fed or amino acid starvation conditions were estimated using an
Agilent Bioanalyzer. Microarray experiments were then performed using Affymetrix
28
GeneChip Yeast Genome 2.0 arrays according to manufacturer’s instructions by the OSU
microarray
shared
resource
(http://www.osuccc.osu.edu/microarray/).
Data
pre-
processing and further statistical analysis were conducted using the free open-source
software R (version 2.7.2 or later, R development Core Team, 2011) (http://www.rproject.org) and Bioconductor suite (Gentleman et al., 2004) supplemented with packages
of Affy (Irizarry et al., 2003), Limma (linear models for microarray data) (Smyth, 2004),
and others, as described in the programming codes in Appendix P. Microarray raw and
normalized data set will be deposited in the GEO database.
2.3.1 Pre-processing of raw data
In this project, the procedures of pre-processing included raw intensity data (.cel files)
imported into R, removal of S. pombe probes, Robust Multiarray Average (RMA)
normalization, and filtering outliers. After RMA normalization, expression intensities of
each target were simultaneously transformed to a single log2 value, which was then
utilized for calculation of the translational activity index (P/NP) using the equation log2 P
– log2 NP. Distinct processed dataset from each mutant under fed or starvation were then
generated (mtr10Δ versus wild-type in fed or in starvation conditions; msn5Δ versus
wild-type in fed or in starvation conditions). Codes are in Appendix P.
2.3.2 Identification of significant differentially-expressed genes
Each dataset was subjected to fit the linear model using the limma program according to
instructions. Significant differentially expressed genes were selected by setting cutoff
29
conditions, such as log2 (fold-change) and adjusted p-value, and were highlighted in
volcano plots. Codes are in Appendix P. These selected genes were then annotated and
exported for further applications. In this study, hierarchical clustering, gene ontology
enrichment analysis, functional categories were used.
2.3.3 Hierarchical clustering of significantly changed target transcripts
When differentially-expressed targets were selected, their expression profiles from P, NP,
and T, were extracted for heatmap creation. Hierarchical clustering analysis and
generation of heatmaps were conducted using web-based tool in the GenePattern
platform
(by
using
the
modules
of
HierarchicalClustering
and
HierarchicalClusteringViewer) (Reich et al., 2006) with the parameters of pearsoncorrelation in row distance, no column clustering, and pair-wise complete linkage.
(http://www.broadinstitute.org/cancer/software/genepattern/).
2.4
Northern blot analysis
Total RNA (12 µg in 6 µl) samples were denatured (for each sample, denaturing buffer
contained 3 µl of 10X MOPS buffer, 5.3 µl of 37 % formaldehyde, 15 µl of de-ionized
formamide, 1 µl of 1mg/ml ethidium bromide) at 65°C for 15 min, following by chilling
on ice and addition of loading dye (75 % glycerol and 0.2 % bromophenol blue in RNA
denature buffer). Denatured RNA samples were separated by 1.2 % agarose
formaldehyde gels in 1X MOPS buffer subjected to electrophoresis at 50-80 V for
approximately 5-6 hr. RNAs were then capillary transferred to Hybond N membrane (GE
30
Healthcare) using 20X SSC, following by UV cross-linking to the membranes. The blot
was hybridized at 42°C with purified radiolabeled DNA probes. Blots were washed with
wash buffer (2X SSC, 0.05 % SDS). The blots were then analyzed using Typhoon Trio
variable Mode Imager (GE Healthcare) and ImageQuant 5.0 (Molecular Dynamics).
2.4.1 Preparation of DNA probes
DNA probes (length between 300 to 800 base pair) used for Northern blots were
generated by PCR with genomic DNA from wild-type cells or with plasmids from the
yeast genomic tiling collection (Jones et al., 2008, OpenBiosystems). DNA probes were
randomly radiolabeled with random primers (Invitrogen), α–32P-dCTP (PerkinElmer,
Massachusetts, USA), dATP, dTTP, and dGTP, by DNA polymerase Klenow (Fermentas,
Maryland, USA). Labeled probes were purified by eluting from G-50 column (GE
Healthcare). The purified probes were then denatured in boiled water for 5 min and added
into hybridization buffer. All of the oligonucleotides used in this study are listed in
Table 2. 2.
2.5 Western blot analysis
2.5.1 Protein extraction
Whole cell protein extracts were prepared from 15 ml cell cultures grown at 30°C to a
density of 0.35-0.45 OD600. Cells were washed once with cold water and disrupted in 100
µl lysis buffer (50 mM Tris-HCl with pH7.4, 150 mM NaCl, 25 mM EDTA, 1 % Triton
X-100, 0.5 % SDS, 10 mM PMSF, 1X protease inhibitor [Calbiochem, cocktail set IV])
31
with approximately 50-70 µl of acid-washed glass beads. Cleared cell extracts were
obtained after centrifugation at ~ 12,600
g for 5 min at 4°C. Protein concentrations
were determined from 1 µl of extracts using the Bradford method (Bio-Rad). Protein
extracts were then denatured in 4X SDS sample loading buffer (0.2 M Tris-HCl with
pH6.8, 8 % SDS, 0.4 % BPB, 40 % Glycerol, 57.2 mM 2-ME) in boiling water for 5
minutes.
2.5.2 Western blot and quantification
Depending on the individual endogenous target protein intracellular levels, total amounts
of 5 to 20 µg of protein extracts from each strain were resolved on 10% SDS-PAGE with
running buffer (0.025 M Tris, 0.192 M glycine, 0.1 % SDS). Immunoblotting was
employed using a semi-dry transfer apparatus (BioRad Trans-Blot) at 15 V for 1 hr in
transfer buffer (30 mM glycine, 0.037 % SDS, 20 % methanol, 48 mM Tris-HCl, pH 8.0).
The blots were probed with primary antibodies in 5 % non-fat milk in 1X TBST buffer
(20 mM Tris-HCl, pH 7.4, 120 mM NaCl, 0.1 % Tween-20). 3HA or GFP fusion proteins,
Pgk1, or Kar2, were detected using horseradish peroxidase (HRP)-conjugated
electrochemiluminescence (ECL) technology (Pierce, Rockford, IL, USA) using primary
antibodies: anti-HA, (Roche, Rat monoclone, 3F10, 1:1,500), anti-GFP (Roche, mouse
polyclone, 1:1,500), anti-Pgk1 (a kind gift from Paul Herman lab; rabbit polyclone, 1:
15,000), anti-Kar2 (Santa Cruz Biotechnology, rabbit polyclone, y-115, sc-33630, 1:
5,000). Quantification of protein signals were performed by ImageJ open source software
(http://rsbweb.nih.gov/ij/).
32
2.6 Cis-regulatory element analyses of targets
Sequences of upstream and downstream of target genes were retrieved from web-based
resource (Regulatory Sequence Analysis Tools, RSAT, http://rsat.ulb.ac.be/rsat/)
(Thomas-Chollier et al., 2011; Thomas-Chollier et al., 2008; van Helden, 2003). The
output text file was later utilized for further analyses of codon bias usage and amino acid
usage.
2.6.1 Codon bias and amino acid usage
For investigating the codon bias and amino acid usage, the open reading frame sequences
of translational differentially expressed genes (DEGs) in fed mtr10Δ cells were extracted
from the table supplemented with the frequencies of each codon in each gene by the
generous help of Dr. Thomas Begley (State University of New York in Albany) to
compile the algorithm. Z score for each transcript, calculated as described previously
(Begley et al., 2007). The data were imported into GenePattern for generation of
hierarchical heat map.
33
Table 2. 1. Yeast strains used in this study
34
Strain
Genotype
Source
BY4742
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0, wild-type
Winzeler et al., 1999
los1Δ
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 los1::kanMX4
Winzeler et al., 1999
msn5Δ
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 msn5::kanMX4
Winzeler et al., 1999
los1Δmsn5Δ
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 los1::kanMX4 msn5::hphMX4
This study
mtr10Δ
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 mtr10::natMX4
This study
BY4741
MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0, wild-type
Winzeler et al., 1999
dhh1ko1
MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 dhh1::hphMX4
Hurto and Hopper, 2011
pat1ko8
MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 pat1::natMX4
Hurto and Hopper, 2011
pat1dhh1-11
MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 pat1::natMX4 dhh1::hphMX4
Hurto and Hopper, 2011
mtr10Δ
MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 mtr10::natMX4
Murthi et al., 2010
HYC163
MATα BY4742 MET22-3HA::His3MX6
This study
HYC171
MATα los1Δ MET22-3HA::His3MX6
This study
HYC179
MATα msn5Δ MET22-3HA::His3MX6
This study
HYC186
MATα los1Δ msn5Δ MET22-3HA::His3MX6
This study
HYC192
MATα mtr10Δ MET22-3HA::His3MX6
This study
HYC261
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 MET22::natMX4
This study
HYC296
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 trm8::Kl.leu2 trm4::natMX4
This study
HYC348
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 trm8::Kl.leu2 trm4::kanMX4 met22:natMX4
This study
HYC337
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 msn5::kanMX4 trm8::Kl.leu2 trm4::natMX4
This study
HYC335
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 los1::kanMX4 trm8::Kl.leu2 trm4::natMX4
This study
HYC341
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 los1::kanMX4 msn5::hphMX4 trm8::Kl.leu2
trm4::natMX4
This study
34
(continued.)
Table 2. 1. (continued.)
35
Strain
Genotype
Source
HYC375
This study
HYC354
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 mtr10:: natMX4 trm8::Kl.leu2
trm4::kanMX4
MATα BY4742 MET2-3HA::His3MX6
HYC364
MATα los1Δ MET2-3HA::His3MX6
This study
HYC359
MATα msn5Δ MET2-3HA::His3MX6
This study
HYC367
MATα los1Δ msn5Δ MET2-3HA::His3MX6
This study
HYC370
MATα mtr10Δ MET2-3HA::His3MX6
This study
HYC479
MATα BY4742 MET3-3HA::His3MX6
This study
HYC483
MATα los1Δ MET3-3HA::His3MX6
This study
HYC486
MATα msn5Δ MET3-3HA::His3MX6
This study
HYC489
MATα los1Δ msn5Δ MET3-3HA::His3MX6
This study
HYC492
MATα mtr10Δ MET3-3HA::His3MX6
This study
HYC495
MATα BY4742 MET14-3HA::His3MX6
This study
HYC500
MATα los1Δ MET14-3HA::His3MX6
This study
HYC504
MATα msn5Δ MET14-3HA::His3MX6
This study
HYC508
MATα los1Δ msn5Δ MET14-3HA::His3MX6
This study
HYC514
MATα mtr10Δ MET14-3HA::His3MX6
This study
HYC560
MATα BY4742 CYS4-3HA::His3MX6
This study
HYC565
MATα los1Δ CYS4-3HA::His3MX6
This study
HYC570
MATα msn5Δ CYS4-3HA::His3MX6
This study
HYC574
MATα los1Δ msn5Δ CYS4-3HA::His3MX6
This study
HYC578
MATα mtr10Δ CYS4-3HA::His3MX6
This study
HYC1162
MATα BY4742 ARG3-3HA::His3MX6
This study
35
This study
(continued.)
Table 2. 1. (continued.)
36
Strain
Genotype
Source
HYC619
MATα los1ΔARG3-3HA::His3MX6
This study
HYC1165
MATα msn5Δ ARG3-3HA::His3MX6
This study
HYC630
MATα los1Δ msn5Δ ARG3-3HA::His3MX6
This study
HYC1167
MATα mtr10Δ ARG3-3HA::His3MX6
This study
HYC1171
MATα BY4742 ARG5,6-GFP(S65T)::His3MX6
This study
HYC636
MATα los1Δ ARG5,6-GFP(S65T)::His3MX6
This study
HYC1174
MATα msn5Δ ARG5,6-GFP(S65T)::His3MX6
This study
HYC638
MATα los1Δ msn5Δ ARG5,6-GFP(S65T)::His3MX6
This study
HYC1175
MATα mtr10Δ ARG5,6-GFP(S65T)::His3MX6
This study
HYC1012
MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 pat1ko8 ARG3-3HA::His3MX6
This study
HYC1017
MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 pat1ko8 MET3-3HA::His3MX6
This study
HYC1041
MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 mtr10::natMX4 MET3-3HA::His3MX6
This study
HYC1057
MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 mtr10::natMX4 ARG3-3HA::His3MX6
This study
HYC1078, BY4741
MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 ARG3-3HA::His3MX6
This study
HYC1082, BY4741
MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 MET3-3HA::His3MX6
This study
HYC1086, dhh1
MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 ARG3-3HA::His3MX6
This study
HYC1090, dhh1
MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 MET3-3HA::His3MX6
This study
HYC1094, dhh1pat1
MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 ARG3-3HA::His3MX6
This study
HYC1098, dhh1pat1
MATa his3Δ0 leu2Δ0 met15Δ0 ura3Δ0 MET3-3HA::His3MX6
This study
HYC1185, BY4742
(HYC1171 derivative) ARG5,6-GFP(S65T)::His3MX6 [pRS426 URA3]
This study
HYC1186, BY4742
(HYC1171 derivative) ARG5,6-GFP(S65T)::His3MX6 [Trz1-MORF URA3]
This study
HYC1195, tyw1
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 tyw1::kanMX4 ARG3-3HA::His3MX6
This study
HYC1201, BY4742
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 ARG3-3HA::His3MX TRM5-GFP::kanMX4
This study
36
(continued.)
Table 2. 1. (continued)
Strain
Genotype
Source
HYC1210, BY4742
This study
HYC1360, BY4742
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 ARG3-3HA::His3MX TRM5-NESGFP::kanMX4
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 mtr10::natMX4 ARG3-3HA::His3MX
TRM5-GFP::kanMX4
MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 mtr10::natMX4 ARG3-3HA::His3MX
TRM5-NES-GFP::kanMX4
MATα BY4742 LEU4-3HA::His3MX6
HYC1360, los1msn5
MATα los1Δ msn5Δ LEU4-3HA::His3MX6
This study
HYC1374, mtr10
MATα mtr10Δ LEU4-3HA::His3MX6
This study
HYC1381, BY4741
MATa BY4741 LEU4-3HA::His3MX6
This study
HYC1378, dhh1pat1
MATa dhh1Δ pat1Δ LEU4-3HA::His3MX6
This study
HYC1380, dhh1
MATa dhh1Δ LEU4-3HA::His3MX6
This study
HYC1383, mtr10
MATa mtr10Δ LEU4-3HA::His3MX6
This study
HYC1231, mtr10
HYC1232, mtr10
37
37
This study
This study
This study
Table 2. 2. Oligonucleotides used in this study
Name
Purpose
Sequence (5’→3’)
Source
mtr10 deletion F
(::nat or ::hph)
mtr10 deletion R
(nat or hph)
TGAGGATATACTAAGGATTAACTTGCGTTATGGACAACTTACAG
GTATCTGCAGGTCGACGGATCCCCGG
CCATCCAACAAACGCCCTAATCCTTCCTTCCCTCACCTTTCTGTA
ATCCCTTGAGTGGATCTGATATCGA
WHIT47
mtr10 upstream
CATCGGCACTATTCACAGGAA
WHIT48
mtr10 downstream
GGCATATCCTGATGTACTCAG
Shaheen and Hopper,
2005
Shaheen and
Hopper, 2005
Shaheen and
Hopper, 2005
Shaheen and
Hopper, 2005
msn5 deletion F
(::nat or ::hph)
msn5 deletion R
(::nat or ::hph)
CGTTGATTGGAAGAAAAGTAATGGATTCCACAGGCGCTTCTCAG
ATTGTTACAGCTGAAGCTTCGTACGC
CAGACCCACATTAAAACGCTTGATTATATGCATATTTACCGGCT
GCCGACTGTGGATCTGATATCATCGA
HY01 F
msn5 upstream
CCATTGAACAGAGGTGCTGGAG
This study
HY02 R
msn5 downstream
GGTGTATGCACGTACCTCTTAC
This study
HY06 F
mtr10 Midstream
TTGGTAGATATACCGAATGGACAG
This study
HY07 R
mtr10 Midstream
ACTCAATATCAATCGAACTCTGCAC
This study
HY25 F
met22 DNA probe generation
TCCTATTGACGGAACCAAGG
This study
HY26 R
met22 DNA probe generation
CCTCCAGCTTCATGGACAAT
This study
HY33 F
met3 DNA probe generation
TAGAGCCCACAGGGAGTTGACTG
This study
HY34 R
met3 DNA probe generation
GGTCTTGGTGGGTTGGATTCTC
This study
HY37 F
met2 DNA probe generation
CTAGTGCTTGAGTCTGGCGTGGT
This study
HY38 R
met2 DNA probe generation
GACATACGTGCAGCCGATAGTCC
This study
HY43 F
met14 DNA probe generation
CGCAAGGCATTGAGAAAACAGG
This study
HY45 F
Met28 DNA probe generation
CATTGCTGCTGGTTAGCAGTGG
This study
WHIT37
WHIT38
WHIT59
WHIT60
38
38
Michael Whitney
Michael Whitney
(continued.)
Table 2. 2. continued.
Purpose
Sequence (5’→3’)
Source
HY46 R
Met28 DNA probe generation
CTACCTGCCCATGTTCCGTCTCT
This study
HY73 F
Met22 C-term tag
HY74 R
Met22 C-term tag
HY75 R
confirm 3HA tag
GCGCCTCAGCACTGAGCAGCG
This study
TPL010 R
confirm GFP tagg
TTGTGACCATTAACATCACCATCT
Tsung-Po Lai
HY83 F
Trm8 upstream
GCTAAGTGGGTTGGGTTTGGTTCGTACG
This study
HY84 R
Trm8 downstream
CGGAAGAGCTTGCGGCTCAAATAACCTGG
This study
HY85 F
Trm4 deletion (::natMX4 or
::kanMX4)
CACTTCCTTTTATCTACACTGTAATCCGAAGAATACACTATAAG
GCTGGCTAGAAGccaggtcgacggatccccgg
GCCTTTTAATAATATACATTTACTTTACAGTGGAGGGGATAAGA
AACATGATAACTATCAATTAGCAGCGCcgtggatctgatatcatcgatgaattcga
gc
39
Name
GTTATAGCGTCAAGTGGCCCACGCGAGTTACATGACTTGGTGGT
GTCTACATCATGCGATGTCATTCAGTCAAGAAACGCCcggatccccgg
gttaattaa
CACATACACACATATATATATGTACTCATATATTTATGTCTATCA
ATAAAGTAAAATATATGTTATgaattcgagctcgtttaaac
This study
This study
This study
HY86 R
Trm4 deletion (::natMX4 or
::kanMX4)
HY87 F
Trm4 upstream
GCGGTGCTGAAGTAACGAAACCGCGCGC
This study
HY88 R
Trm4 downstream
CCGCAGGTCTTTCGCAATTTATACCTTGGGTC
This study
HY89 F
Trm8 midstream
GGCTGTGGATTCGGTGGGTTGATGATAG
This study
HY90 F
Trm4 midstream
GTCGAAGATAGCACTGAGGCGGC
This study
HY91 F
Trm8 deletion (::Kl.leu2)
HY92 R
Trm8 deletion (::Kl.leu2)
HY93 F
Met22 deletion (::natMX4 or
::hphMX4)
HY94 R
Met22 deletion (::natMX4 or
CAGCAGTTCCCATAGGATAAAATTTTCAAGCGTTTATTGTTAAG
CTGAAAGCCAAGCCcgccagctgaagcttcgtac
GTATATGTGGTAAATTGTTCTAGTTATACATCTATGTTACAATAT
GGCTGGCGccttcacttgcatctatccgttc
GTTAGTAAGTAAGAAGTTTAAAGACAACTCAGAAGACATCAGC
ACTTTACTCTGGCATTGGAAAGAGAATTATTGGccaggtcgacggatccc
cgg
GTACTCATATATTTATGTCTATCAATAAAGTAAAATATATGTTAT
39
This study
This study
This study
This study
This study
(continued.)
Name
Purpose
Sequence (5’→3’)
Source
::hphMX4)
TTAGGCGTTTCTTGACTGAATGACATCGCcgtggatctgatatcatcgatgaatt
cgagc
HY95 F
Met22 upstream
CAAGAGGCTCCTTGAGGGCATTCAAG
This study
HY96 R
Met22 downstream
CGGTCAGAATCCTGCTGTATTTTCTTGTCTCAC
This study
HY97 F
Met22 midstream
CCCTTGGTTCCGTCAATAGGATCCAAACACC
This study
GGTAACGATGAAACGAAGACGTCTGTCTTTGGTGAGGCCGAAG
AAGTTACCAACTGGcggatccccgggttaattaa
GCTGTTTGTCTATATATAAATATAGATATAGATATACATGTACTG
GTTTATCTATGTTATGCCgaattcgagctcgtttaaac
This study
40
HY106 F
Met2 C-term tagging
HY107 R
Met2 C-term tagging
HY110 F
Met2 upstream
CCGCTTCGTTGTACAACCTACCTG
This study
HY111 F
Arg3 DNA probe generation
GGTGCCCAACCGATGTTTTTAGG
This study
HY112 R
Arg3 DNA probe generation
CGCACCGTTTCTCTCAGCAAC
This study
HY117 F
Met3 C-term tagging
HY118 R
Met3 C-term tagging
HY119 F
Met14 C-term tagging
HY120 R
Met14 C-term tagging
HY133 F
Arg3 C-term tagging
HY134 R
Arg3 C-term tagging
HY135 F
Arg5,6 DNA probe generation
CGCGCTTATTGGTGCTAGAGGT
This study
HY136 R
Arg5,6 DNA probe generation
CCTTGAAACCACTGCCCAACAT
This study
HY137 F
Arg5,6 C-term tagging
GCAAAATATTAATCTTGCTATGGGTTATGGAGAGTATGCTGGTA
This study
CCTATTTCACATATTGTACAAAAAGTTGTCCTATTCTTGGAAGAC
AATGGCTTTTTTGTATTTcggatccccgggttaattaa
GCAAATCTATTTATTTTGCGCGGTCGATCATGAATTTTGCCCTAC
TTTTGAGATGGGgaattcgagctcgtttaaac
CGGTTGAAGAATGTGCTACCATTATTTATGAGTACTTAATCAGT
GAAAAAATCATCCGTAAGCATTTGcggatccccgggttaattaa
CCTCGAATAAATATGTTCTATATTATATATATACATCTTTTATAT
ATCATTAAATGTACAGgaattcgagctcgtttaaac
GCAGCTATGTCTGCCATTGATATCTTTGTTAATAATAAAGGTAAT
TTCAAGGACTTGAAAcggatccccgggttaattaa
GCAAAATAATCAATGTATATCATTATTCATGCATCTATATCTGTA
TTTATATATTAGTTATTAAGgaattcgagctcgtttaaac
40
This study
This study
This study
This study
This study
This study
This study
(continued.)
Table 2. 2. (continued.)
Name
Purpose
Sequence (5’→3’)
Source
TCCCTGAAAATAAAATTATTGGTGTCcggatccccgggttaattaa
CGTTATTTAATGGATATATATATATTATATATTTATATACGTTAA
TGTCTCATGTGACTGAGCTGCAGgaattcgagctcgtttaaac
GCCGTTATCACTGATGGCTTGAAACCAATCCATATCGTTACTAA
GATGGATTTACTGAGCTACTTAGCAcggatccccgggttaattaa
GAGAACGGTGCAATTGAATAGGAAAGGAATGACGGATTTTGCT
TCTATGTTTGCTTTTATTTGAAGCgaattcgagctcgtttaaac
HY138 R
Arg5,6 C-term tagging
HY144 F
Cys4 C-term KI
HY145 R
Cys4 C-term KI
HY146 F
Cys4 midstream conf.
GACTCTTCAAAGCTGGAGGCTTCGACG
CWC15_DNA probe
generation
CWC15_DNA probe
generation
CAGACCACAGTTAGAAGCAAGAAGCGG
GTCATATCGTTAATGTATCCGGACGCTG
This study
HY205 F
LCD1_DNA probe generation
CAGATCTGAAATCCTTGATAAGCGGTAGTTGGTGG
This study
HY206 R
LCD1_DNA probe generation
CCAAGTTCGGGGAGTCTTGTCCCACGTACC
This study
HY207 F
RAD9_DNA probe generation
GGGGATGCTGTTACCTTTGATGGAAATGAGTACG
This study
HY208 R
RAD9_DNA probe generation
CCAGTGTAGTGTAGGCCACCCCAACGCC
This study
CTCCTGTGGCTAACATACCCAATAACGCGC
This study
GACCCGTGGCTGCGAGCGAGTATATCCGAG
This study
HY203 F
HY204 R
41
HY213 F
HY214 R
GTO3_DNA probe
generation
GTO3_DNA probe
generation
This study
This study
This study
This study
This study
HY219 F
ACT1 DNA probe generation
CCGGTGATGGTGTTACTCACGTCGTTCC
This study
HY220 F
ACT1 DNA probe generation
GACCTTCATGGAAGATGGAGCCAAAGCGGTG
This study
HY252 F
MTH1 DNA probe generation
CCCCCTCTACTGTGCACACGCAACTAAC
This study
HY253 R
MTH1 DNA probe generation
GGTATTATGCTTGGTGGGGGCATGTCCGGTC
This study
HY267 F
Trm5 midstream
GGCGCCACTGATACCATCCAAATGCCATGGGTGC
This study
HY275 R
Trm5 C-term KI
CATCTCGTTTCTTTTTCTAATGGTCGCCTTTTTGCCTTTTTCCTCC
Ohira and Suzuki,
41
(continued.)
Table 2. 2. continued.
Name
Purpose
Sequence (5’→3’)
Source
CACGGCgaattcgagctcgtttaaacTTTTCGACACTGGATGGCGGCGTT
AGTA
gcacccaccaaaccgatgtattgcgcgagtttccaacttccagctaacgtactaccaccgcttgagag
acttactcttgatggtcgacggatccccggg
2011
Ohira and Suzuki,
2011
Ohira and Suzuki,
2011
42
HY276 F
Trm5 C-term KI (NES-GFP)
HY277 F
Trm5 C-term KI (GFP)
ccgatgtattgcgcgagtttccaacttccagctaacgtaggtcgacggatccccggg
HY308 F
Sps2 DNA probe generation
CTGATACTGCATTAACCTCCATCG
This study
HY309 R
Sps2 DNA probe generation
CGCCTCTTATGATCGAACGACCGG
This study
HY312 F
LEU4 C-term KI
HY313 R
LEU4 C-term KI
HY314 F
LEU4 midstream
GCGTGCTCAAGGTGAAACTCAATGGAGAATCCC
This study
HY325 R
LEU4 DNA probe generation
TCGGAGACACCTACACCCCATTTGTAGGCC
This study
CTGGTGATGTGTCCATTCCATCTTTGGCCGAGGTCGAAGGTAAG
AATGCTGCGGCATCTGGCTCTGCAcggatccccgggttaattaa
CCGTGCTTCTAGTAATTATATGGTTAAAAAAAAAGGAAAGGAA
GTAAATAAATAAGTATAGAAATAAATAGAAGCGgaattcgagctcgtttaa
ac
42
This study
This study
CHAPTER 3
Genome-wide investigations of cellular functions
for tRNA nuclear-cytoplasmic trafficking in
regulation of translation
3.1 Introduction
In eukaryotic cells, tRNAs are transcribed in the nucleus but function in protein synthesis
in the cytoplasm. For decades, tRNAs were thought to travel only unidirectionally,
nucleus to cytoplasm. However, it is now known that tRNAs actively shuttle between the
nucleus and the cytoplasm (Shaheen and Hopper, 2005; Takano et al., 2005; Whitney et
al., 2007), and this bi-directional movement is conserved in vertebrate cells (Barhoom et
al., 2011; Shaheen et al., 2007; Zaitseva et al., 2006). Cytoplasmic mature tRNAs rapidly
accumulate in the nucleus when cells are nutrient-deprived as observed by fluorescence
in situ hybridization. Upon re-feeding, the nuclear previously-cytoplasmic tRNAs return
to the cytoplasm to participate in translation (Hurto et al., 2007; Shaheen and Hopper,
2005; Whitney et al., 2007).
43
In the current working model, at least three nuclear transporters (all belong to βimportin family) function in tRNA nucleus-cytoplasm subcellular dynamics: Los1, Mtr10,
and Msn5 (Figure 3. 1). Los1 functions in the initial export of intron-containing and
intron-less tRNAs, and also in the re-export of previously cytoplasmic mature tRNAs
back to the cytoplasm. Mtr10, directly or indirectly, is responsible for the retrograde
movement of cytoplasmic tRNAs to the nucleus. Little is known about the biological
roles of Mtr10 and one goal of this study is also to investigate the transcriptional
expression profiles of mtr10Δ cells, which will be addressed in Chapter 4. Msn5 can
export intron-less tRNAs and appears to function solely in tRNA re-export (Hopper et al.,
2010; Murthi et al., 2010).
There are still many questions regarding the tRNA trafficking process. For
example, not all the exporters/importers have been identified (for reviews, see Hopper,
2006; Hopper et al., 2010; Hopper and Shaheen, 2008). Although it appears that tRNA
re-export is regulated by nutrient status of the cell and the regulation is coordinated with
P-body formation (Hurto and Hopper, 2011), none of the details of the molecular
regulation have been uncovered. Whitney et al. demonstrated that the PKA pathway is
required for the tRNA nuclear accumulation and this is independent of Gcn2 (Whitney et
al., 2007). Perhaps the most important question “Why does cytoplasmic tRNA travel
back to the nucleus” remains completely unresolved. Previous studies showed that tRNA
accumulate in the nucleus when cells are nutrient stressed or when tRNA is damaged,
implicating the potential roles of tRNA retrograde pathway in response to stress or in
tRNA quality control (Feng and Hopper, 2002; Sarkar et al., 1999).
44
Based on the essential role that tRNAs serve as adaptors to deliver amino acids
for polypeptides synthesis during translation in the cytoplasm, in this chapter we focus on
the impacts of tRNA nuclear-cytoplasmic dynamics on translation regulation in the yeast,
Saccharomyces cerevisiae. In this work, we demonstrate that tRNA nuclear-cytoplasmic
movement plays a role in regulating translation of mRNAs encoding proteins involved in
several amino acid biosynthetic pathways, including sulfur assimilation (methionine),
arginine, and leucine. Thus, tRNA nuclear-cytoplasm trafficking is involved in cellular
metabolism/physiology.
45
Figure 3. 1. Current model of tRNA subcellular movement in yeast. The proposed
model of tRNA nuclear-cytoplasmic trafficking includes three steps. 1. Primary export.
The primary tRNA transcripts are end-processed and exported to the cytoplasm by the
tRNA exportin Los1. 2. Constitutive retrograde import. After maturation processes
(including intron-splicing on the mitochondria, base modifications, and aminoacylation),
Mtr10 is responsible for the import of the cytoplasmic mature tRNAs to the nucleus. 3.
Re-export. The previously-cytoplasmic tRNAs are re-exported from the nucleus to the
cytoplasm by the functions of Los1 and Msn5.
46
Figure 3. 2. Flowchart of experimental designs. For polysome profiles, more than three
repeats were performed. For microarray samples, two biological repeats were performed
and RNAs were extracted from indicated pools and hybridized to two Affymetrix chips.
47
3.2 Results
This section includes results of polysome profiles analyses, microarray data of
translational activity, followed by verification and sequence analyses. Figure 3. 2
illustrates the steps of experiments for polysome profile analysis and microarray sample
collection.
3.2.1 Polysome profiles analysis
Previous studies showed that tRNAs accumulate in the nucleus when cells are nutrient
starved (Hurto et al., 2007; Shaheen and Hopper, 2005; Whitney et al., 2007). Amino
acid or glucose deprivation also causes translation inhibition (Ashe et al., 2000; Holmes
et al., 2004). Therefore, we proposed that cells regulate the translation machinery by
controlling tRNA availability via its subcellular distribution. If it is true, we expected that
the global translation should be inhibited in cells with defects in tRNA export pathways,
such as in msn5Δ, los1Δ, and los1Δ msn5Δ mutants in which tRNAs constitutively
accumulated in the nucleus. Furthermore, in cells which fail to accumulate tRNAs in the
nucleus the global translation in nutrient starvation, such as mtr10Δ cells, translation
should not be inhibited. To test the hypothesis, we analyzed the polysome profiles of wild
type, mtr10Δ, msn5Δ, los1Δ, and los1Δ msn5Δ cells grown in fed or acute amino acid
deprivation conditions (Figure 3. 3 and Figure 3. 4).
As anticipated, in wild-type cells there was a major shift from polysomes to the
non-translating region when cells were nutrient deprived (Figure 3. 3). Surprisingly, in
general, the polysome profiles from cells with defects in the tRNA trafficking pathways
48
were similar in fed or amino acid starvation condition, but three differences were
demonstrated. First, quantifications of polysome profiles from fed msn5Δ and los1Δ
msn5Δ cells revealed that there were statistically significant increases in the ratio of P/NP
relative to that in wild-type cells (NP, non-polysomal region, represented the region of
40S+80S, Figure 3. 5). Since the polysome region did not exhibit large changes, the
decreases of NP region accounted for the increases in P/NP ratio. Second, the polysome
region of fed mtr10Δ cells was smaller, suggesting a translation defect. Third, in starved
mtr10Δ cells the NP region was smaller and polysomal region was larger, suggesting the
rate of ribosome runoff in mtr10Δ cells is slower. This suggested that mtr10Δ cells were
defective in repressing translation when responding to nutrient deprivation (Figure 3. 5).
Possible explanations are addressed in the Discussion section. In summary, the similar
polysome profiles of tRNA export mutants suggested that the global translation is not
affected when tRNAs are accumulated in the nucleus, and this led us to employ
microarray experiments to identify the specific targets.
3.2.2 Microarray data pre-processing
To investigate whether the tRNA trafficking process regulates translation of particular
mRNAs, we performed microarray analysis on the distribution of polysome-bound (P,
translating) and non-polysome bound (NP, not-translating) mRNAs from wild-type,
msn5Δ, and mtr10Δ cells grown in fed or acute amino acid starvation conditions
(summary of the microarray experiments is cartooned in Figure 3. 6). After microarray
experiments, all of the raw intensity data files (*.cel files) from fractioned (P or NP) and
49
unfractionated (total, T) RNA samples were generated. These files were imported
together into the platform R with Bioconductor (Gentleman et al., 2004; R development
Core Team, 2011). A diagnostic plot, principle component analysis (PCA) plot was
utilized to roughly assess the similarity of microarray data. Figure 3. 7 exhibited that
expression profiles of msn5Δ cells are similar to those from wild-type cells whereas
mtr10Δ profiles displayed larger differences. Prior to the normalization, an optional
procedure of masking S. pombe probes was performed because Affymetrix Yeast 2.0
GeneChips, contain two yeast species genomes, S. cerevisiae and S. pombe. In addition,
this step can decrease background noise.
As mentioned in Introduction, it is required to process the intensity data from
probesets into gene expression values by normalization. We used the function of Robust
Multiarray Average (RMA) (Irizarry et al., 2003) in the affy package. It is an algorithm
that has been commonly used for microarray normalization (Ashe et al., 2000; Shenton et
al., 2006; Smirnova et al., 2005; Vyas et al., 2009). Box plots of microarray data before
and after RMA normalization were shown in Figure 3. 8 and Figure 3. 9. After a step of
filtering low signals, a log2-value matrix with 36 columns (RNA samples) and 5684 rows
(genes) was used for calculation of P/NP ratio and subsequently subject to statistical
analysis to select differential expressed genes.
50
Figure 3. 3. Polysome profiles of wild-type, mtr10Δ, and msn5Δ cells collected from fed
or 30-min amino acid starved conditions. Twenty A260 units of cell lysate were loaded
and separated on 10% to 50% sucrose gradient. Polysome traces were recorded by UV254
detector during fractionation and are shown as representatives from more than five
experiments. Cartoons represent the phenotypes of tRNA distribution.
51
Figure 3. 4. Polysome profiles of wild-type, los1Δ, and los1Δ msn5Δ cells collected
from fed or 30-min amino acid starved condition. Twenty A260 units of cell lysate were
loaded and separated on 10% to 50% sucrose gradient. Polysome traces were recorded by
UV254 detector during fractionation and are shown as representatives from more than five
experiments. Cartoons represent the phenotypes of tRNA distribution.
52
D.
0.6
WT
B.
mtr10∆ msn5∆
n=8
0
n=8
0.2
n=17
0.4
los1∆
los1∆ msn5∆
WT
E.
Fed
1.2
*
*
NP/T
NP/T
1
0.8
0.6
0.4
0.2
0
WT
C.
mtr10∆ msn5∆
los1∆
1.4
1.2
1
0.8
0.6
0.4
0.2
0
los1∆ msn5∆
los1∆
los1∆ msn5∆
los1∆
los1∆ msn5∆
*
WT
mtr10∆ msn5∆
F.
Fed
los1∆
Starved
los1∆ msn5∆
2
Starved
2.5
*
*
*
2
P/NP
1.5
P/NP mtr10∆ msn5∆
n=8
0.8
1.4
1.2
1
0.8
0.6
0.4
0.2
0
n=8
*
n=5
*
P/T
*
n=5
1
n=11
P/T
1.2
Starved
n=11
Fed
n=18
A.
1
0.5
1.5
1
0.5
0
0
WT
mtr10∆ msn5∆
los1∆
los1∆ msn5∆
WT
53
mtr10∆ msn5∆
Figure 3. 5. Quantification of polysome profiles of tRNA trafficking mutants in fed (AC) or amino acid starved (D-F) conditions. NP represents the region of 40S and 80S in
the polysome profile; P represents the region of disome and polysome in the profile; T
represents the area of whole profile. *: p-value
54
0.01
55
Figure 3. 6. Summary of microarray experiments. One RNA sample was hybridized to one Affymetrix yeast 2.0 GeneChip.
55
Figure 3. 7. Three dimensional view of result from principle component analysis (PCA).
Global assessment of microarray raw data set from fractionated RNA samples was
evaluated by using principle component analysis (Courtesy of microarray center of OSU).
WT_fed_mono represents the samples that were collected from non-polysomal bound
fractions of wild-type cells grown in fed condition. One block represents one microarray
experiment. Same color represents biological repeats of same condition.
56
3.2.3 Identification of significant differentially-expressed genes (DEGs)
In order to understand the impact on translational status of specific mRNAs when cells
are defective in tRNA nuclear import or re-export pathway, we analyzed the translation
activity index of each mRNA, which was obtained from the ratio of P/NP (Smirnova et
al., 2005; Vyas et al., 2009). There are several indexes which have served as indicators of
translation status. Generally, higher translational index correlates with higher protein
level (Greenbaum et al., 2002; Tuller et al., 2007). The tRNA retrograde process was
proposed to function in regulation of translation of a subset of transcripts (Shaheen and
Hopper, 2005; Whitney et al., 2007); therefore, we expected that aberrant tRNA nuclearcytoplasmic traffic could result in a re-distribution between P- and NP- bound population
for such target mRNAs. Moreover, considering that Msn5 and Mtr10 also transport other
protein cargos, we proposed that the transcripts that are affected commonly in mtr10Δ
cells and msn5Δ cells are more likely the primary targets of tRNA trafficking. Thus, we
paid more attention on the transcripts with changes in translational activity index affected
in both msn5Δ and mtr10Δ cells.
To identify such tRNA trafficking targets, a three-step approach was executed.
First, the ratio of P/NP of each mRNA from the pre-processed matrix was calculated.
Second, the translationally differentially expressed genes (DEGs) were selected
separately from mtr10Δ cells or from msn5Δ cells versus wild-type cells in fed or starved
condition by using the statistic method of linear model for microarray data (Limma)
(Smyth, 2004). In this work, translationally DEGs were selected when adjusted p-values
were smaller than 0.05 and
1.5 fold change (log2 FC = 0.6) from each mutant relative
57
to wild-type under each condition. The numbers of statistically DEGs are summarized in
Table 3. 1. Detail lists are in Appendix B to Appendix E. Expression profiles from these
genes were selected and imported to GenePattern website for generation of hierarchical
heat map (Figure 3. 11 from fed mtr10Δ and Figure 3. 12 from fed msn5Δ). We also
performed the same statistical analyses of “total” RNA samples; with this information we
can check transcriptional effects by selecting potential targets with changes in P/NP ratio
and no or little changes in their “total” expression levels. For details of transcriptional
analyses, see Chapter 4.
The translation profiling is unchanged in msn5-depleted cells under fed or amino
acid starvation condition
Because in msn5Δ cells tRNAs constitutively accumulate in the nucleus, we expected a
large change in its translation profile. However, the numbers of translationally
differentially expressed genes in msn5Δ cells were few or none in fed or starved
condition (see summary table of number of translationally differentially expressed genes
in Table 3. 1). This result was consistent with the data from polysome profiles (Figure 3.
5), which showed that there was no large difference between msn5Δ and wild-type cells.
The unchanged translational profiles of msn5Δ cells in fed or starved condition might be
due to two, or more, possibilities. First, tRNA nuclear accumulation is uncoupled with
translation. Second and more likely, the Los1 and unknown tRNA re-export pathways are
sufficient to compensate or maintain translation. Further interpretations are in the
Discussion.
58
Normal responses to amino acid deprivation at translation level in tRNA import
mutant
Considering that in mtr10-null cells tRNAs fail to accumulate in the nucleus upon
nutrient stress (Hurto et al., 2007; Shaheen and Hopper, 2005) and that a defect of
translation repression was demonstrated (Figure 3. 3), we anticipated a subset of
transcripts were translationally changed in starved mtr10Δ cells. However, very few
transcripts that were translationally changed in starved mtr10Δ cells (Table 3. 1), which
suggested that tRNA nuclear retrograde transport process is not regulating translation in
response to nutrient availability. Furthermore, this correlates to the observation that
tRNA nuclear import is a constitutive process (Murthi et al., 2010).
A group of transcripts is translationally down-regulated in both mtr10Δ cells and
msn5Δ cells
On the basis of the opposite phenotypes in tRNA subcellular distribution between msn5Δ
and mtr10Δ cells, we attempted to identify transcripts which display opposite translation
expression patterns (i.e., up-regulated in mtr10Δ cells and down-regulated in msn5Δ cells,
or vise versa, when compared to wild-type cells); however, such transcripts were not
identified. More surprisingly, we identified a group of transcripts that was downregulated in translation (with decreased P/NP ratio) in both msn5Δ and mtr10Δ cells
under fed condition. Furthermore, by employing the web-based tool which provides a
survey of the functional distribution of genes of interests, MIPS functional catalogue
(Ruepp et al., 2004), we found that the group of the affected transcripts was functionally
59
overrepresented in methionine/sulfur and arginine amino acid biosynthesis (Figure 3. 13).
In addition, the translational indexes of transcripts encoding other amino acid
biosynthesis pathways, such as LEU4, SER33, and LYS5, were also decreased in mtr10Δ
cells (Figure 3. 11). Our data indicated that tRNA subcellular dynamics has a unique role
in regulating translation of a subset of mRNAs encoding enzymes involved in several
amino acid biogenesis pathways, including methionine, arginine, leucine, serine, and
lysine (methionine, arginine, and leucine biosynthetic pathways are shown in Figure 3.
14).
3.2.4 Transcriptional control and RNA stability of target mRNAs are
not affected
According to the microarray expression profiles, mRNAs encoding proteins in the
methionine and arginine biosynthetic pathways were translationally down-regulated in
fed msn5Δ and mtr10Δ cells. The total expression levels of these targets in tRNA
trafficking mutants were similar to that in wild-type cells from microarray data (for
example, MET3 in (Figure 3. 15). To confirm the microarray results, we employed
Northern blot analysis. The total RNAs were extracted from wild-type and tRNA
trafficking mutant cells (msn5Δ, mtr10Δ, los1Δ, los1Δ msn5Δ) grown in SC media (fed
condition). Since Los1 functions in tRNA primary export and re-export pathways, we
anticipated that blocking nuclear export pathways by deleting both Los1 and Msn5 would
further enhance the phenotypes of the potential targets, which would be shown in the next
section. The Northern blots were hybridized to the DNA probes for target mRNAs, such
60
as ARG5,6, MET3, and LEU4 (Figure 3. 16). The result showed that the steady state
levels of target mRNAs were not largely changed in all tested strains. In addition, another
line of evidence supported that the transcriptional control of these target transcripts were
not affected. When cells were amino acid deprived, translation of the master regulator
Gcn4 is induced and it subsequently activates the transcription of amino acid biogenesisrelated genes. If the transcriptional control is defective, cells cannot grow in amino acid
deprived conditions. Given this consideration, we performed a growth assay of tRNA
nuclear-cytoplasmic shuttling mutants on SC solid media without methionine or arginine.
Interestingly, those mutants were able to grow on SC-methionine or SC-arginine plates
(Figure 3. 17), suggesting that the general amino acid transcriptional control is not
affected.
3.2.5 Verification of microarray data by western blot analyses
The Northern blot analysis and growth assays indicated that the steady state levels of
mRNAs and transcriptional control are not affected in the mutants that are defective in
tRNA subcellular trafficking. To confirm the results of the microarray analysis which
indicated that these transcripts are changed at the translation level, we employed western
analysis to determine the endogenous levels of protein targets. We introduced the 3HA or
GFP epitope tags at the C-terminal of the endogenous locus to generate in-frame fusion
of the Met, Arg, or Leu protein targets in wild-type cells and each tRNA trafficking
mutant cells, including mtr10Δ, msn5Δ, los1Δ, and los1Δ msn5Δ. All of the fusion
proteins were full length and functional by assessing cell growth on methionine (a
61
representative result is shown in Figure 3. 18) or arginine (not shown) depletion plates.
We then examined the steady state levels of endogenous protein targets by immunoblots
of whole-cell extracts obtained from normal SC media cultures.
Correlated to their decreased translation activity indexes from microarray data,
the expression levels of all tested proteins (Met2-3HA, Met3-3HA, Met14-3HA, Met223HA, Arg3-3HA, Arg5,6-GFP, and Leu4-3HA) were remarkably reduced or even not
apparent in mtr10Δ cells (Figure 3. 19) while these target proteins had basal level
expression in wild-type cells. In msn5Δ or los1Δ cells these protein levels were not
largely changed. As mentioned earlier, it has been shown that Los1 and Msn5 function in
parallel in the tRNA nuclear re-export process. Blocking tRNA re-export pathway only
by deleting Msn5 would not be sufficient to cause significant result; this led to the
prediction that further blocking tRNA re-export by deleting both Los1 and Msn5 would
lead to significant decrease in target protein levels. In agreement with this expectation,
the levels of Met, Arg, and Leu biosynthetic pathway proteins in los1Δ msn5Δ cells were
synergistically decreased when compared to that in single deletion strains (Figure 3. 19).
Importantly, this result also demonstrated that the growth defect of mtr10Δ cells was not
accounted by the reduced level of target proteins because los1Δ msn5Δ cells grow as well
as wild-type cells. Furthermore, most of tested proteins exhibited higher levels in los1Δ
cells (Figure 3. 19). We reasoned that it was likely caused by up-regulated translation of
Gcn4 mRNA, because it has been shown that translation of Gcn4 is up-regulated when
unspliced tRNA accumulates in the nucleus in los1Δ cells (Qiu et al., 2000).
62
To further validate microarray data, Cys4-3HA fusion proteins were also tested as
unchanged candidate in all tested cells (Figure 3. 19). Moreover, when we introduced the
functional Los1, Msn5, or Mtr10 proteins back into individual mutants, the levels of
Met3-3HA protein expression in tRNA trafficking mutants were mostly or partially
recovered to basal level as in wild-type cells (Figure 3. 20).
Collectively, the results from western blot analysis confirmed the microarray data
that target mRNAs with lower translation activity indexed were poorly-translated.
63
X01_WT.fed.poly.CEL
X02_WT.fed.poly.CEL
X03_WT.fed.mono.CEL
X04_WT.fed.mono.CEL
X05_WT.starved.poly.CEL
X06_WT.starved.poly.CEL
X07_WT.starved.mono.CEL
X08_WT.starved.mono.CEL
X09_msn5.fed.poly.CEL
X10_msn5.fed.poly.CEL
X11_msn5.fed.mono.CEL
X12_msn5.fed.mono.CEL
X13_msn5.starved.poly.CEL
X14_msn5.starved.poly.CEL
X15_msn5.starved.mono.CEL
X16_msn5.starved.mono.CEL
X17_mtr10.fed.poly.CEL
X18_mtr10.fed.poly.CEL
X19_mtr10.fed.mono.CEL
X20_mtr10.fed.mono.CEL
X21_mtr10.starved.poly.CEL
X22_mtr10.starved.poly.CEL
X23_mtr10.starved.mono.CEL
X24_mtr10.starved.mono.CEL
X25_Wt.fed_total_c.CEL
X26_Wt.fed.total.CEL
X27_Wt.Starved_total_c.CEL
X28_Wt.starved.total.CEL
X29_msn5.fed.total.CEL
X30_msn5.fed.total.CEL
X31_msn5.starved.total.CEL
X32_msn5.starved.total.CEL
X33_mtr10.fed.total.CEL
X34_mtr10.fed.total.CEL
X35_mtr10.starved.total.CEL
X36_mtr10.starved.total.CEL
6
8
10
log2 intensity
12
14
Raw data
Figure 3. 8. Box plot of raw microarray data.
64
X01_WT.fed.poly.CEL
X02_WT.fed.poly.CEL
X03_WT.fed.mono.CEL
X04_WT.fed.mono.CEL
X05_WT.starved.poly.CEL
X06_WT.starved.poly.CEL
X07_WT.starved.mono.CEL
X08_WT.starved.mono.CEL
X09_msn5.fed.poly.CEL
X10_msn5.fed.poly.CEL
X11_msn5.fed.mono.CEL
X12_msn5.fed.mono.CEL
X13_msn5.starved.poly.CEL
X14_msn5.starved.poly.CEL
X15_msn5.starved.mono.CEL
X16_msn5.starved.mono.CEL
X17_mtr10.fed.poly.CEL
X18_mtr10.fed.poly.CEL
X19_mtr10.fed.mono.CEL
X20_mtr10.fed.mono.CEL
X21_mtr10.starved.poly.CEL
X22_mtr10.starved.poly.CEL
X23_mtr10.starved.mono.CEL
X24_mtr10.starved.mono.CEL
X25_Wt.fed_total_c.CEL
X26_Wt.fed.total.CEL
X27_Wt.Starved_total_c.CEL
X28_Wt.starved.total.CEL
X29_msn5.fed.total.CEL
X30_msn5.fed.total.CEL
X31_msn5.starved.total.CEL
X32_msn5.starved.total.CEL
X33_mtr10.fed.total.CEL
X34_mtr10.fed.total.CEL
X35_mtr10.starved.total.CEL
X36_mtr10.starved.total.CEL
log2 intensity
After Remove probes and RMA normalized
14
12
10
8
6
4
Figure 3. 9. Box plot of RMA normalized microarray data.
65
4
3
0
1
2
-log10 p value
5
6
Volcano plot of limma -- P/NP_fed_mtr10 vs wt
-3
-2
-1
0
1
2
3
4
diff(logFC)
3
2
0
1
-log10 p value
4
5
Volcano plot of limma -- P/NP_starved_mtr10 vs wt
-2
-1
0
1
2
3
4
diff(logFC)
Figure 3. 10. Volcano plot showing differential expressed genes selected by P/NP index
compared from mtr10Δ to wild-type cells. Upper, fed condition; bottom, starved
condition.
66
mtr10∆ vs. wild-type
Fed
P/NP
a
T
Starved
a
Fed
b
Starved
b
Fed
P/T
c
Starved c
Up
93
2
335
605
0
102
Down
131
5
198
560
1
143
msn5∆ vs. wild-type
Fed
P/NP
d
T
Starved
d
Fed
e
Starved
e
Fed
P/T
f
Starved f
Up
0
0
177
193
0
0
Down
12
0
119
258
0
0
Table 3. 1. Summary tables of numbers of differentially expressed genes in mtr10Δ or
msn5Δ cells in fed or starved conditions. top, mtr10Δ cells vs. wild-type cells; bottom,
msn5Δ cells vs. wild-type cells. P/NP, translation activity index, obtained from log2 Plog2 NP. T, total RNA, obtained from unfrationated RNA sample. P/T, index for analysis
of ribosome occupancy, obtained from log2 P- log2 T. a: cutoff condition: adjusted pvalue < 0.05 with log2 FC
0.6 (Up-regulated) or
condition: adjusted p-value < 0.001 with log2 FC
0.01 with log2 FC
0.6 or
− 0.6; c: adjusted p-value <
0.6 or < − 0.6; d: adjusted p-value < 0.05 with log2 FC
0.6; e: adjusted p-value < 0.05 with log2 FC
with log2 FC
− 0.6 (Down-regulated); b: cutoff
0.6 or
0.6 or
− 0.6.
67
0.6 or
−
− 0.6; f: adjusted p-value < 0.05
Figure 3. 11. Heat map of hierarchical clustering results of gene expression profiles
from translational DEGs in mtr10Δ cells versus wild-type cells in fed condition.
68
Figure 3. 12. Heat map of hierarchical clustering results of translational DEGs from
msn5Δ cells compared to wild-type cells in fed condition.
69
Figure 3. 13. Venn diagram of DEGs which were decreased in translation activity index
in both mtr10Δ and msn5Δ cells.
70
71
71
Figure 3. 14.
Amino acid biosynthesis pathways affected in tRNA trafficking mutants. A. Sulfur assimilation pathway. B. Arginine
72
biosynthesis pathway. C. Leucine biosynthesis pathway. Transcripts with decreased translation activity index were marked with green
shadow. Targets confirmed by Western blot analyses are indicated with orange box.
72
73
73
Figure 3. 15. Expression profile of MET3 transcript among all microarray samples. The expression values were log2 and centered
to the median of all values from all samples. WT_fed_poly represents RNA sample was collected from polysome-bound pool
from wild-type cells in fed condition. WT_fed_mono represents RNA samples was collected from non-polysome bound pool
74
from wild-type cells in fed condition. WT_starved_poly represents RNA sample was collected from polysome-bound pool from
wild-type cells in amino acid starvation condition.
74
Figure 3. 16. Northern blot analysis of total RNA collected from wild-type and tRNA
trafficking mutants in fed condition. The blot was hybridized to α-32P-dCTP-labeled
ARG5,6, MET3, or LEU4 DNA probes. ACT1 served as an internal loading control. 25S
and 18S rRNAs were indicated in the bottom ethidium bromide-staining formaldehyde
agarose gel. Each ratio was normalized to the expression values of ACT1 and compared
to WT.
75
Figure 3. 17. Growth assay of tRNA trafficking mutants on SC, SC-arginine and SCmethionine plates. All tested cells were grown in rich liquid media overnight and adjusted
to similar density before spotted on indicated solid plates and incubated at 30°C for two
days. arg3Δ and met22Δ cells served as controls for SC-arginine and SC-methionine,
respectively.
76
3.2.6 tRNA subcellular trafficking affects translation regulation of
amino acid biosyntheses transcripts
We attempted to study the roles of Mtr10 and Msn5, by analyzing transcripts
translationally affected by both of Mtr10 and Msn5. However, it still could be argued that
the reduced levels of proteins involved in the Met, Arg, and Leu biosynthetic pathways
resulted from defects in protein transport, rather than tRNA subcellular dynamics. We
sought to alter tRNA nuclear/cytoplasmic dynamics in an independent way. Dhh1 and
Pat1 are not β-importin members and it has been shown that in dhh1Δ pat1Δ cells
translation is repressed (Coller and Parker, 2005) and tRNAs fail to accumulate in the
nucleus upon amino acid starvation (Hurto and Hopper, 2011). Both of these phenotypes
exist for mtr10Δ cells and thus the tRNA subcellular trafficking is also aberrant in dhh1Δ
pat1Δ cells. Therefore, we disrupted tRNA nuclear-cytoplasmic trafficking and assessed
the levels of target proteins in dhh1Δ pat1Δ cells.
As predicted, the levels of endogenous fusion proteins in Met, Arg, and Leu
biosynthetic pathways were largely decreased in dhh1Δ pat1Δ cells (Figure 3. 21).
Moreover, it appeared that Dhh1 played a more important role in regulating translation of
the Met, Arg, and Leu biosynthetic pathway transcripts because the reduction was also
observed in dhh1Δ cells, but not in pat1Δ cells. It is also worthy to notice that BY4741
and its isogenic mtr10Δ cells were utilized as isogenic controls for dhh1Δ pat1Δ cells,
and their protein expression patterns were similar as which shown in BY4742 derivative
strains. This result further provides the evidence that the reduced levels of enzymes in
77
Met, Arg, and Leu biosynthetic pathways can be reproduced in different mating
type/background.
78
79
Figure 3. 18. Growth assays of cells with Met22-3HA fusion protein. WT, wild-type cells, as the parent strain for Met22-3HA
knock-in, #6 and #12 represent candidate numbers. All of the parental strains and their derivatives were grown in liquid YEPD
media overnight at 30°C. Cells were adjusted to similar density and followed by 10X serial dilution before spotting on the
indicated solid media and incubated at 30°C or 37°C for two days.
79
80
80
Figure 3. 19. Western blot analysis of endogenously 3HA- or GFP- tagged target proteins. A. targets with decreased translation
81
activity index were poorly-translated in tRNA trafficking mutants. B. target with no change in translation index was also not
changed in protein expression. Pgk1 and Nsp1 served as internal loading controls. Each ratio was obtained from normalizing to
internal control and then comparing to WT.
81
Figure 3. 20. Western blot analysis of protein levels in tRNA trafficking mutants
harboring recovery plasmids. Cells with Met3-3HA fusion proteins were transformed
with pRS416 vector or MORF plasmids containing individual functional karyopherin and
its promoter (courtesy from Ivy Huang). Cells harboring plasmids were then cultured in
SC-uracil liquid media to early log phase. Met3-3HA proteins were determined by
immunoblotting with α-HA antibody. Pgk1 served as internal loading control.
82
Figure 3. 21. Immunoblot analyses of Met3-, Arg3-, and Leu4-3HA fusion proteins in
wild-type cells and dhh1Δ pat1Δ cells. Pgk1 and Kar2 served as internal loading controls.
Each ratio was obtained from normalizing to internal control and then comparing to WT.
83
Figure 3. 22. Heat map of hierarchical clustering of codon occurrence frequency for
DEGs with decreased translation activity index in mtr10Δ cells.
84
Taken together, our investigation of translational expression profiles by
microarray analysis of the tRNA subcellular trafficking mutants showed that the
translation of proteins responsible for methionine, arginine, and leucine biosynthesis
pathways were defective, suggesting that tRNA trafficking process plays a role in
regulating cell metabolism by influencing the translation of a subset of mRNAs. This is
the first and novel connection between tRNA subcellular dynamics and cell physiological
process.
3.2.7 Cis-regulatory elements analysis of tRNA trafficking targets
Protein translation is generally regulated at the steps of translation initiation or the rate of
elongation (Day and Tuite, 1998; McCarthy, 1998). Translation initiation is the ratelimiting step and can be regulated by the 5’ sequences or length of upstream region of the
ORF, or by the secondary structure of the 5’ leader (Hinnebusch, 2005; Lawless et al.,
2009; Tuller et al., 2009). We were unable to identify a common cis-acting motif from
upstream and downstream sequences, except for Gcn4-responsive, methionine-, arginineresponse elements, among these primary target genes (data not shown, for reviews see
Hinnebusch, 1988; Thomas and Surdin-Kerjan, 1997).
Translation elongation can be affected by the number of rare codons (Letzring et
al., 2010). We proposed that the target transcripts (mRNAs encode enzymes in Met, Arg,
and Leu biosynthetic pathways) might have rarely used codons or amino acids, which can
lead to inefficient translation and cause the reduced level of protein products. We
analyzed the codon usage as well as amino acid usage for each target by comparing the
85
appearance frequencies of each codon or amino acid in targets open reading frames
versus genome average occurrence. However, we were unable to document rare codon
bias (Figure 3. 22) or particular amino acid usage patterns (not shown). The possible
mechanisms for translation regulation will be further described in Discussion.
3.3 Discussion
In this work we demonstrate that constitutive tRNA nuclear accumulation in cells with
defective tRNA re-export (los1Δ, msn5Δ, and los1Δ msn5Δ) does not cause large global
translation repression. There are several possible explanations. First, it is possible that the
remaining cytoplasmic pool of tRNAs is sufficient to maintain the translation machinery.
Second, and a non-exclusive, possibility is that the additional tRNA export pathway(s) is
sufficient to transport tRNAs back to the cytoplasm, and that these pathways contribute to
the generally normal translation. Finally, although we cannot rule out the impacts from
additional tRNA export pathway, perhaps global translation is not coupled with tRNA
subcellular distribution and, if this is the case, the mechanisms of translation inhibition
and tRNA nuclear accumulation upon nutrient stress must be distinct. Thus, the
translation repression upon nutrient stress is likely not resulted from nuclear
accumulation of tRNA. Although there is no dramatic change, we still found a significant
reduction in non-polysome region in the polysome profiles from msn5Δ and los1Δ msn5Δ
cells. This result might be attributed to the combination of small translation defects of
affected mRNAs (e. g. 10 % decrease of each mRNA), which are not selected in the
microarray data analysis.
86
In contrast, polysomal region is decreased in mtr10Δ cells which are defective in
tRNA nuclear import, suggesting a translation defect. This observation might be
contributed from several factors. The mtr10Δ strain exhibits growth defect and this is
likely due to impaired import of the essential mRNA export factor, Npl3, to the nucleus
(Pemberton et al., 1997; Senger et al., 1998). Furthermore, Npl3 has been shown to
associate with polysomes and act as a negative translation regulator, and Mtr10 is
involved in the disassociation of Npl3 from polysome-bound mRNAs (Windgassen et al.,
2004). Therefore, the translation defect might result from the cytoplasmic pool of Npl3
that are associated with polysomes. Taken together, the translation defect in mtr10Δ
strain could be an ultimate outcome of several factors: growth defect, impaired nuclear
import of Npl3, impaired tRNA nuclear import, and also likely the aberrant transport of
unidentified cargos.
Upon amino acid deprivation, mtr10Δ cells, which fail to accumulate tRNAs in
the nucleus upon nutrient stress, are also defective in translation repression. This result is
consistent with the model proposed previously (Hurto and Hopper, 2011). In this model,
tRNA nuclear accumulation is a downstream event of the global translation repression in
response to nutrient stress. If this is the case, the mutant with failure to repress translation
upon nutrient stress should also not able to accumulate tRNA in the nucleus. In
agreement with this prediction, in dhh1Δ pat1Δ cells, mutations which have been shown
to block general translation repression in amino acid or glucose withdrawal condition
(Coller and Parker, 2005; Holmes et al., 2004), tRNAs also fail to accumulate in the
nucleus in amino acid or glucose starvation condition (Hurto and Hopper, 2011).
87
A defect of translation repression in response to amino acid starvation is observed
in mtr10Δ cells, but microarray analysis of translational profiles from starved mtr10Δ
cells does not correlate such change. We reason that the changes in translation of affected
mRNAs are slight, so they are not selected by the cutoff conditions with large foldchange while compared to wild-type cells in the microarray analysis, but each slight
change can be additive and ultimately affects the polysome profile.
Surprisingly, we discover that the basal level of translation of a group of target
mRNAs is reduced in cells defective in tRNA trafficking by mutations in tRNA
retrograde import or re-export or independently by deleting Dhh1 and Pat1 proteins. The
affected mRNAs encode enzymes involved in amino acid biosynthesis pathways,
including sulfur assimilation (methionine), arginine, and leucine. In addition, Ser33 and
Lys5 are also potential targets; however, the endogenous abundance of Ser33 and Lys5
proteins are too low to be assessed by western blot. According to previous results with
reduced levels of enzymes in Met, Arg, and Leu biosynthetic pathways, we anticipate the
protein levels of Ser33 and Lys5 should also decrease in tRNA trafficking mutants. If so,
there are five amino acid biosynthesis pathways affected. Taken together, these results
support that tRNA subcellular dynamics serves as a novel mechanism to regulate the
translation of mRNAs involved in amino acid biosynthesis pathways. And this role also
further correlates with the constitutive tRNA import process (Murthi et al., 2010).
The mechanism(s) for how the affected enzymes are reduced is not clear. It
appears that the reduction of these proteins is defective at translation regulation of the
target mRNAs based on three observations from this work. First, the transcriptional
88
control and the steady state levels of the mRNAs involved in are generally not changed.
Second, the levels of Met, Arg, and Leu biosynthetic enzymes are also decreased in
dhh1Δ pat1Δ cells, in which cells mRNAs are stabilized. Third, the expression profiles of
most target mRNAs showed that their decreased translation activity indexes (P/NP) are
due to increasing in the NP values, suggesting a translation initiation defect of such
mRNAs (Figure 3. 15). Although we do not exclude the possibility for enhanced protein
turnover, it would be important to investigate whether and how the translation of the
target mRNAs is affected.
There is still much to learn about how signaling pathway(s) regulate tRNA
nuclear-cytoplasmic dynamics, which may also provide a possible mechanism for
regulating translation of target mRNAs. So far no evidence indicates that Dhh1 and Pat1
are tRNA transporters, and it was proposed that both Dhh1 and Pat1 are involved in a
signal transduction pathway for tRNA subcellular trafficking (Hurto and Hopper, 2011).
Considering the tRNA import process is constitutive and its impairment causes decreased
basal levels of translation of mRNAs that encode Met, Arg, and Leu biosynthetic
pathways, the signaling pathway must be active in normal condition. Moreover, given the
nuclear accumulation of tRNAs in nutrient starvation stress, the signaling pathway must
be responsive to nutrient availability and transmit the signal through Dhh1, Pat1, and
Mtr10 into the nucleus. In agreement with this hypothesis, the amino acid responsive
Gcn2-dependent signaling pathway is not involved in the tRNA subcellular movement
because Gcn2-depleted cells do not prevent the nuclear accumulation of tRNAs (Whitney
et al., 2007). The PKA pathway has been shown to be involved in the tRNA trafficking
89
(Whitney et al., 2007), but given the complexity of this pathway, as well as TOR and
glucose derepression pathways, how exactly the signaling pathway(s) plays a role in
tRNA nuclear-cytoplasmic trafficking needs further investigation (Whitney et al., 2007).
It is unknown what the consequence(s) of reduced enzyme levels in the Met, Arg,
and Leu biogenesis pathways is. One possibility is that reduction of such enzymes leads
to decrease amino acid products. However, it is less likely according to several lines of
evidence. First, no tRNA charging defects are observed in tRNA trafficking mutants
(Whitney et al., 2007, and personal communication with Dr. Rebecca Hurto), suggesting
that aminoacylation status of bulk tRNAs must be not affected in tRNA trafficking
mutants. Second, uncharged tRNAs can activate the kinase Gcn2 and subsequently
enhance translation of GCN4, the general regulator of amino acid biosynthesis, which
activates the transcription of Gcn4-responsive genes. Evidence from transcription
expression profiles of fed mtr10Δ and msn5Δ cells showed that Gcn4-responsive genes
are not induced (data not shown). This result correlates to previous observation that
aminoacylation status of tRNAs are not affected when tRNA nuclear-cytoplasmic
trafficking is defective (Whitney et al., 2007). We still cannot completely rule out this
possibility that the productions of amino acids, including Met, Arg, Leu, or more,
production are reduced in the tRNA trafficking mutants and this reduction is
complemented by amino acids from media.
It is also likely that tRNA nuclear-cytoplasmic trafficking functions in
maintaining the basal levels of these target enzymes to regulate intermediates of the Met,
Arg, and Leu biosynthetic pathways, not to regulate the amino acid production per se. If
90
it is true, we can predict the intracellular levels of specific substrates of these target
enzymes may be accumulated and/or enzyme products decreased in the Met, Arg, and
Leu biosynthetic pathways in tRNA trafficking mutants.
Since several amino acid biogenesis-related enzymes can be feedback regulated
by their products (Cherest et al., 1973, for reviews, see Hinnebusch, 1988; Thomas and
Surdin-Kerjan, 1997), it seems also possible that tRNA trafficking defects lead to
changes in metabolic flux and that subsequently causes accumulation of amino acids. The
excess amino acid products further inhibit the rate-limiting enzyme activities without
affecting aminoacylation levels of tRNAs. If it is true, it will also be interesting to learn
why sulfur assimilation and arginine biosynthesis pathways are repressed by regulating
multiple proteins of the pathways, whereas the affected Leu, Ser, and Lys biosynthetic
pathway proteins function at first step of each pathway (leucine biosynthesis pathway see
Figure 3. 14, serine and lysine pathways are not shown). Therefore, extensive analysis of
amino acid intermediates and metabolome in tRNA trafficking mutants may shed light on
understanding the physiological functions of tRNA subcellular dynamics.
How these specific mRNA targets are commonly regulated at translation level by
tRNA nuclear-cytoplasmic trafficking? It is not clear. We are unable to identify common
cis-regulatory elements among the ORFs within these down-regulated translating
mRNAs by analyzing codon bias or amino acid usage bias. Moreover, other than Gcn4responsive elements, methionine-responsive element, and arginine-responsive element,
we are not able to find other common regulatory motifs among the 5’ UTR and 3’ UTR
regions from all of the target mRNAs. These results led us to propose that perhaps these
91
targets are regulated by secondary structure close to AUG or by uORF, which serves as
negative translation regulator. Importantly, a previous study characterizing MET2
transcript provides a hint in which MET2 is implicated to be regulated at posttranscriptional level and there are two possible stem-loop-stem structures from upstream
region to open reading frame (-9 to +61 and -80 to -44, Baroni et al., 1986; Forlani et al.,
1991). Whether and how MET2 transcript is regulated via the secondary structure is still
unknown. A recent publication has been shown that proteins synthesis can be initiated by
non-canonical uORF in mammalian cells (Starck et al., 2012). Thus, investigation of
secondary structure near start codon as well as identification of possible uORF (canonical
and non-canonical) among the upstream sequences of these targets might provide
possible regulatory mechanisms.
Although we discovered a novel function for tRNA subcellular trafficking in
cellular metabolism, its other potential functions are not excluded. For example, tRNA
nuclear retrograde import might function in transporting damaged or hypomodified
tRNAs back to the nucleus for quality control/proofreading. It has been shown that two
tRNA surveillance systems exist in yeast cells, the TRAMP pathway, which locates in the
nucleus, and the RTD pathway, which locates in the nucleus and the cytoplasm.
(Alexandrov et al., 2006; Chernyakov et al., 2008; Kadaba et al., 2006). Since tRNA
nuclear import is constitutive, transporting damaged cytoplasmic tRNAs for repair or
turnover further supports this observation. Moreover, in trm8Δ trm4Δ cells tRNAVal(AAC)
is hypomodified and degraded by the RTD pathway, which was proposed to cause the
temperature sensitive growth at 37°C (Chernyakov et al., 2008). When we introduced
92
los1Δ into trm8Δ trm4Δ cells, we found this triple mutant is even more sensitive when
grown at 30°C (Appendix A, Figure A. 1). We reason that it is likely because tRNA
substrates are retained in the nucleus in cells lacking Los1, and this subsequently leads to
increasing tRNA substrates degraded by endonucleases.
A recent study showed that the tRNA nuclear-cytoplasmic trafficking is required
for wybutosine (yW) base modification of tRNAPhe at position 37 (Ohira and Suzuki,
2011). G37 of tRNAPhe must be imported to the nucleus and modified by nuclear Trm5,
and the product m1G37 of tRNAPhe needs to return cytoplasm for next modification to
form yW. The yW formation is catalyzed by the four cytoplasmic enzymes, Tyw1-4, and
is important to prevent translation frameshift (Kalhor et al., 2005; Noma et al., 2006).
Therefore, interrupting tRNA nuclear import or re-export would generate the
hypomodified tRNAPhe , which subsequently increase translation frameshift, and that
might be the reason for reduced levels of proteins involved in Met, Arg, and Leu
biosynthetic pathways in cells defective in tRNA nuclear import or export. And if this is
the case, mislocation of the nuclear Trm5 to the cytoplasm may prevent the reduction.
Furthermore, in tyw1Δ cells the levels of proteins responsible for Met, Arg, and Leu
biosynthetic pathways should also decrease. However, our result revealed that
mislocation of the nuclear Trm5 to the cytoplasm in mtr10Δ cells does not rescue the
reduced protein levels (Appendix A, Figure A. 3). Also, Arg3-3HA (Appendix A, Figure
A. 3) or Met3-3HA (data not shown) protein levels are unchanged in tyw1Δ cells.
Therefore, hypomodified tRNAPhe is not the reason for down-regulation of translating
amino acid biosynthetic mRNAs. However, there are other modifications whose
93
pathways are not yet discovered. This might also follow the tRNA nuclear-cytoplasmic
trafficking and contribute to the regulation on the translation of the target mRNAs.
It is also possible that the tRNA nuclear import functions for nuclear translation.
Whether nuclear translation does occur in the eukaryotic cells has been argued for a long
time. Recently it has been reported that nuclear translation occurs in the mammalian cells
(David et al., 2012; Reid and Nicchitta, 2012). Others argued that their data do not
support the nuclear translation (Dahlberg and Lund, 2012). Even if nuclear translation
occurs in the mammalian cells, it may or may not occur in yeast. Thus, tRNA import may
still leave a novel function in the nucleus.
We seek to provide addition information about the cellular function of tRNA
nucleocytoplasmic trafficking. For example, we would like to extend the analysis of cisregulatory elements by identifying possible uORFs or secondary structures in the
upstream region of target mRNAs. Moreover, the mRNAs encode Met, Arg, and Leu
biosynthetic pathways should be associated with the non-polysomal region in the
Northern blot analysis of samples collected from tRNA trafficking mutants. Furthermore,
since there is no large change in microarray analysis of msn5Δ cells and Los1 also
functions in tRNA re-export, therefore, we expect a larger change in los1Δ msn5Δ cells
by microarray analysis.
There are more questions remaining unanswered. How do cells sense tRNA
intracellular distribution? Are nuclear accumulated tRNAs functional? If so, what is the
physiological role(s) of previously-cytoplasmic nuclear tRNA during nutrient starvation?
The roles of tRNA nuclear-cytoplasmic trafficking in quality control and the newly
94
discovered regulation/maintenance of amino acid biosynthesis are still not able to explain
why and how tRNAs are retained in the nucleus upon nutrient stress? More studies on
how exporters are regulated during nutrient stress and which signaling pathway(s) is
involved will be important to answer these questions.
95
CHAPTER 4
Transcriptional analysis of mtr10Δ cells
4.1 Introduction
Mtr10 was first discovered in a genome-wide screen for polyadenylated mRNAs
accumulation in the nucleus at 37°C. Thus, Mtr10 was suggested to function in mRNA
nuclear export (Kadowaki et al., 1994). Later, it was reported to be a member of the
karyopherin family that functions in nuclear import of an essential mRNA binding
protein, Npl3. Npl3 functions in nuclear export of mRNAs and large ribosomal subunits
(Hackmann et al., 2011; Lee et al., 1996; Stage-Zimmermann et al., 2000; Windgassen et
al., 2004). Npl3 immunoprecipitates with Mtr10 and the complex only disassociates in
the presence of Ran-GTP. Npl3 shuttles between the nucleus and the cytoplasm, and thus
in the absence of Mtr10 as expected for a β-importin, Npl3 mislocalizes to the cytoplasm
(Pemberton et al., 1997; Senger et al., 1998).
Mtr10 is also required for the nuclear import of the RNA component of the yeast
telomerase, TLC1 (Ferrezuelo et al., 2002; Gallardo et al., 2008). The nucleo-cytoplasmic
trafficking of TLC1 RNA is required for telomerase biogenesis (Gallardo et al., 2008;
96
Teixeira et al., 2002). In wild-type cells TLC1 RNA is predominantly in the nucleus and
it is mislocalized to the entire cell in mtr10Δ cells (Ferrezuelo et al., 2002).
To date, the understanding of the physiological roles of Mtr10 is limited. It was
proposed that there must be more unexplored cargos which depend on Mtr10 (Senger et
al., 1998). In this study, we employed a genome-wide approach to determine the direct
and indirect targets of Mtr10 by comparing the gene expression level of each transcript in
mtr10Δ to wild-type cells in fed or amino acid starvation condition. We demonstrated that
in addition to its previously known role to import Npl3, Mtr10 also likely functions in
sporulation, DNA damage response, glutathione homeostasis, metal ion homeostasis, and
lipid metabolism, directly or indirectly.
4.2 Results
This section includes data analysis of transcription profiles from total mRNAs of msn5Δ
(section 4.2.1) and mtr10Δ (section 4.2.2 and thereafter) cells compared to wild-type cells
in fed or amino acid starvation conditions. Because the transcription profiles of msn5Δ
cells were as expected from the large numbers of studies of this karyopherin (Bakhrat et
al., 2008; Blondel et al., 1999; Bollman et al., 2003; DeVit and Johnston, 1999; Kaffman
et al., 1998; Shimada et al., 2000; Willis and Moir, 2007), the results described in this
section predominately focus on the transcriptional analyses of mtr10Δ cells. The data
include the microarray analyses of the transcriptional profiles, the validations of selected
transcripts, and functional analyses.
97
4.2.1 Microarray analysis of transcription profiles in msn5∆ cells
Since Msn5 is known to export several nuclear phosphorylated transcription factors, such
as Far1 and Pho4, to the cytoplasm in fed conditions (Blondel et al., 1999; Kaffman et al.,
1998), we expected that msn5Δ cells would accumulate these cargos in the nucleus and
therefore their target genes would have induced transcription. After employing statistical
analysis of the transcription profiles from msn5Δ cells to the profiles from wild-type cells,
we used the cutoff conditions with adjusted p-value 0.05 and log2 FC
0.6 or
−0.6 to
select differentially expressed genes. In msn5Δ cells, 177 genes were up-regulated and
119 genes were down-regulated in the fed condition; and 193 genes were up-regulated
and 258 genes were down-regulated in acute amino acid starved condition (see
Table 4. 1). All of the genes with statistically significant changes in expression are listed
in Appendix L to Appendix O (msn5Δ vs. wild-type in fed or amino acid starved
conditions). Most of the affected mRNAs are consistent with previous studies (Blondel et
al., 1999; Springer et al., 2003). For example, the transcription of several Pho4responsive genes, such as PHO84, PHO89, PHO11, and PHO5, were activated in msn5Δ
cells (Appendix M). Hence, in the following sections we focus on the transcriptional
profiles from mtr10Δ cells.
4.2.2 Microarray analysis of transcription profiles in mtr10∆ cells
Current understanding of the cellular roles of the importin Mtr10 is largely unclear. Since
the results from analysis of the transcriptional profiles of msn5Δ cells confirmed its
known roles, we proposed that analysis of transcriptional profiles of mtr10Δ cells could
98
provide further insights into the cellular functions of Mtr10. In general, the transcription
profiles from mtr10Δ cells exhibited a relatively larger change as roughly assessed by
PCA analysis (Figure 4. 1). We next performed statistical analysis of the microarray
transcriptional profiles from total RNA samples of mtr10Δ cells compared to total RNA
samples isolated from wild-type cells that were propagated in fed or acute amino acid
starvation condition. Because ~10% of genome was affected in mtr10Δ cells (~900 genes
affected in fed and ~1400 genes affected in starved condition) when using adjusted pvalue
0.05, we used a more stringent condition to select significant differentially
expressed genes to narrow down the range of genes of interests (Table 4. 1). Total
numbers of 533 genes from fed mtr10Δ cells and 1165 genes from starved mtr10Δ cells
were selected using the cutoff condition as adjusted p-value 0.001 and log2 FC
0.6 or
−0.6 (Figure 4. 2 and Table 4. 1). More details are described below. All of the genes with
statistically significant changed in expression are listed in Appendix G to Appendix J
(mtr10Δ vs. wild-type).
Genes with expression changed in mtr10Δ cells under fed condition
There are 335 genes that were up-regulated and 198 genes that were down-regulated in
cells lacking Mtr10 (Table 4. 1). To understand the functions of the differential expressed
genes, we employed GO term-enrichment analysis and FunCat analysis (complete result
of FunCat analysis is in Appendix F). Among the 335 up-regulated genes, the top one
over-represented function of each analysis was sexual reproduction (from GO term
enrichment analysis, n=28) and zygospore development (from FunCat, n=21),
99
respectively (Table 4. 2). The results suggested that Mtr10, directly or indirectly, is
involved in the regulation of zygote or spore formation. Among 198 down-regulated
genes, 11 encoded proteins that function in metal ion homeostasis (top one from GO term
enrichment analysis) and 22 encoded proteins that function in lipid metabolism (top one
from FunCat analysis) (Table 4. 2). Taken together, the transcriptional profiling of fed
mtr10Δ cells revealed several potential functions of Mtr10.
100
Figure 4. 1. PCA analysis of transcription profiles of total mRNAs from wild-type,
msn5Δ, and mtr10Δ cells in fed or acute amino acid starvation condition. PCA analysis
provided a general view of microarray data before statistical analysis. One ball represents
one microarray experiment.
101
6
4
0
2
-log10 p value
8
Volcano plot of limma -- Tf_mtr10 vs wt
-6
-4
-2
0
2
4
Diff (logFC)
6
4
0
2
-log10 p value
8
Volcano plot of limma -- Ts_mtr10 vs wt
-6
-4
-2
0
2
Diff (logFC)
Figure 4. 2. Volcano plots showing differential expressed genes at transcriptional level
in mtr10Δ cells versus wild-type cells. Upper, in fed condition; bottom, in acute amino
acid starved condition. Red dots represent up-regulated genes; blue dots represent downregulated genes. Cutoff values of adjusted p-value < 0.001 with log2 FC
0.6 or
are shown in dashed lines in the plots. Y axis represents log10 of original p-value.
102
− 0.6
msn5Δ vs. WT
mtr10Δ vs. WT
Total.Fed a
Total.Starved a
Total.Fed b
Up
177
193
335
605
Down
119
258
198
560
Total.Starved b
Table 4. 1. Numbers of significant differentially transcriptionally expressed genes from
total mRNA samples of msn5Δ or mtr10Δ cells in fed or amino acid starvation conditions.
a: adjusted p-value < 0.05 with log2 FC
with log2 FC
0.6 or
0.6 or
− 0.6; b: adjusted p-value < 0.001
− 0.6.
Genes changed in mtr10-deletion cells under starved condition
By identifying genes with expression changes in amino acid starved mtr10Δ cells
compared to amino acid starved wild-type cells, we may be able to discover “Mtr10dependent amino acid-deprived responsive” genes. If so, the data could provide
information about the possible role of Mtr10 in response to environmental stress. In the
transcriptional profiles from starved mtr10Δ cells, there were 605 genes that were upregulated and 560 genes that were down-regulated (Table 4. 1). Some of the affected
genes were attributed to loss of Mtr10 per se, and thus appeared in both profiles from fed
and starved conditions (the common affected genes in fed and starved conditions in
Figure 4. 3). We identified numerous genes with affected expression only in starved
condition. The functions of up-regulated genes included cell cycle, DNA repair, nuclear
mRNA splicing, and protein folding (Table 4. 3). Interestingly, among starvation-only
103
down-regulated genes via identified a large numbers of genes encoded transporters. This
result suggested that Mtr10 is likely involved in regulation of transporters in response to
amino acid starvation.
4.2.3 Confirmations of selected target mRNA expressions by Northern
blot analysis
Genome-wide studies usually provide valuable information, but often produce errors or
false-positive results. Hence, it is necessary to validate every gene of interest selected
from microarray expression profiles by different methods, such as Northern blot analysis
or real-time RT-PCR. To confirm the microarray data analysis of the transcriptional
profile from mtr10Δ cells grown in fed condition, I performed the Northern analyses. The
total mRNAs were collected from wild-type, mtr10Δ, and msn5Δ cells grown in SC
media. In this experiment, msn5Δ cells served as an internal negative control. At least one
target gene from each functional category was chose to be validated.
Most of the targets from up-regulated expression profiles in mtr10Δ cells were
confirmed: MTH1 (encodes a protein involved in negative regulator of glucose signaling
transduction pathway), CWC15 (encodes a protein involved in mRNA splicing), RAD9
(encodes DNA-damage checkpoint protein), and LCD1 (encodes a protein essential in
DNA integrity pathway) (Figure 4. 4) were all up-regulated. The expression profiles of
SNF3 (encodes membrane glucose sensor) and DAL80 (encodes negative regulator of
nitrogen degradation pathway) were tested but no signals were detected, likely due to
their low expressions (data not shown). SPS2, SPR3, and SPR28, encode proteins
104
expressed during sporulation, were also tested. The expression level of SPS2 gene was
not significantly increased in mtr10Δ cells (Figure 4. 4). In addition, the signals of SPR3
and SPR28 were too low to be detected by Northern analysis (data not shown).
We also examined the expression levels of two candidate genes, GTO3 and TPO4,
which were down-regulated by microarray analyses. GTO3 encodes a glutathione
transferase and TPO4 encodes a polyamine transporter. The results of Northern analysis
showed that the expression level of GTO3 was dramatically reduced in mtr10Δ cells
relative to wild-type or msn5Δ cells and thus confirmed the microarray data (Figure 4. 4).
In contrast, the expression level of TPO4 was unchanged in mtr10Δ cells when compared
to wild-type cells (data not shown).
In conclusion, by employing Northern blot analysis, the expression profiles of
most tested targets from microarray analyses in fed mtr10Δ cells were confirmed. Mtr10
not only imports Npl3 but also is possibly involved in regulation of glucose signaling
pathway, DNA damage checkpoint pathways, and glutathione homeostasis. Although
further investigations are required, the microarray analysis of transcription profiles from
mtr10Δ cells provides valuable information and hints of the physiological roles of Mtr10.
4.2.4 Phenotypic analyses by growth assays
Since it appeared that the DNA damage-related genes were up-regulated in mtr10Δ cells
(Figure 4. 4), we proposed that the DNA damage pathway was activated in mtr10Δ cells.
If so, mtr10Δ cells might be more resistant to DNA damage than wild-type cells. To test
this hypothesis, we performed growth assay of wild-type, mtr10Δ, msn5Δ, los1Δ, and
105
los1Δ msn5Δ cells, on solid media containing the mutagen 5-fluorouracil (5-FU) which
induces DNA base excision repair pathway (Seiple et al., 2006), or methyl
methanesulfonate (MMS) which causes DNA double strand breaks (Lundin et al., 2005)
(Figure 4. 5). Since it was previously shown that los1Δ cells are sensitive to 5-FU
(Gustavsson and Ronne, 2008), we utilized los1Δ strain as a positive control. We also
examined other tRNA nucleocytoplasmic trafficking mutants, such as msn5Δ and los1Δ
msn5Δ, to test their growth in the presence of these mutagens.
Contrary to the expectation, the mtr10Δ strain was not resistant to either DNA
damage agent. Conversely, the mtr10Δ cells were more sensitive (Figure 4. 5). These
results indicated that both DNA repair pathways were defective in the absence of Mtr10
even through RAD9 and LCD1 mRNA levels were induced (Figure 4. 4). As expected,
los1Δ cells were not viable in the presence of 5-FU, msn5Δ cells grew similarly as wildtype cells. These results suggest that Los1 and Msn5 do not function in parallel in
response to DNA damage. Since 5-FU activates DNA base-excision pathway (Seiple et
al., 2006) and los1Δ cells are sensitive to 5-FU (Gustavsson and Ronne, 2008), we
hypothesized that Los1 functions in the DNA damage response. If this is the case, los1Δ
cells would be also sensitive when DNA damage response alternatively induced by MMS.
However, wild-type, msn5Δ, los1Δ, and los1Δ msn5Δ strains had similar growth on the
MMS-containing solid media. The data suggest that these tRNA exportin pathways
function independently for the DNA double-strand damage response.
106
107
Table 4. 2. GO term enrichment analysis and FunCat analysis of genes with significant changed in mtr10Δ cells in fed condition.
Significant up-regulated or down-regulated expressed genes were analyzed and grouped with their GO terms or functional
categories by using web-interface tools in GO or FunCat, respectively. Bold words represent the over-represented GO term or
functional categories. Numbers of genes in each term or category are noted in parentheses. The p-value was obtained by
comparing the occurrence frequency to background frequency.
107
108
Table 4. 3. GO term enrichment analysis and FunCat analysis of genes with significant changed in mtr10Δ cells in acute amino
acid starved condition. Significant up-regulated or down-regulated expressed genes were analyzed and grouped with their GO
terms or functional categories by using web-interface tools in GO or FunCat, respectively. Bold words represent the overrepresented GO term or functional categories. Numbers of genes in each term or category are noted in parentheses. The p-value
was obtained by comparing the occurrence frequency to background frequency.
108
Figure 4. 3. Venn diagram of differentially expressed genes from mtr10Δ cells relative
to wild-type cells in fed and amino acid starved conditions.
109
110
Figure 4. 4. Northern blot analysis of total mRNAs collected from wild-type, mtr10Δ, and msn5Δ cells grown in fed condition.
ACT1 served as internal loading control. 25S and 18S rRNAs were also serving as internal loading controls, the bottom pictures
were ethidium bromide-stained agarose gels. Each ratio was obtained from normalizing to ACT1 expression value and then
compared to WT.
110
Figure 4. 5. Growth assay to assess the function of Mtr10 in DNA damage response. All
of the strains were grown in liquid YEPD media overnight at 30°C and were adjusted to
similar density followed with 10X serial dilution before spotting on the indicated solid
media. 5-FU, 5-fluorouracil, a pyrimidine analog. MMS, an agent causes DNA double
strand breaks. The concentrations of 5-FU and MMS were 15 µg/ml and 0.02 %,
respectively, in SC media. The cells were incubated at indicated temperatures for 2 days.
111
4.3 Discussion
Here we report that in mtr10Δ cells a large number of genes (about ~10% of the genome
when we used the stringent conditions with adjusted p-value < 0.001 and log2 FC
or
0.6
− 0.6) have affected expression from microarray analysis. Among the up-regulated
genes, those encoding zygote development and sporulation are over-represented. In
Northern analysis the expression level of one of these genes, SPS2, is not significantly
increased. It is likely because its expression is too low to be detected. Therefore, the
potential function of Mtr10, and/or its unknown cargo(s), in the regulation of sporulation
may not be exclusive.
Other than sporulation-related genes, we also confirmed the enhanced expression
of DNA damage check point-related genes, RAD9 and LCD1, in fed mtr10Δ cells.
However, the results of growth assay indicated that the mtr10Δ cells are highly sensitive
to 5-FU and MMS and do not grow in the presence of these agents. It is unknown
whether up-regulated expression of RAD9 and LCD1 are direct or indirect due to loss of
Mtr10, but this misregulation may contribute to the defect of DNA damage response in
mtr10Δ cells. Since the studies about Rad9 and Lcd1 mainly focus on the regulation of
their phosphorylation states during DNA damage signaling pathway (Andrew, 1998;
Rouse and Jackson, 2000), our findings provide a potentially different level of regulation.
More interestingly, previous work showed that intron-containing tRNAs are retained in
the nucleus after UV-induced DNA damage due to the translocation of Los1 from the
nucleus to cytoplasm (Ghavidel et al., 2007). Although the regulation of this translocation
and its biological significance are unclear, this observation leads to the idea that Mtr10
112
might play a role in the DNA damage signaling transduction pathway. If so, it might be
directly regulated by the translocation of Mtr10 upon DNA damage (like Los1) or
through Mtr10’s function in shuttling the unknown cargo(s) that function in the DNA
damage signaling pathways.
Northern analysis also confirmed that induction of expression levels of MTH1,
which encodes a negative regulator in the glucose signaling pathway (for review, see
Santangelo, 2006). When cells are grown in glucose-containing media, MTH1 expression
is repressed by the Snf1-Mig1 glucose repression pathway (Kim et al., 2006). Strikingly,
MTH1 not only de-represses in mtr10Δ cells but also in msn5Δ cells. This observation
indicates that the Snf1-Mig1 glucose repression pathway is not fully functional in cells
with defective in tRNA nuclear-cytoplasmic traffic. It is unknown whether the
accumulating MTH1 transcripts leads to increased Mth1 protein and more phosphorylated
Mth1. Because it has been shown that the regulation of tRNA subcellular distribution is
glucose-dependent/specific (Whitney et al., 2007), our data provides supporting evidence
that there might be a connection between the regulation of glucose signaling transduction
pathway and tRNA subcellular movement.
For down-regulated genes, we confirmed GTO3 reduced transcript levels. GTO3
encodes a glutathione transferase. This result provides another potential function for
Mtr10 in glutathione homeostasis. In addition, Mtr10 may participate in two other
cellular processes: metal ion homeostasis and lipid metabolism, according to the
microarray analysis. It is particularly interesting to examine the expression levels of
genes related to the lipid metabolism in mtr10Δ cells, because lipid homeostasis is
113
important for maintaining cell membrane and cell shape, and previous observations
shows that mtr10Δ cells have abnormal long and shield-like shape (Murthi et al., 2010;
Whitney et al., 2007). Therefore, although further investigations are needed, the
transcriptional profiles provide explanations for the abnormal shape of mtr10Δ mutant
cells.
114
CHAPTER 5
Summary and future directions
In this study the data provide no evidence for the possibility that tRNA nuclear retrograde
process functions as a stress signal upon nutrient deprivation from the results of
polysome profiles and microarray data of starved tRNA trafficking mutants. But we
discovered a novel connection between tRNA nuclear-cytoplasmic trafficking and
translation of the Met, Arg, and Leu amino acid biosynthetic mRNAs. In cells with
defects of tRNA trafficking, several enzymes involved in the Met, Arg, and Leu amino
acid biosynthesis pathways are poorly produced, suggesting a role of tRNA nuclearcytoplasmic trafficking in maintaining the basal levels of translation of mRNAs encoding
Met, Arg, and Leu biosynthetic pathways.
Future direction
It is unknown what are the consequence(s) caused by the reduced levels of the
Met, Arg, and Leu biosynthetic enzymes. A high-throughput analysis of amino acid
intermediates in Met, Arg, and Leu biosynthesis pathways by LC/MS might provide more
insights in the ultimate outcomes in amino acid metabolism when tRNA nuclearcytoplasmic traffic is defective. Additionally, it is also interesting to study by which
115
mechanism that tRNA trafficking specifically regulates the translations of mRNAs
involved in Met, Arg, and Leu biosynthetic pathways.
On the other hand, more work is required to confirm the microarray data for the
mtr10Δ mutant. In addition, further investigations on the consequences of the affected
genes will contribute a greater understanding of the biological functions of Mtr10. In
particular, what is the role of Mtr10 in DNA damage response pathways? Whether or not
the glucose signaling pathways are misregulated in the mutants with defects of tRNA
nuclear-cytoplasmic trafficking? If so, how these two pathways are coupled?
116
APPENDIX A: Tested possibilities for
mechanism of down-regulated translation of the
target mRNAs involved in the Met, Arg, and Leu
biosynthetic pathways
This section includes two results. First, in Figure A. 1 and Figure A. 2, I employed the
growth assay to determine the temperature sensitive growth of tRNA modification
mutants and its derivative strain with tRNA trafficking mutants. Second, we tested the
hypothesis that mislocate the nuclear Trm5 to the cytoplasm might rescue the reduced
levels of Arg3-3HA in cells with defective of tRNA import process (mtr10Δ) (Figure A.
3). In addition, we assessed Arg3-3HA protein levels in tRNA yW modification mutant
(tyw1Δ) (Figure A. 3). The result showed that Arg3-3HA protein level was not rescued
when mislocating Trm5 into the cytoplasm in mtr10Δ cells and Arg3-3HA protein was
unchanged in tyw1Δ cells. Moreover, nuclear retention tRNAs by overexpressing Trz1MORF does not lead to reduced levels of Arg5,6-GFP. All together, several lines of
evidence indicated that the reduced levels of target amino acid biosynthesis pathways do
not result from tRNAPhe modification defect.
117
118
Figure A. 1. Growth assay of mutants defective in tRNA export and modifications. trm8Δ trm4Δ mutants combined with
defective tRNA export processes (los1Δ, msn5Δ, los1Δ msn5Δ). trm8Δ trm4Δ-derived defective tRNA export mutants. All
mutants were grown in liquid media overnight and density-adjusted cells were serial-diluted on SC solid media and incubated two
or more days at indicated temperature. #1, #2, and #3 represented three different candidates.
118
119
Figure A. 2. Growth assay of mutants defective in tRNA import and modifications. All mutants were grown in liquid media
overnight and density-adjusted cells were serial-diluted on SC solid media and incubated two or more days at indicated
temperature. #1, #2, and #3 represented three different candidates. A. trm8Δ trm4Δ mutants combined with defective tRNA export
processes (los1Δ, msn5Δ, los1Δ msn5Δ). B. trm8Δ trm4Δ mutants combined with defective of tRNA import process mtr10Δ.
119
Figure A. 3. Western blot analysis of Arg3-3HA in tRNA modification mutants. A.
Endogenously GFP or NES-GFP tagged Trm5 was created in Wild-type or mtr10Δ cells
that harboring Arg3-3HA fusion protein. The whole cell extracts were collected from
early log phase of cell culture in SC media. Kar2 is internal loading control. B.
Assessment of Arg3-3HA protein levels in tyw1Δ cells. Wild-type or mtr10Δ cells served
as positive and negative controls. C. Assessment of Arg5,6-GFP in cells expressing
vector or Trz1-MORF plasmid before and after galactose 3-hr induction.
120
APPENDIX B: Transcripts with decreased
translation activity index in fed mtr10Δ cells
The transcripts with decreased P/NP ratio (cutoff condition: log2 FC
0.6 and
adjusted p-value 0.05) in mtr10Δ cells while compared to wild-type cells in fed
condition are listed below and ordered according to log2 (fold-change).
Transcripts with decreased P/NP ratio in fed mtr10Δ cells.
log2 (mtr10[P
f/NP.f]/
WT[Pf/N
P.f]) Symbols ORF Description SUL1 YBR294W STR3 YGL184C BDH2 YAL061W PHM6 YDR281C MET2 YNL277W MET28 YIR017C NA YGR226C AAD14 YNL331C TPK1 YJL164C MET3 YJR010W High affinity sulfate permease; sulfate uptake is mediated by specific sulfate transporters Sul1p and Sul2p, which control the concentration of endogenous activated sulfate intermediates Peroxisomal cystathionine beta‐lyase, converts cystathionine into homocysteine; may be redox regulated by Gto1p Putative medium‐chain alcohol dehydrogenase with similarity to BDH1; transcription induced by constitutively active PDR1 and PDR3 Protein of unknown function, expression is regulated by phosphate levels L‐homoserine‐O‐acetyltransferase, catalyzes the conversion of homoserine to O‐acetyl homoserine which is the first step of the methionine biosynthetic pathway Basic leucine zipper (bZIP) transcriptional activator in the Cbf1p‐
Met4p‐Met28p complex, participates in the regulation of sulfur metabolism Dubious open reading frame, unlikely to encode a protein; not conserved in closely related Saccharomyces species; overlaps significantly with a verified ORF, AMA1/YGR225W Putative aryl‐alcohol dehydrogenase with similarity to P. chrysosporium aryl‐alcohol dehydrogenase; mutational analysis has not yet revealed a physiological role cAMP‐dependent protein kinase catalytic subunit; promotes vegetative growth in response to nutrients via the Ras‐cAMP signaling pathway; inhibited by regulatory subunit Bcy1p in the absence of cAMP; partially redundant with Tpk2p and Tpk3p ATP sulfurylase, catalyzes the primary step of intracellular sulfate activation, essential for assimilatory reduction of sulfate to sulfide, involved in methionine metabolism 121
adj.p.val ‐2.8202 0.0026
‐2.4652 0.0024
‐2.2714 0.0037
‐2.0514 0.0171
‐1.8123 0.0041
‐1.7081 0.0050
‐1.6090 0.0408
‐1.5827 0.0127
‐1.5650 0.0060
‐1.4839 0.0060
log2 (mtr10[P
f/NP.f]/
WT[Pf/N
P.f]) Symbols ORF Description MMP1 YLL061W ‐1.4724 0.0050
NA YHR140W High‐affinity S‐methylmethionine permease, required for utilization of S‐methylmethionine as a sulfur source; has similarity to S‐
adenosylmethionine permease Sam3p Putative integral membrane protein of unknown function
‐1.4717 0.0288
FRE5 YOR384W ‐1.4654 0.0205
NA YBR184W ‐1.4519 0.0060
MET32 YDR253C ‐1.4489 0.0096
NA YFR032C‐B ‐1.4458 0.0171
QDR2 YIL121W ‐1.4424 0.0301
COX17 YLL009C ‐1.3702 0.0459
MET14 YKL001C ‐1.3027 0.0171
ARG3 YJL088W ‐1.2977 0.0060
SAP4 YGL229C ‐1.2958 0.0216
MHT1 YLL062C ‐1.2937 0.0108
MET16 YPR167C ‐1.2880 0.0112
NA YDR366C Putative ferric reductase with similarity to Fre2p; expression induced by low iron levels; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies Putative protein of unknown function; YBR184W is not an essential gene Zinc‐finger DNA‐binding protein, involved in transcriptional regulation of the methionine biosynthetic genes, similar to Met31p Putative protein of unknown function; identified by gene‐trapping, microarray‐based expression analysis, and genome‐wide homology searching Multidrug transporter of the major facilitator superfamily, required for resistance to quinidine, barban, cisplatin, and bleomycin; may have a role in potassium uptake Copper metallochaperone that transfers copper to Sco1p and Cox11p for eventual delivery to cytochrome c oxidase; contains twin cysteine‐x9‐cysteine motifs Adenylylsulfate kinase, required for sulfate assimilation and involved in methionine metabolism Ornithine carbamoyltransferase (carbamoylphosphate:L‐ornithine carbamoyltransferase), catalyzes the sixth step in the biosynthesis of the arginine precursor ornithine Protein required for function of the Sit4p protein phosphatase, member of a family of similar proteins that form complexes with Sit4p, including Sap155p, Sap185p, and Sap190p S‐methylmethionine‐homocysteine methyltransferase, functions along with Sam4p in the conversion of S‐adenosylmethionine (AdoMet) to methionine to control the methionine/AdoMet ratio 3'‐phosphoadenylsulfate reductase, reduces 3'‐phosphoadenylyl sulfate to adenosine‐3',5'‐bisphosphate and free sulfite using reduced thioredoxin as cosubstrate, involved in sulfate assimilation and methionine metabolism Putative protein of unknown function
‐1.2866 0.0204
AMS1 YGL156W ‐1.2697 0.0112
NA YKL069W ‐1.2514 0.0366
SEO1 YAL067C ‐1.2394 0.0293
EMI2 YDR516C ‐1.2189 0.0416
NA YBL008W‐A ‐1.2071 0.0459
NA YLR361C‐A Vacuolar alpha mannosidase, involved in free oligosaccharide (fOS) degradation; delivered to the vacuole in a novel pathway separate from the secretory pathway Methionine‐R‐sulfoxide reductase, reduces the R enantiomer of free Met‐SO, in contrast to Ycl033Cp which reduces Met‐R‐SO in a peptide linkage; has a role in protection against oxidative stress Putative permease, member of the allantoate transporter subfamily of the major facilitator superfamily; mutation confers resistance to ethionine sulfoxide Non‐essential protein of unknown function required for transcriptional induction of the early meiotic‐specific transcription factor IME1; required for sporulation; expression is regulated by glucose‐repression transcription factors Mig1/2p Putative protein of unknown function; identified by fungal homology and RT‐PCR Putative protein of unknown function
‐1.1860 0.0429
SUL2 YLR092W High affinity sulfate permease; sulfate uptake is mediated by specific sulfate transporters Sul1p and Sul2p, which control the concentration of endogenous activated sulfate intermediates ‐1.1638 0.0252
122
adj.p.val log2 (mtr10[P
f/NP.f]/
WT[Pf/N
P.f]) Symbols ORF Description SPC3 YLR066W MET1 YKR069W ARG7 YMR062C HXT9 YJL219W RGI1 YER067W PAU17 YLL025W NAT5 YOR253W NA YDL114W SET4 YJL105W Subunit of signal peptidase complex (Spc1p, Spc2p, Spc3p, Sec11p), which catalyzes cleavage of N‐terminal signal sequences of proteins targeted to the secretory pathway; homologous to mammalian SPC22/23 S‐adenosyl‐L‐methionine uroporphyrinogen III transmethylase, involved in the biosynthesis of siroheme, a prosthetic group used by sulfite reductase; required for sulfate assimilation and methionine biosynthesis Mitochondrial ornithine acetyltransferase, catalyzes the fifth step in arginine biosynthesis; also possesses acetylglutamate synthase activity, regenerates acetylglutamate while forming ornithine Putative hexose transporter that is nearly identical to Hxt11p, has similarity to major facilitator superfamily (MFS) transporters, expression of HXT9 is regulated by transcription factors Pdr1p and Pdr3p Protein of unknown function involved in energy metabolism under respiratory conditions; protein abundance is increased upon intracellular iron depletion Protein of unknown function, member of the seripauperin multigene family encoded mainly in subtelomeric regions; YLL025W is not an essential gene Subunit of the N‐terminal acetyltransferase NatA (Nat1p, Ard1p, Nat5p); N‐terminally acetylates many proteins, which influences multiple processes such as the cell cycle, heat‐shock resistance, mating, sporulation, and telomeric silencing Putative protein of unknown function with similarity to acyl‐carrier‐
protein reductases; YDL114W is not an essential gene Protein of unknown function, contains a SET domain
NA YJL218W NA YOR387C NA YIL046W‐A BNA4 YBL098W RTT102 YGR275W IRC15 YPL017C NA YJL163C GID7 YCL039W PAU5 YFL020C adj.p.val ‐1.1282 0.0431
‐1.1043 0.0205
‐1.1018 0.0205
‐1.0957 0.0454
‐1.0825 0.0308
‐1.0771 0.0171
‐1.0728 0.0454
‐1.0609 0.0108
‐1.0592 0.0330
Putative protein of unknown function, similar to bacterial galactoside O‐acetyltransferases; induced by oleate in an OAF1/PIP2‐dependent manner; promoter contains an oleate response element consensus sequence; non‐essential gene Putative protein of unknown function; regulated by the metal‐
responsive Aft1p transcription factor; highly inducible in zinc‐
depleted conditions; localizes to the soluble fraction Putative protein of unknown function; identified by expression profiling and mass spectrometry Kynurenine 3‐mono oxygenase, required for the de novo biosynthesis of NAD from tryptophan via kynurenine; expression regulated by Hst1p; putative therapeutic target for Huntington disease Component of both the SWI/SNF and RSC chromatin remodeling complexes, suggested role in chromosome maintenance; possible weak regulator of Ty1 transposition Microtubule associated protein; regulates microtubule dynamics; required for accurate meiotic chromosome segregation; null mutant displays large budded cells due to delayed mitotic progression, increased levels of spontaneous Rad52 foci Putative protein of unknown function
‐1.0499 0.0108
‐1.0169 0.0293
‐1.0125 0.0293
‐1.0108 0.0498
‐1.0074 0.0171
‐0.9902 0.0301
‐0.9795 0.0330
Protein of unknown function, involved in proteasome‐dependent catabolite inactivation of fructose‐1,6‐bisphosphatase; contains six WD40 repeats; computational analysis suggests that Gid7p and Moh1p have similar functions Member of the seripauperin multigene family encoded mainly in subtelomeric regions; induced during alcoholic fermentation; ‐0.9741 0.0424
‐0.9672 0.0301
123
Symbols NA ORF AIM19 YMR105W‐
A YIL087C MER1 YNL210W MRPL49 YJL096W AVT6 YER119C DOG2 YHR043C AGE2 YIL044C YHC3 YJL059W NA YOL162W MET10 YFR030W MET22 YOL064C NSE4 YDL105W HUL4 YJR036C IRC24 YIR036C NA YGR204C‐A GSY1 YFR015C MSW1 YDR268W BUR6 YER159C NA YOR238W log2 (mtr10[P
f/NP.f]/
WT[Pf/N
P.f]) Description induced by low temperature and also by anaerobic conditions;
negatively regulated by oxygen and repressed by heme Putative protein of unknown function
adj.p.val ‐0.9640 0.0207
Putative protein of unknown function; the authentic, non‐tagged protein is detected in purified mitochondria in high‐throughput studies; null mutant displays reduced respiratory growth Protein with RNA‐binding motifs required for meiosis‐specific mRNA splicing; required for chromosome pairing and meiotic recombination Mitochondrial ribosomal protein of the large subunit
‐0.9508 0.0365
‐0.9436 0.0301
‐0.9428 0.0288
Vacuolar aspartate and glutamate exporter; member of a family of seven genes (AVT1‐7) related to vesicular GABA‐glycine transporters; involved in compartmentalizing acidic amino acids in response to nitrogen starvation 2‐deoxyglucose‐6‐phosphate phosphatase, member of a family of low molecular weight phosphatases, similar to Dog1p, induced by oxidative and osmotic stress, confers 2‐deoxyglucose resistance when overexpressed ADP‐ribosylation factor (ARF) GTPase activating protein (GAP) effector, involved in Trans‐Golgi‐Network (TGN) transport; contains C2C2H2 cysteine/histidine motif Vacuolar membrane protein involved in the ATP‐dependent transport of arginine into the vacuole and possibly in balancing ion homeostasis; homolog of human CLN3 involved in Batten disease (juvenile onset neuronal ceroid lipofuscinosis) Putative protein of unknown function; member of the Dal5p subfamily of the major facilitator family Subunit alpha of assimilatory sulfite reductase, which converts sulfite into sulfide Bisphosphate‐3'‐nucleotidase, involved in salt tolerance and methionine biogenesis; dephosphorylates 3'‐phosphoadenosine‐5'‐
phosphate and 3'‐phosphoadenosine‐5'‐phosphosulfate, intermediates of the sulfate assimilation pathway Nuclear protein that plays a role in the function of the Smc5p‐
Rhc18p complex Protein with similarity to hect domain E3 ubiquitin‐protein ligases, not essential for viability Putative benzil reductase;(GFP)‐fusion protein localizes to the cytoplasm and is induced by the DNA‐damaging agent MMS; sequence similarity with short‐chain dehydrogenase/reductases; null mutant has increased spontaneous Rad52p foci Putative protein of unknown function; identified by gene‐trapping, microarray‐based expression analysis, and genome‐wide homology searching Glycogen synthase with similarity to Gsy2p, the more highly expressed yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary phase Mitochondrial tryptophanyl‐tRNA synthetase
‐0.9385 0.0408
‐0.9243 0.0205
‐0.9228 0.0366
‐0.8925 0.0293
‐0.8915 0.0205
‐0.8869 0.0301
‐0.8845 0.0215
‐0.8792 0.0205
‐0.8737 0.0293
‐0.8731 0.0301
‐0.8700 0.0288
‐0.8694 0.0252
‐0.8661 0.0288
‐0.8641 0.0207
‐0.8601 0.0171
Subunit of a heterodimeric NC2 transcription regulator complex with Ncb2p; complex binds to TBP and can repress transcription by preventing preinitiation complex assembly or stimulate activated transcription; homologous to human NC2alpha Putative protein of unknown function; green fluorescent protein 124
Symbols ORF MET17 YLR303W ECM11 YDR446W PHO80 YOL001W FMN1 YDR236C CIR2 YOR356W HOR2 YER062C MET5 YJR137C PIG1 YLR273C NA YFR017C RRF1 YHR038W RDL2 YOR286W BNA3 YJL060W XYL2 YLR070C NA YDL218W CWC15 YDR163W PAU18 YLL064C LYS5 YGL154C log2 (mtr10[P
f/NP.f]/
WT[Pf/N
P.f]) Description adj.p.val (GFP)‐fusion protein localizes to the cytoplasm
Methionine and cysteine synthase (O‐acetyl homoserine‐O‐acetyl serine sulfhydrylase), required for sulfur amino acid synthesis Non‐essential protein apparently involved in meiosis, GFP fusion protein is present in discrete clusters in the nucleus throughout mitosis; may be involved in maintaining chromatin structure Cyclin, interacts with cyclin‐dependent kinase Pho85p; regulates the response to nutrient levels and environmental conditions, including the response to phosphate limitation and stress‐dependent calcium signaling Riboflavin kinase, phosphorylates riboflavin to form riboflavin monophosphate (FMN), which is a necessary cofactor for many enzymes; localizes to microsomes and to the mitochondrial inner membrane Putative ortholog of human electron transfer flavoprotein dehydrogenase (ETF‐dH); found in a large supramolecular complex with other mitochondrial dehydrogenases; may have a role in oxidative stress response One of two redundant DL‐glycerol‐3‐phosphatases (RHR2/GPP1 encodes the other) involved in glycerol biosynthesis; induced in response to hyperosmotic stress and oxidative stress, and during the diauxic transition Sulfite reductase beta subunit, involved in amino acid biosynthesis, transcription repressed by methionine Putative targeting subunit for the type‐1 protein phosphatase Glc7p that tethers it to the Gsy2p glycogen synthase Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and is induced in response to the DNA‐damaging agent MMS; YFR017C is not an essential gene Mitochondrial ribosome recycling factor, essential for mitochondrial protein synthesis and for the maintenance of the respiratory function of mitochondria Protein with rhodanese activity; contains a rhodanese‐like domain similar to Rdl1p, Uba4p, Tum1p, and Ych1p; overexpression causes a cell cycle delay; null mutant displays elevated frequency of mitochondrial genome loss Kynurenine aminotransferase, catalyzes formation of kynurenic acid from kynurenine; potential Cdc28p substrate Xylitol dehydrogenase, converts xylitol to D‐xylulose; expression induced by xylose, even though this pentose sugar is not well utilized by S. cerevisiae; null mutant has cell wall defect Putative protein of unknown function; YDL218W transcription is regulated by Azf1p and induced by starvation and aerobic conditions; expression also induced in cells treated with the mycotoxin patulin Non‐essential protein involved in pre‐mRNA splicing, component of a complex containing Cef1p; has similarity to S. pombe Cwf15p Protein of unknown function, member of the seripauperin multigene family encoded mainly in subtelomeric regions; identical to Pau6p Phosphopantetheinyl transferase involved in lysine biosynthesis; converts inactive apo‐form of Lys2p (alpha‐aminoadipate reductase) into catalytically active holo‐form by posttranslational addition of phosphopantetheine 125
‐0.8522 0.0205
‐0.8511 0.0293
‐0.8458 0.0439
‐0.8445 0.0281
‐0.8429 0.0216
‐0.8370 0.0248
‐0.8342 0.0295
‐0.8249 0.0248
‐0.8211 0.0416
‐0.8157 0.0366
‐0.8092 0.0354
‐0.8022 0.0301
‐0.7997 0.0437
‐0.7966 0.0366
‐0.7961 0.0301
‐0.7936 0.0408
‐0.7917 0.0293
log2 (mtr10[P
f/NP.f]/
WT[Pf/N
P.f]) Symbols ORF Description HBN1 YCL026C‐B APQ12 YIL040W OSH6 YKR003W NA YGL117W Putative protein of unknown function; similar to bacterial nitroreductases; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; protein becomes insoluble upon intracellular iron depletion Protein required for nuclear envelope morphology, nuclear pore complex localization, mRNA export from the nucleus; exhibits synthetic lethal genetic interactions with genes involved in lipid metabolism Member of an oxysterol‐binding protein family with overlapping, redundant functions in sterol metabolism and which collectively perform a function essential for viability; GFP‐fusion protein localizes to the cell periphery Putative protein of unknown function
MSK1 YNL073W YSW1 YBR148W RSM18 YER050C ODC2 YOR222W PYK2 YOR347C MGT1 YDL200C NA YGL185C SHC1 YER096W MAM33 YIL070C RTR2 YDR066C AIM45 YPR004C SAM37 YMR060C VPS30 YPL120W Mitochondrial lysine‐tRNA synthetase, required for import of both aminoacylated and deacylated forms of tRNA(Lys) into mitochondria and for aminoacylation of mitochondrially encoded tRNA(Lys) Protein required for normal prospore membrane formation; interacts with Gip1p, which is the meiosis‐specific regulatory subunit of the Glc7p protein phosphatase; expressed specifically in spores and localizes to the prospore membrane Mitochondrial ribosomal protein of the small subunit, has similarity to E. coli S18 ribosomal protein Mitochondrial inner membrane transporter, exports 2‐oxoadipate and 2‐oxoglutarate from the mitochondrial matrix to the cytosol for use in lysine and glutamate biosynthesis and in lysine catabolism Pyruvate kinase that appears to be modulated by phosphorylation; PYK2 transcription is repressed by glucose, and Pyk2p may be active under low glycolytic flux DNA repair methyltransferase (6‐O‐methylguanine‐DNA methylase) involved in protection against DNA alkylation damage Putative protein with sequence similarity to hydroxyacid dehydrogenases; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm Sporulation‐specific activator of Chs3p (chitin synthase III), required for the synthesis of the chitosan layer of ascospores; has similarity to Skt5p, which activates Chs3p during vegetative growth; transcriptionally induced at alkaline pH Acidic protein of the mitochondrial matrix involved in oxidative phosphorylation; related to the human complement receptor gC1q‐
R Protein of unknown function with high similarity to Rtr1p; exhibits genetic interactions with Rtr1p; green fluorescent protein (GFP)‐
fusion protein localizes to the cytoplasm; YDR066C is not an essential gene Putative ortholog of mammalian electron transfer flavoprotein
complex subunit ETF‐alpha; interacts with frataxin, Yfh1p; null mutant displays elevated frequency of mitochondrial genome loss; may have a role in oxidative stress response Component of the Sorting and Assembly Machinery (SAM or TOB complex) of the mitochondrial outer membrane, which binds precursors of beta‐barrel proteins and facilitates their outer membrane insertion; contributes to SAM complex stability Subunit of phosphatidylinositol (PtdIns) 3‐kinase complexes I and II; Complex I is essential in autophagy and Complex II is required for vacuolar protein sorting; ortholog of the higher eukaryotic gene Beclin 1 126
adj.p.val ‐0.7903 0.0454
‐0.7753 0.0293
‐0.7748 0.0301
‐0.7739 0.0256
‐0.7704 0.0301
‐0.7665 0.0301
‐0.7607 0.0478
‐0.7406 0.0293
‐0.7392 0.0408
‐0.7329 0.0301
‐0.7248 0.0400
‐0.7160 0.0365
‐0.7148 0.0301
‐0.6954 0.0437
‐0.6932 0.0293
‐0.6908 0.0478
‐0.6876 0.0293
log2 (mtr10[P
f/NP.f]/
WT[Pf/N
P.f]) Symbols ORF Description NA YLR031W Putative protein of unknown function
‐0.6863 0.0326
YSC84 YHR016C ‐0.6811 0.0324
BDH1 YAL060W ‐0.6753 0.0431
IME1 YJR094C ‐0.6740 0.0431
JEN1 YKL217W ‐0.6735 0.0449
NA YDR248C ‐0.6716 0.0416
LEU4 YNL104C ‐0.6661 0.0330
CLD1 YGR110W ‐0.6656 0.0482
RSB1 YOR049C ‐0.6587 0.0454
TMT1 YER175C ‐0.6578 0.0358
COQ4 YDR204W ‐0.6484 0.0416
SPS19 YNL202W ‐0.6481 0.0425
NA YDR336W ‐0.6439 0.0301
TUM1 YOR251C ‐0.6330 0.0366
NA YHR112C ‐0.6309 0.0416
AIM20 YIL158W Actin‐binding protein involved in bundling of actin filaments and endocytosis of actin cortical patches; activity stimulated by Las17p; contains SH3 domain similar to Rvs167p NAD‐dependent (R,R)‐butanediol dehydrogenase, catalyzes oxidation of (R,R)‐2,3‐butanediol to (3R)‐acetoin, oxidation of meso‐
butanediol to (3S)‐acetoin, and reduction of acetoin; enhances use of 2,3‐butanediol as an aerobic carbon source Master regulator of meiosis that is active only during meiotic events, activates transcription of early meiotic genes through interaction with Ume6p, degraded by the 26S proteasome following phosphorylation by Ime2p Lactate transporter, required for uptake of lactate and pyruvate; phosphorylated; expression is derepressed by transcriptional activator Cat8p during respiratory growth, and repressed in the presence of glucose, fructose, and mannose Putative protein of unknown function; sequence similarity to bacterial and human gluconokinase; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; upregulated by deletion of the RNAP‐II associated factor, PAF1 Alpha‐isopropylmalate synthase (2‐isopropylmalate synthase); the main isozyme responsible for the first step in the leucine biosynthesis pathway Mitochondrial cardiolipin‐specific phospholipase; functions upstream of Taz1p to generate monolyso‐cardiolipin; transcription increases upon genotoxic stress; involved in restricting Ty1 transposition; has homology to mammalian CGI‐58 Suppressor of sphingoid long chain base (LCB) sensitivity of an LCB‐
lyase mutation; putative integral membrane transporter or flippase that may transport LCBs from the cytoplasmic side toward the extracytoplasmic side of the membrane Trans‐aconitate methyltransferase, cytosolic enzyme that catalyzes the methyl esterification of 3‐isopropylmalate, an intermediate of the leucine biosynthetic pathway, and trans‐aconitate, which inhibits the citric acid cycle Protein with a role in ubiquinone (Coenzyme Q) biosynthesis, possibly functioning in stabilization of Coq7p; located on the matrix face of the mitochondrial inner membrane; component of a mitochondrial ubiquinone‐synthesizing complex Peroxisomal 2,4‐dienoyl‐CoA reductase, auxiliary enzyme of fatty acid beta‐oxidation; homodimeric enzyme required for growth and sporulation on petroselineate medium; expression induced during late sporulation and in the presence of oleate Putative protein of unknown function; sumoylated under stress conditions in a genome wide study; YDR336W is not an essential gene Rhodanese domain sulfur transferase, accepts persulfite from Nfs1p and transfers it to Uba4p in the pathway for 2‐thiolation of the wobble uridine base of tRNAs; also stimulates sulfur transfer by Nfs1p; may be mitochondrially localized Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm Putative protein of unknown function; overexpression causes a cell cycle delay or arrest; green fluorescent protein (GFP)‐fusion protein localizes to the vacuole; null mutant displays elevated frequency of mitochondrial genome loss ‐0.6267 0.0408
127
adj.p.val log2 (mtr10[P
f/NP.f]/
WT[Pf/N
P.f]) Symbols ORF Description SWD3 YBR175W SNX41 YDR425W STB2 YMR053C NA YMR315W DCG1 YIR030C ARG5,6 YER069W HAP3 YBL021C YCT1 YLL055W NA YLR352W NA YNL193W MET13 YGL125W ARG1 YOL058W TNA1 YGR260W Essential subunit of the COMPASS (Set1C) complex, which methylates histone H3 on lysine 4 and is required in transcriptional silencing near telomeres; WD40 beta propeller superfamily member and ortholog of mammalian WDR5 Sorting nexin, involved in the retrieval of late‐Golgi SNAREs from the post‐Golgi endosome to the trans‐Golgi network; interacts with Snx4p Protein that interacts with Sin3p in a two‐hybrid assay and is part of a large protein complex with Sin3p and Stb1p Protein with NADP(H) oxidoreductase activity; transcription is regulated by Stb5p in response to NADPH depletion induced by diamide; promoter contains a putative Stb5p binding site Protein of unknown function, expression is sensitive to nitrogen catabolite repression and regulated by Dal80p; contains transmembrane domain Protein that is processed in the mitochondrion to yield acetylglutamate kinase and N‐acetyl‐gamma‐glutamyl‐phosphate reductase, which catalyze the 2nd and 3rd steps in arginine biosynthesis; enzymes form a complex with Arg2p Subunit of the heme‐activated, glucose‐repressed Hap2p/3p/4p/5p CCAAT‐binding complex, a transcriptional activator and global regulator of respiratory gene expression; contains sequences contributing to both complex assembly and DNA binding High‐affinity cysteine‐specific transporter with similarity to the Dal5p family of transporters; green fluorescent protein (GFP)‐fusion protein localizes to the endoplasmic reticulum; YCT1 is not an essential gene Putative protein of unknown function with similarity to F‐box proteins; interacts with Skp1p and Cdc53p; YLR352W is not an essential gene Putative protein of unknown function; exhibits a two‐hybrid interaction with Yhr151cp in a large‐scale analysis Major isozyme of methylenetetrahydrofolate reductase, catalyzes the reduction of 5,10‐methylenetetrahydrofolate to 5‐
methyltetrahydrofolate in the methionine biosynthesis pathway Arginosuccinate synthetase, catalyzes the formation of L‐
argininosuccinate from citrulline and L‐aspartate in the arginine biosynthesis pathway; potential Cdc28p substrate High affinity nicotinic acid plasma membrane permease, responsible for uptake of low levels of nicotinic acid; expression of the gene increases in the absence of extracellular nicotinic acid or para‐
aminobenzoate (PABA) 128
adj.p.val ‐0.6238 0.0366
‐0.6154 0.0393
‐0.6085 0.0419
‐0.6063 0.0424
‐0.6057 0.0449
‐0.5991 0.0424
‐0.5909 0.0459
‐0.5853 0.0400
‐0.5850 0.0493
‐0.5735 0.0493
‐0.5689 0.0459
‐0.5550 0.0493
‐0.5346 0.0460
APPENDIX C: Transcripts with increased
translation activity index in fed mtr10Δ cells
The transcripts with decreased P/NP ratio (cutoff condition: log2 FC
0.6 and adjusted
p-value 0.05) in mtr10Δ cells while compared to wild-type cells in fed condition are
listed below and ordered according to log2 (fold-change).
Transcripts with increased P/NP ratio in fed mtr10Δ cells.
Symbols ORF Description log2 (mtr10[Pf/N
P.f]/WT[Pf/
NP.f]) AFFX‐
18srRnac_a
t NA NA 2.9412 0.0267
AFFX‐r2‐Sc‐
18SrRNA‐
3_at NA NA 2.9310 0.0454
NA YHL012W Putative protein of unknown function, has some homology to Ugp1p, which encodes UDP‐glucose pyrophosphorylase 1.6485 0.0171
NA YBR238C Mitochondrial membrane protein with similarity to Rmd9p; not required for respiratory growth but causes a synthetic respiratory defect in combination with rmd9 mutations; transcriptionally up‐
regulated by TOR; deletion increases life span 1.3591 0.0403
YAP7 YOL028C Putative basic leucine zipper (bZIP) transcription factor
1.2656 0.0276
KAP123 YER110C Karyopherin beta, mediates nuclear import of ribosomal proteins prior to assembly into ribosomes and import of histones H3 and H4; localizes to the nuclear pore, nucleus, and cytoplasm; exhibits genetic interactions with RAI1 1.2417 0.0293
KAP95 YLR347C Karyopherin beta, forms a complex with Srp1p/Kap60p; interacts with nucleoporins to mediate nuclear import of NLS‐containing cargo proteins via the nuclear pore complex; regulates PC biosynthesis; GDP‐to‐GTP exchange factor for Gsp1p 1.2363 0.0346
ACC1 YNR016C Acetyl‐CoA carboxylase, biotin containing enzyme that catalyzes the carboxylation of acetyl‐CoA to form malonyl‐CoA; required for de novo biosynthesis of long‐chain fatty acids 1.2323 0.0171
129
adj.p.v
al log2 (mtr10[Pf/N
P.f]/WT[Pf/
NP.f]) adj.p.v
al Symbols ORF Description SSA3 YBL075C ATPase involved in protein folding and the response to stress; plays a role in SRP‐dependent cotranslational protein‐membrane targeting and translocation; member of the heat shock protein 70 (HSP70) family; localized to the cytoplasm 1.1830 0.0431
CDC34 YDR054C Ubiquitin‐conjugating enzyme (E2) and catalytic subunit of SCF ubiquitin‐protein ligase complex (together with Skp1p, Rbx1p, Cdc53p, and an F‐box protein) that regulates cell cycle progression by targeting key substrates for degradation 1.1211 0.0293
RNR1 YER070W Major isoform of the large subunit of ribonucleotide‐diphosphate reductase; the RNR complex catalyzes rate‐limiting step in dNTP synthesis, regulated by DNA replication and DNA damage checkpoint pathways via localization of small subunits 1.1207 0.0205
AFFX‐r2‐Sc‐
SRB4‐5_at NA NA 1.1078 0.0302
NA Putative protein of unknown function
1.0989 0.0171
NUP192 YMR230W‐
A YJL039C Essential structural subunit of the nuclear pore complex (NPC), localizes to the nuclear periphery of nuclear pores, homologous to human p205 1.0915 0.0319
DRS2 YAL026C Aminophospholipid translocase (flippase) that maintains membrane lipid asymmetry in post‐Golgi secretory vesicles; contributes to clathrin‐coated vesicle formation and endocytosis; mutations in human homolog ATP8B1 result in liver disease 1.0772 0.0416
TIF4632 YGL049C Translation initiation factor eIF4G, subunit of the mRNA cap‐
binding protein complex (eIF4F) that also contains eIF4E (Cdc33p); associates with the poly(A)‐binding protein Pab1p, also interacts with eIF4A (Tif1p); homologous to Tif4631p 1.0711 0.0293
GSC2 YGR032W Catalytic subunit of 1,3‐beta‐glucan synthase, involved in formation of the inner layer of the spore wall; activity positively regulated by Rho1p and negatively by Smk1p; has similarity to an alternate catalytic subunit, Fks1p (Gsc1p) 1.0557 0.0496
MPT5 YGL178W Member of the Puf family of RNA‐binding proteins; binds to mRNAs encoding chromatin modifiers and spindle pole body components; involved in longevity, maintenance of cell wall integrity, and sensitivity to and recovery from pheromone arrest 1.0514 0.0301
NA YNL247W Cysteinyl‐tRNA synthetase; may interact with ribosomes, based on co‐purification experiments 1.0468 0.0293
SRP40 YKR092C Nucleolar, serine‐rich protein with a role in preribosome assembly or transport; may function as a chaperone of small nucleolar ribonucleoprotein particles (snoRNPs); immunologically and structurally to rat Nopp140 1.0348 0.0288
CDC60 YPL160W Cytosolic leucyl tRNA synthetase, ligates leucine to the appropriate tRNA 1.0205 0.0301
CHC1 YGL206C Clathrin heavy chain, subunit of the major coat protein involved in intracellular protein transport and endocytosis; two heavy chains form the clathrin triskelion structural component; the light chain (CLC1) is thought to regulate function 1.0150 0.0403
RPB2 YOR151C RNA polymerase II second largest subunit B150, part of central core; similar to bacterial beta subunit 1.0088 0.0301
130
log2 (mtr10[Pf/N
P.f]/WT[Pf/
NP.f]) adj.p.v
al Symbols ORF Description TCB3 YML072C Lipid‐binding protein, localized to the bud via specific mRNA transport; non‐tagged protein detected in a phosphorylated state in mitochondria; GFP‐fusion protein localizes to the cell periphery; C‐termini of Tcb1p, Tcb2p and Tcb3p interact 1.0075 0.0416
NA YGR054W 0.9970 0.0326
PMA1 YGL008C Eukaryotic initiation factor (eIF) 2A; associates specifically with both 40S subunits and 80 S ribosomes, and interacts genetically with both eIF5b and eIF4E; homologous to mammalian eIF2A Plasma membrane H+‐ATPase, pumps protons out of the cell; major regulator of cytoplasmic pH and plasma membrane potential; part of the P2 subgroup of cation‐transporting ATPases; Hsp30p plays a role in Pma1p regulation 0.9908 0.0377
SFC1 YJR095W Mitochondrial succinate‐fumarate transporter, transports succinate into and fumarate out of the mitochondrion; required for ethanol and acetate utilization 0.9668 0.0293
DED1 YOR204W 0.9665 0.0410
NA YBR056W‐A ATP‐dependent DEAD (Asp‐Glu‐Ala‐Asp)‐box RNA helicase, required for translation initiation of all yeast mRNAs; mutations in human DEAD‐box DBY are a frequent cause of male infertility Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the dubious ORF YBR056C‐B 0.9631 0.0330
NA YHR210C Putative protein of unknown function; non‐essential gene; highly expressed under anaeorbic conditions; sequence similarity to aldose 1‐epimerases such as GAL10 0.9419 0.0171
COS7 YDL248W Protein of unknown function, member of the DUP380 subfamily of conserved, often subtelomerically‐encoded proteins; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies 0.9406 0.0459
PIR3 YKL163W 0.9395 0.0248
JLP1 YLL057C 0.9375 0.0205
FAA4 YMR246W 0.9120 0.0459
NOT3 YIL038C O‐glycosylated covalently‐bound cell wall protein required for cell wall stability; expression is cell cycle regulated, peaking in M/G1 and also subject to regulation by the cell integrity pathway Fe(II)‐dependent sulfonate/alpha‐ketoglutarate dioxygenase, involved in sulfonate catabolism for use as a sulfur source; contains sequence that resembles a J domain (typified by the E. coli DnaJ protein); induced by sulphur starvation Long chain fatty acyl‐CoA synthetase, activates imported fatty acids with a preference for C12:0‐C16:0 chain lengths; functions in long chain fatty acid import; important for survival during stationary phase; localized to lipid particles Subunit of the CCR4‐NOT complex, which is a global transcriptional regulator with roles in transcription initiation and elongation and in mRNA degradation 0.9069 0.0366
CRM1 YGR218W Major karyopherin, involved in export of proteins, RNAs, and ribosomal subunits from the nucleus; exportin 0.8817 0.0464
NA YBL095W Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies 0.8798 0.0295
FLC3 YGL139W Putative FAD transporter, similar to Flc1p and Flc2p; localized to the ER 0.8766 0.0215
TRA1 YHR099W Subunit of SAGA and NuA4 histone acetyltransferase complexes; interacts with acidic activators (e.g., Gal4p) which leads to transcription activation; similar to human TRRAP, which is a cofactor for c‐Myc mediated oncogenic transformation 0.8766 0.0488
131
log2 (mtr10[Pf/N
P.f]/WT[Pf/
NP.f]) adj.p.v
al Symbols ORF Description NUM1 YDR150W Protein required for nuclear migration, localizes to the mother cell cortex and the bud tip; may mediate interactions of dynein and cytoplasmic microtubules with the cell cortex 0.8647 0.0454
NA YBR196C‐B Putative protein of unknown function; identified by expression profiling and mass spectrometry 0.8608 0.0293
AAD6 YFL056C Putative aryl‐alcohol dehydrogenase with similarity to P. chrysosporium aryl‐alcohol dehydrogenase, involved in the oxidative stress response; expression induced in cells treated with the mycotoxin patulin 0.8545 0.0312
DCP2 YNL118C 0.8334 0.0459
PRP16 YKR086W 0.8202 0.0308
NA YMR102C Catalytic subunit of the Dcp1p‐Dcp2p decapping enzyme complex, which removes the 5' cap structure from mRNAs prior to their degradation; member of the Nudix hydrolase family RNA helicase in the DEAH‐box family involved in the second catalytic step of splicing, exhibits ATP‐dependent RNA unwinding activity Protein of unknown function; transcription is activated by paralogous transcription factors Yrm1p and Yrr1p along with genes involved in multidrug resistance; mutant shows increased resistance to azoles; YMR102C is not an essential gene 0.8193 0.0408
PDH1 YPR002W 0.8185 0.0426
AFFX‐
YER022w5_
at NA Mitochondrial protein that participates in respiration, induced by diauxic shift; homologous to E. coli PrpD, may take part in the conversion of 2‐methylcitrate to 2‐methylisocitrate NA 0.8087 0.0288
MCM7 YBR202W Component of the hexameric MCM complex, which is important for priming origins of DNA replication in G1 and becomes an active ATP‐dependent helicase that promotes DNA melting and elongation when activated by Cdc7p‐Dbf4p in S‐phase 0.8077 0.0366
SAC1 YKL212W Phosphatidylinositol phosphate (PtdInsP) phosphatase involved in hydrolysis of PtdIns[4]P; transmembrane protein localizes to ER and Golgi; involved in protein trafficking and processing, secretion, and cell wall maintenance 0.8050 0.0291
VIP1 YLR410W Inositol hexakisphosphate (IP6) and inositol heptakisphosphate (IP7) kinase; IP7 production is important for phosphate signaling; involved in cortical actin cytoskeleton function, and invasive pseudohyphal growth analogous to S. pombe asp1 0.7931 0.0366
IRC7 YFR055W Putative cystathionine beta‐lyase; involved in copper ion homeostasis and sulfur metabolism; null mutant displays increased levels of spontaneous Rad52p foci; expression induced by nitrogen limitation in a GLN3, GAT1‐dependent manner 0.7880 0.0437
IRR1 YIL026C Subunit of the cohesin complex, which is required for sister chromatid cohesion during mitosis and meiosis and interacts with centromeres and chromosome arms, essential for viability 0.7801 0.0288
RTS1 YOR014W B‐type regulatory subunit of protein phosphatase 2A (PP2A); homolog of the mammalian B' subunit of PP2A 0.7654 0.0301
MCM1 YMR043W Transcription factor involved in cell‐type‐specific transcription and pheromone response; plays a central role in the formation of both repressor and activator complexes 0.7526 0.0488
RPN2 YIL075C Subunit of the 26S proteasome, substrate of the N‐
acetyltransferase Nat1p 0.7460 0.0349
132
log2 (mtr10[Pf/N
P.f]/WT[Pf/
NP.f]) adj.p.v
al Symbols ORF Description SMI1 YGR229C Protein involved in the regulation of cell wall synthesis; proposed to be involved in coordinating cell cycle progression with cell wall integrity 0.7433 0.0301
DIA1 YMR316W Protein of unknown function, involved in invasive and pseudohyphal growth; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern 0.7421 0.0454
GFA1 YKL104C Glutamine‐fructose‐6‐phosphate amidotransferase, catalyzes the formation of glucosamine‐6‐P and glutamate from fructose‐6‐P and glutamine in the first step of chitin biosynthesis 0.7396 0.0254
TCB1 YOR086C Lipid‐binding protein containing three calcium and lipid binding domains; non‐tagged protein localizes to mitochondria and GFP‐
fusion protein localizes to the cell periphery; C‐termini of Tcb1p, Tcb2p and Tcb3p interact 0.7338 0.0293
UFD2 YDL190C Ubiquitin chain assembly factor (E4) that cooperates with a ubiquitin‐activating enzyme (E1), a ubiquitin‐conjugating enzyme (E2), and a ubiquitin protein ligase (E3) to conjugate ubiquitin to substrates; also functions as an E3 0.7338 0.0293
NDD1 YOR372C Transcriptional activator essential for nuclear division; localized to the nucleus; essential component of the mechanism that activates the expression of a set of late‐S‐phase‐specific genes 0.7332 0.0252
SIC1 YLR079W Inhibitor of Cdc28‐Clb kinase complexes that controls G1/S phase transition, preventing premature S phase and ensuring genomic integrity; phosphorylation targets Sic1p for SCF(CDC4)‐dependent turnover; functional homolog of mammalian Kip1 0.7241 0.0459
SEC27 YGL137W Essential beta'‐coat protein of the COPI coatomer, involved in ER‐
to‐Golgi and Golgi‐to‐ER transport; contains WD40 domains that mediate cargo selective interactions; 45% sequence identity to mammalian beta'‐COP 0.7130 0.0437
SIS2 YKR072C Negative regulatory subunit of protein phosphatase 1 Ppz1p and also a subunit of the phosphopantothenoylcysteine decarboxylase (PPCDC; Cab3p, Sis2p, Vhs3p) complex, which catalyzes the third step of coenzyme A biosynthesis 0.7129 0.0326
RAD51 YER095W Strand exchange protein, forms a helical filament with DNA that searches for homology; involved in the recombinational repair of double‐strand breaks in DNA during vegetative growth and meiosis; homolog of Dmc1p and bacterial RecA protein 0.7101 0.0301
LHS1 YKL073W Molecular chaperone of the endoplasmic reticulum lumen, involved in polypeptide translocation and folding; nucleotide exchange factor for the ER lumenal Hsp70 chaperone Kar2p; regulated by the unfolded protein response pathway 0.7092 0.0288
MSN4 YKL062W Transcriptional activator related to Msn2p; activated in stress conditions, which results in translocation from the cytoplasm to the nucleus; binds DNA at stress response elements of responsive genes, inducing gene expression 0.7027 0.0326
ADE2 YOR128C Phosphoribosylaminoimidazole carboxylase, catalyzes a step in the 'de novo' purine nucleotide biosynthetic pathway; red pigment accumulates in mutant cells deprived of adenine 0.7018 0.0454
133
log2 (mtr10[Pf/N
P.f]/WT[Pf/
NP.f]) adj.p.v
al Symbols ORF Description STP1 YDR463W Transcription factor, undergoes proteolytic processing by SPS (Ssy1p‐Ptr3p‐Ssy5p)‐sensor component Ssy5p in response to extracellular amino acids; activates transcription of amino acid permease genes and may have a role in tRNA processing 0.7012 0.0454
ACS2 YLR153C Acetyl‐coA synthetase isoform which, along with Acs1p, is the nuclear source of acetyl‐coA for histone acetylation; mutants affect global transcription; required for growth on glucose; expressed under anaerobic conditions 0.6811 0.0368
NUP133 YKR082W 0.6787 0.0464
MNN5 YJL186W 0.6765 0.0366
PSD2 YGR170W Subunit of the Nup84p subcomplex of the nuclear pore complex (NPC), localizes to both sides of the NPC, required to establish a normal nucleocytoplasmic concentration gradient of the GTPase Gsp1p Alpha‐1,2‐mannosyltransferase, responsible for addition of the second alpha‐1,2‐linked mannose of the branches on the mannan backbone of oligosaccharides, localizes to an early Golgi compartment Phosphatidylserine decarboxylase of the Golgi and vacuolar membranes, converts phosphatidylserine to phosphatidylethanolamine 0.6765 0.0384
JJJ2 YJL162C Protein of unknown function, contains a J‐domain, which is a region with homology to the E. coli DnaJ protein 0.6749 0.0431
RIO2 YNL207W Essential serine kinase involved in the processing of the 20S pre‐
rRNA into mature 18S rRNA; has similarity to Rio1p 0.6679 0.0408
MUD1 YBR119W U1 snRNP A protein, homolog of human U1‐A; involved in nuclear mRNA splicing 0.6666 0.0301
CDC20 YGL116W 0.6666 0.0301
RFC4 YOL094C Cell‐cycle regulated activator of anaphase‐promoting complex/cyclosome (APC/C), which is required for metaphase/anaphase transition; directs ubiquitination of mitotic cyclins, Pds1p, and other anaphase inhibitors; potential Cdc28p substrate Subunit of heteropentameric Replication factor C (RF‐C), which is a DNA binding protein and ATPase that acts as a clamp loader of the proliferating cell nuclear antigen (PCNA) processivity factor for DNA polymerases delta and epsilon 0.6648 0.0301
TFA1 YKL028W TFIIE large subunit, involved in recruitment of RNA polymerase II to the promoter, activation of TFIIH, and promoter opening 0.6596 0.0459
YPT32 YGL210W Rab family GTPase, very similar to Ypt31p; involved in the exocytic pathway; mediates intra‐Golgi traffic or the budding of post‐Golgi vesicles from the trans‐Golgi 0.6574 0.0301
NA YGL140C Putative protein of unknown function; non‐essential gene; contains multiple predicted transmembrane domains 0.6567 0.0454
ARO9 YHR137W Aromatic aminotransferase II, catalyzes the first step of tryptophan, phenylalanine, and tyrosine catabolism 0.6498 0.0431
PFK27 YOL136C 6‐phosphofructo‐2‐kinase, catalyzes synthesis of fructose‐2,6‐
bisphosphate; inhibited by phosphoenolpyruvate and sn‐glycerol 3‐
phosphate, expression induced by glucose and sucrose, transcriptional regulation involves protein kinase A 0.6479 0.0330
TPD3 YAL016W Regulatory subunit A of the heterotrimeric protein phosphatase 2A (PP2A), which also contains regulatory subunit Cdc55p and either catalytic subunit Pph21p or Pph22p; required for cell morphogenesis and transcription by RNA polymerase III 0.6442 0.0400
134
log2 (mtr10[Pf/N
P.f]/WT[Pf/
NP.f]) adj.p.v
al Symbols ORF Description REB1 YBR049C RNA polymerase I enhancer binding protein; DNA binding protein which binds to genes transcribed by both RNA polymerase I and RNA polymerase II; required for termination of RNA polymerase I transcription 0.6403 0.0431
SMP1 YBR182C Putative transcription factor involved in regulating the response to osmotic stress; member of the MADS‐box family of transcription factors 0.6394 0.0485
NUP145 YGL092W Essential nucleoporin, catalyzes its own cleavage in vivo to generate a C‐terminal fragment that assembles into the Nup84p subcomplex of the nuclear pore complex, and an N‐terminal fragment of unknown function that is homologous to Nup100p 0.6392 0.0431
KES1 YPL145C Member of the oxysterol binding protein family, which includes seven yeast homologs; involved in negative regulation of Sec14p‐
dependent Golgi complex secretory functions, peripheral membrane protein that localizes to the Golgi complex 0.6191 0.0478
MNN2 YBR015C Alpha‐1,2‐mannosyltransferase, responsible for addition of the first alpha‐1,2‐linked mannose to form the branches on the mannan backbone of oligosaccharides, localizes to an early Golgi compartment 0.5941 0.0459
NA YOL098C Putative metalloprotease
0.5910 0.0459
CDC55 YGL190C Non‐essential regulatory subunit B of protein phosphatase 2A (PP2A), which has multiple roles in mitosis and protein biosynthesis; involved in regulation of mitotic exit; found in the nucleus of most cells, also at bud neck and bud tip 0.5698 0.0459
CDC3 YLR314C Component of the septin ring of the mother‐bud neck that is required for cytokinesis; septins recruit proteins to the neck and can act as a barrier to diffusion at the membrane, and they comprise the 10nm filaments seen with EM 0.5571 0.0458
ARO7 YPR060C Chorismate mutase, catalyzes the conversion of chorismate to prephenate to initiate the tyrosine/phenylalanine‐specific branch of aromatic amino acid biosynthesis 0.5515 0.0454
135
APPENDIX D: Transcripts with changed
translation activity index in mtr10Δ cells in amino
acid starvation condition
This section includes the transcripts with decreased P/NP ratio (cutoff condition: log2 FC
0.6 and adjusted p-value 0.05) and the transcripts with increase P/NP ratio (log2
FC
0.6 and adjusted p-value 0.05) in mtr10Δ cells while compared to wild-type cells
in amino acid starvation condition. The affected transcripts are ordered according to log2
(fold-change).
Transcripts with decreased P/NP ratio in amino acid starved mtr10Δ cells.
log2 (mtr10[Ps/
NP.s]/WT[
Ps/NP.s]) adj.p.
val Symbols ORF Description AAD14 YNL331C Putative aryl‐alcohol dehydrogenase with similarity to P. chrysosporium aryl‐alcohol dehydrogenase; mutational analysis has not yet revealed a physiological role ‐1.9155 0.0302
AMS1 YGL156W Vacuolar alpha mannosidase, involved in free oligosaccharide (fOS) degradation; delivered to the vacuole in a novel pathway separate from the secretory pathway ‐1.1781 0.0479
CIR2 YOR356W Putative ortholog of human electron transfer flavoprotein dehydrogenase (ETF‐dH); found in a large supramolecular complex with other mitochondrial dehydrogenases; may have a role in oxidative stress response ‐1.0468 0.0479
NSE4 YDL105W Nuclear protein that plays a role in the function of the Smc5p‐Rhc18p complex ‐1.0143 0.0479
FLO9 YAL063C Lectin‐like protein with similarity to Flo1p, thought to be expressed and involved in flocculation ‐0.9790 0.0479
136
Transcripts with increased P/NP ratio in amino acid starved mtr10Δ cells.
log2 (mtr10[Ps/
NP.s]/WT[
Ps/NP.s]) adj.P.V
al symbols ORF Description NA YLR154W‐E Dubious open reading frame unlikely to encode a protein; encoded within the the 35S rRNA gene on the opposite strand 2.6224 0.0302
NA YHL012W Putative protein of unknown function, has some homology to Ugp1p, which encodes UDP‐glucose pyrophosphorylase 1.8017 0.0479
137
APPENDIX E: Transcripts with decreased
translation activity index in fed msn5Δ cells
The transcripts with decreased P/NP ratio (cutoff condition: log2 FC
0.6 and
adjusted p-value 0.05) in msn5Δ cells while compared to wild-type cells in fed
condition are listed below and ordered according to log2 (fold-change).
Transcripts with decreased P/NP ratio in fed msn5Δ cells.
log2 (msn5[Pf/
NP.f]/WT[
Pf/NP.f]) adj.p.
val Symbols ORF Description STR3 YGL184C ‐2.6447 0.0099
MSN5 YDR335W ‐2.5962 0.0205
SUL1 YBR294W ‐2.4354 0.0239
SEO1 YAL067C Peroxisomal cystathionine beta‐lyase, converts cystathionine into homocysteine; may be redox regulated by Gto1p Karyopherin involved in nuclear import and export of proteins, including import of replication protein A and export of Swi6p, Far1p, and Pho4p; required for re‐export of mature tRNAs after their retrograde import from the cytoplasm High affinity sulfate permease; sulfate uptake is mediated by specific sulfate transporters Sul1p and Sul2p, which control the concentration of endogenous activated sulfate intermediates Putative permease, member of the allantoate transporter subfamily of the major facilitator superfamily; mutation confers resistance to ethionine sulfoxide ‐1.8658 0.0099
ARG3 YJL088W Ornithine carbamoyltransferase (carbamoylphosphate:L‐ornithine carbamoyltransferase), catalyzes the sixth step in the biosynthesis of the arginine precursor ornithine ‐1.6423 0.0246
MMP1 YLL061W High‐affinity S‐methylmethionine permease, required for utilization of S‐methylmethionine as a sulfur source; has similarity to S‐
adenosylmethionine permease Sam3p ‐1.5790 0.0099
MET3 YJR010W ATP sulfurylase, catalyzes the primary step of intracellular sulfate activation, essential for assimilatory reduction of sulfate to sulfide, involved in methionine metabolism ‐1.4117 0.0246
MHT1 YLL062C S‐methylmethionine‐homocysteine methyltransferase, functions along with Sam4p in the conversion of S‐adenosylmethionine (AdoMet) to methionine to control the methionine/AdoMet ratio ‐1.3841 0.0239
138
PRM1 YNL279W Pheromone‐regulated multispanning membrane protein involved in membrane fusion during mating; predicted to have 5 transmembrane segments and a coiled coil domain; localizes to the shmoo tip; regulated by Ste12p 139
‐1.0819 0.0291
APPENDIX F: Summary tables of functional
catalogue analysis for affected transcripts in
mtr10Δ cells in fed or amino acid starvation
conditions
This section includes four summary results of functional catalogue (FunCat) analysis of
transcriptionally differentially expressed genes (cutoff conditions: log2 FC
FC
0.6 or log2
0.6 and adjusted p-value < 0.001) in mtr10Δ cells in fed or amino acid starvation
conditions. The FunCat analysis was executed in the website: http://mips.helmholtzmuenchen.de/proj/funcatDB/ (Ruepp et al., 2004)
Table F. 1. FunCat analysis of down-regulated transcripts in mtr10Δ cells in fed
condition.
FUNCTIONAL CATALOGUE METABOLISM lipid, fatty acid and isoprenoid metabolism
membrane lipid metabolism phospholipid metabolism modification with fatty acids (e.g. myristylation, palmitylation, farnesylation)
thiamine pyrophosphate binding
transported compounds (substrates)
ion transport cation transport (H+, Na+, K+, Ca2+ , NH4+, etc.)
heavy metal ion transport (Cu+, Fe3+, etc.)
siderophore‐iron transport
lipid/fatty acid transport nucleotide/nucleoside/nucleobase transport
140
numbers
of gene
matches
65 22 8 7 4 1 32 11 8 6 3 6 4 p-value
0.003177
8.86E‐05
0.004182
0.005404
0.019417
0.031648
0.001356
0.007357
0.038983
0.006192
0.005559
0.002408
0.003164
continued.
Table F. 1. continued.
numbers
of gene
matches
3 8 13 5 7 FUNCTIONAL CATALOGUE vitamine/cofactor transport drug/toxin transport transport facilities transport ATPases ABC transporters p-value
0.008779
2.31E‐05
0.008971
0.027214
1.92E‐05
Table F. 2. FunCat analysis of up-regulated transcripts in mtr10Δ cells in fed condition.
FUNCTIONAL CATALOGUE metabolism of lysine biosynthesis of lysine aminoadipic acid pathway degradation of lysine metabolism of phenylalanine nitrogen, sulfur and selenium metabolism
nitrogen metabolism catabolism of nitrogenous compounds
purin nucleotide/nucleoside/nucleobase metabolism
purine nucleotide /nucleoside/nucleobase catabolism
purine nucleotide/nucleoside/nucleobase anabolism
electron transport and membrane‐associated energy conservation
aerobic respiration fermentation lactate fermentation DNA repair mRNA processing (splicing, 5'‐, 3'‐end processing)
modification by ubiquitin‐related proteins
transmembrane signal transduction
detoxification involving cytochrome P450
chemoperception and response pheromone response, mating‐type determination, sex‐specific proteins
CELL TYPE DIFFERENTIATION fungal/microorganismic cell type differentiation
fungal and other eukaryotic cell type differentiation
development of asco‐ basidio‐ or zygospore
UNCLASSIFIED PROTEINS 141
numbers
of gene
matches
4 4 4 2 4 11 3 3 10 2 5 7 10 6 2 17 16 4 7 2 20 17 35 35 35 21 81 p-value
0.009055
0.001352
0.000847
0.026075
0.011347
0.014891
0.00464
0.00464
0.00141
0.00841
0.018126
0.044798
0.00799
0.039273
0.01622
0.005148
0.0429
0.024079
0.007529
0.01622
0.034217
0.025928
0.018017
0.018017
0.018017
0.000228
0.236462
Table F. 3. FunCat analysis of down-regulated transcripts in mtr10Δ cells in amino acid
starved condition.
FUNCTIONAL CATALOGUE METABOLISM phosphate metabolism C‐compound and carbohydrate metabolism
sugar, glucoside, polyol and carboxylate anabolism
polysaccharide metabolism
glycogen metabolism glycogen anabolism lipid, fatty acid and isoprenoid metabolism
catabolism of vitamins, cofactors, and prosthetic groups
metabolism of secondary products derived from primary amino acids
metabolism of nonprotein amino acids
metabolism of energy reserves (e.g. glycogen, trehalose)
oxidation of fatty acids transcription activation modification with sugar residues (e.g. glycosylation, deglycosylation)
CELLULAR TRANSPORT, TRANSPORT FACILITIES AND TRANSPORT ROUTES
transported compounds (substrates)
ion transport cation transport (H+, Na+, K+, Ca2+ , NH4+, etc.)
heavy metal ion transport (Cu+, Fe3+, etc.)
siderophore‐iron transport
C‐compound and carbohydrate transport
amino acid/amino acid derivatives transport
amine / polyamine transport
lipid/fatty acid transport nucleotide/nucleoside/nucleobase transport
allantoin and allantoate transport
vitamine/cofactor transport
drug/toxin transport transport facilities channel / pore class transport
carrier (electrochemical potential‐driven transport)
symporter proton driven symporter
ABC transporters peroxisomal transport MAPKKK cascade osmotic and salt stress response disease, virulence and defense resistance proteins chemical agent resistance detoxification INTERACTION WITH THE ENVIRONMENT
142
numbers
of gene
matches
167 49 58 7 12 4 4 47 2 5 4 10 3 8 65 11 121 88 29 22 15 6 12 14 4 11 8 3 4 15 43 4 5 2 2 15 5 6 10 7 7 7 21 p-value
0.0013
0.032306
0.030207
0.034247
0.0124
0.000307
0.000307
3.05E‐05
0.022994
0.02366
0.008902
0.026663
0.040793
0.031922
0.043824
0.001018
4.71E‐07
5.08E‐05
0.001191
4.41E‐05
0.000305
0.009692
2.45E‐05
0.024365
0.001436
0.0002
0.029111
0.031735
5.87E‐07
2.17E‐08
0.04027
0.018793
0.043248
0.022994
2.25E‐09
0.02366
0.030374
0.036928
0.034247
0.025432
0.012719
0.001624
0.000276
continued
Table. F.3. continued.
FUNCTIONAL CATALOGUE homeostasis homeostasis of cations homeostasis of metal ions (Na, K, Ca etc.)
UNCLASSIFIED PROTEINS numbers
of gene
matches
64 29 26 20 p-value
0.001681
0.002586
0.000386
0.208561
Table F. 4. FunCat analysis of up-regulated transcripts in mtr10Δ cells in amino acid
starved condition.
numbers
of gene
matches
2 140 73 20 36 29 28 26 91 60 25 10 25 24 6 13 4 12 9 3 30 25 145 27 6 29 23 FUNCTIONAL CATALOGUE degradation of arginine CELL CYCLE AND DNA PROCESSING
DNA processing DNA synthesis and replication
DNA recombination and DNA repair
DNA repair DNA restriction or modification
DNA conformation modification (e.g. chromatin)
cell cycle mitotic cell cycle and cell cycle control
mitotic cell cycle M phase meiosis nuclear and chromosomal cycle
chromosome condensation
chromosome segregation/division
nuclear division cell cycle dependent cytoskeleton reorganization
spindle pole body/centrosome and microtubule cycle
cell cycle dependent actin filament reorganization
mRNA processing (splicing, 5'‐, 3'‐end processing)
splicing PROTEIN FATE (folding, modification, destination)
protein folding and stabilization
modification by ubiquitin‐related proteins
cytoplasmic and nuclear protein degradation
proteasomal degradation (ubiquitin/proteasomal pathway)
PROTEIN WITH BINDING FUNCTION OR COFACTOR REQUIREMENT (structural or catalytic) 137 protein binding 67 2 amino acid/amino acid derivatives binding
143
p-value
0.026315
1.88E‐06
0.000536
0.042889
0.010629
0.000556
0.027059
0.036794
0.000135
0.004847
0.01546
0.022457
0.011516
0.000119
0.01559
0.003567
0.016547
0.001971
0.017142
0.023532
0.003396
0.001982
0.000223
9.87E‐08
0.012322
0.007476
0.002473
5.55E‐05 1.66E‐06
0.026315
continued.
Table. F. 4. continued.
FUNCTIONAL CATALOGUE magnesium binding protease activator nuclear transport
unfolded protein response (e.g. ER quality control)
cellular sensing and response to external stimulus
chemoperception and response
pheromone response, mating‐type determination, sex‐specific proteins BIOGENESIS OF CELLULAR COMPONENTS
cytoskeleton/structural proteins
microtubule cytoskeleton UNCLASSIFIED PROTEINS 144
numbers
of gene
matches
2 2 14 15 37 34 0.049269
0.009375
0.032722
0.002077
0.03647
0.014459
26 102 37 11 139 0.0412 0.014298
0.006243
0.004383
0.356087
p-value
APPENDIX G: Down-regulated genes in mtr10Δ
cells in fed condition
This section includes the list of transcriptionally differentially expressed genes (cutoff
conditions: log2 FC
0.6 and adjusted p-value < 0.001) in mtr10Δ cells in fed
condition.
Down-regulated genes in mtr10Δ cells in fed condition
log2(mtr10
.Tf/WT.Tf) Symbols ORF Description MTR10 YOR160W Nuclear import receptor, mediates the nuclear localization of proteins involved in mRNA‐nucleus export; promotes dissociation of mRNAs from the nucleus‐cytoplasm mRNA shuttling protein Npl3p; required for retrograde import of mature tRNAs ‐7.0599 0.0000
QDR2 YIL121W Multidrug transporter of the major facilitator superfamily, required for resistance to quinidine, barban, cisplatin, and bleomycin; may have a role in potassium uptake ‐4.0758 0.0000
FCY21 YER060W ‐3.1458 0.0000
BDH2 YAL061W Putative purine‐cytosine permease, very similar to Fcy2p but cannot substitute for its function Putative medium‐chain alcohol dehydrogenase with similarity to BDH1; transcription induced by constitutively active PDR1 and PDR3 ‐2.7008 0.0001
PNS1 YOR161C ‐2.4530 0.0000
NA NA FIT3 NA NA YOR383C Protein of unknown function; has similarity to Torpedo californica tCTL1p, which is postulated to be a choline transporter, neither null mutation nor overexpression affects choline transport NA NA Mannoprotein that is incorporated into the cell wall via a glycosylphosphatidylinositol (GPI) anchor, involved in the retention of siderophore‐iron in the cell wall ‐2.1966 ‐1.9974 ‐1.9076 0.0002
0.0001
0.0003
RGS2 YOR107W Negative regulator of glucose‐induced cAMP signaling; directly activates the GTPase activity of the heterotrimeric G protein alpha subunit Gpa2p ‐1.8591 0.0000
GTO3 YMR251W Omega class glutathione transferase; putative cytosolic localization ‐1.8261 0.0005
TPO4 YOR273C Polyamine transport protein, recognizes spermine, putrescine, and spermidine; localizes to the plasma membrane; member of the major facilitator superfamily ‐1.7975 0.0000
145
adj.p.val log2(mtr10
.Tf/WT.Tf) Symbols ORF Description HOR2 YER062C One of two redundant DL‐glycerol‐3‐phosphatases (RHR2/GPP1 encodes the other) involved in glycerol biosynthesis; induced in response to hyperosmotic stress and oxidative stress, and during the diauxic transition ‐1.6977 0.0002
HOP1 YIL072W Meiosis‐specific DNA binding protein that displays Red1p dependent localization to the unsynapsed axial‐lateral elements of the synaptonemal complex; required for homologous chromosome synapsis and chiasma formation ‐1.6539 0.0007
ICS2 YBR157C Protein of unknown function; null mutation does not confer any obvious defects in growth, spore germination, viability, or carbohydrate utilization ‐1.6524 0.0002
ARN2 YHL047C ‐1.6499 0.0006
FMP48 YGR052W Transporter, member of the ARN family of transporters that specifically recognize siderophore‐iron chelates; responsible for uptake of iron bound to the siderophore triacetylfusarinine C Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies; induced by treatment with 8‐methoxypsoralen and UVA irradiation ‐1.6387 0.0004
FIT2 YOR382W Mannoprotein that is incorporated into the cell wall via a glycosylphosphatidylinositol (GPI) anchor, involved in the retention of siderophore‐iron in the cell wall ‐1.6293 0.0009
RSB1 YOR049C Suppressor of sphingoid long chain base (LCB) sensitivity of an LCB‐
lyase mutation; putative integral membrane transporter or flippase that may transport LCBs from the cytoplasmic side toward the extracytoplasmic side of the membrane ‐1.5722 0.0003
ERC1 YHR032W Member of the multi‐drug and toxin extrusion (MATE) family of the multidrug/oligosaccharidyl‐lipid/polysaccharide (MOP) exporter superfamily; overproduction confers ethionine resistance and accumulation of S‐adenosylmethionine ‐1.5321 0.0002
NA YCR061W Protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern; induced by treatment with 8‐methoxypsoralen and UVA irradiation ‐1.5255 0.0003
SAP4 YGL229C ‐1.5182 0.0001
SFK1 YKL051W Protein required for function of the Sit4p protein phosphatase, member of a family of similar proteins that form complexes with Sit4p, including Sap155p, Sap185p, and Sap190p Plasma membrane protein that may act together with or upstream of Stt4p to generate normal levels of the essential phospholipid PI4P, at least partially mediates proper localization of Stt4p to the plasma membrane ‐1.5072 0.0000
NA YHR022C ‐1.4996 0.0001
THO1 YER063W Putative protein of unknown function; YHR022C is not an essential gene Conserved nuclear RNA‐binding protein; specifically binds to transcribed chromatin in a THO‐ and RNA‐dependent manner, genetically interacts with shuttling hnRNP NAB2; overproduction suppresses transcriptional defect caused by hpr1 mutation ‐1.4748 0.0001
ARN1 YHL040C Transporter, member of the ARN family of transporters that specifically recognize siderophore‐iron chelates; responsible for uptake of iron bound to ferrirubin, ferrirhodin, and related siderophores ‐1.4686 0.0002
NA TYE7 YHR140W YOR344C Putative integral membrane protein of unknown function
Serine‐rich protein that contains a basic‐helix‐loop‐helix (bHLH) DNA binding motif; binds E‐boxes of glycolytic genes and contributes to their activation; may function as a transcriptional activator in Ty1‐
mediated gene expression ‐1.4314 ‐1.4233 0.0002
0.0003
146
adj.p.val log2(mtr10
.Tf/WT.Tf) Symbols ORF Description NA YOR152C TDH1 YJL052W Putative protein of unknown function; has no similarity to any known protein; YOR152C is not an essential gene Glyceraldehyde‐3‐phosphate dehydrogenase, isozyme 1, involved in glycolysis and gluconeogenesis; tetramer that catalyzes the reaction of glyceraldehyde‐3‐phosphate to 1,3 bis‐phosphoglycerate; detected in the cytoplasm and cell wall YRO2 YBR054W PRY1 PDR3 adj.p.val ‐1.4142 0.0001
‐1.3912 0.0003
Putative protein of unknown function; the authentic, non‐tagged protein is detected in a phosphorylated state in highly purified mitochondria in high‐throughput studies; transcriptionally regulated by Haa1p ‐1.3897 0.0004
YJL079C YBL005W Protein of unknown function
Transcriptional activator of the pleiotropic drug resistance network, regulates expression of ATP‐binding cassette (ABC) transporters through binding to cis‐acting sites known as PDREs (PDR responsive elements) ‐1.3703 ‐1.3401 0.0000
0.0002
NA RPS14B NA YJL191W NA Ribosomal protein 59 of the small subunit, required for ribosome assembly and 20S pre‐rRNA processing; mutations confer cryptopleurine resistance; nearly identical to Rps14Ap and similar to E. coli S11 and rat S14 ribosomal proteins ‐1.3381 ‐1.3157 0.0003
0.0002
TIR1 YER011W Cell wall mannoprotein of the Srp1p/Tip1p family of serine‐alanine‐
rich proteins; expression is downregulated at acidic pH and induced by cold shock and anaerobiosis; abundance is increased in cells cultured without shaking ‐1.3027 0.0001
PGM2 YMR105C ‐1.3001 0.0004
NA DSE1 YAR066W YER124C Phosphoglucomutase, catalyzes the conversion from glucose‐1‐
phosphate to glucose‐6‐phosphate, which is a key step in hexose metabolism; functions as the acceptor for a Glc‐phosphotransferase Putative GPI protein
Daughter cell‐specific protein, may regulate cross‐talk between the mating and filamentation pathways; deletion affects cell separation after division and sensitivity to alpha‐factor and drugs affecting the cell wall ‐1.2845 ‐1.2744 0.0002
0.0006
AAR2 YBL074C ‐1.2717 0.0002
NA IRC15 NA YPL017C Component of the U5 snRNP, required for splicing of U3 precursors; originally described as a splicing factor specifically required for splicing pre‐mRNA of the MATa1 cistron NA Microtubule associated protein; regulates microtubule dynamics; required for accurate meiotic chromosome segregation; null mutant displays large budded cells due to delayed mitotic progression, increased levels of spontaneous Rad52 foci ‐1.2710 ‐1.2560 0.0003
0.0004
NA YLR126C Putative protein of unknown function with similarity to glutamine amidotransferase proteins; has Aft1p‐binding motif in the promoter; may be involved in copper and iron homeostasis; YLR126C is not an essential protein ‐1.2482 0.0004
ENO1 YGR254W Enolase I, a phosphopyruvate hydratase that catalyzes the conversion of 2‐phosphoglycerate to phosphoenolpyruvate during glycolysis and the reverse reaction during gluconeogenesis; expression is repressed in response to glucose ‐1.2413 0.0002
ENB1 YOL158C Endosomal ferric enterobactin transporter, expressed under conditions of iron deprivation; member of the major facilitator superfamily; expression is regulated by Rcs1p and affected by chloroquine treatment ‐1.2397 0.0004
FCY22 YER060W‐
A Putative purine‐cytosine permease, very similar to Fcy2p but cannot substitute for its function ‐1.2287 0.0006
147
log2(mtr10
.Tf/WT.Tf) Symbols ORF Description SPS19 YNL202W Peroxisomal 2,4‐dienoyl‐CoA reductase, auxiliary enzyme of fatty acid beta‐oxidation; homodimeric enzyme required for growth and sporulation on petroselineate medium; expression induced during late sporulation and in the presence of oleate ‐1.2265 0.0004
SHE4 YOR035C Protein containing a UCS (UNC‐45/CRO1/SHE4) domain, binds to myosin motor domains to regulate myosin function; involved in endocytosis, polarization of the actin cytoskeleton, and asymmetric mRNA localization ‐1.2201 0.0001
VMR1 YHL035C Vacuolar membrane protein involved in multiple drug resistance and metal sensitivity; ATP‐binding cassette (ABC) family member involved in drug transport; potential Cdc28p substrate; induced under respiratory conditions ‐1.2097 0.0001
TPK1 YJL164C cAMP‐dependent protein kinase catalytic subunit; promotes vegetative growth in response to nutrients via the Ras‐cAMP signaling pathway; inhibited by regulatory subunit Bcy1p in the absence of cAMP; partially redundant with Tpk2p and Tpk3p ‐1.1856 0.0004
PDR5 YOR153W Plasma membrane ATP‐binding cassette (ABC) transporter, multidrug transporter actively regulated by Pdr1p; also involved in steroid transport, cation resistance, and cellular detoxification during exponential growth ‐1.1815 0.0002
PLB2 YMR006C ‐1.1746 0.0003
KRE5 YOR336W Phospholipase B (lysophospholipase) involved in phospholipid metabolism; displays transacylase activity in vitro; overproduction confers resistance to lysophosphatidylcholine Protein required for beta‐1,6 glucan biosynthesis; mutations result in aberrant morphology and severe growth defects ‐1.1615 0.0001
RPS28B YLR264W ‐1.1388 0.0004
SMF1 YOL122C ‐1.1302 0.0003
PDR15 YDR406W Protein component of the small (40S) ribosomal subunit; nearly identical to Rps28Ap and has similarity to rat S28 ribosomal protein Divalent metal ion transporter with a broad specificity for di‐valent and tri‐valent metals; post‐translationally regulated by levels of metal ions; member of the Nramp family of metal transport proteins Plasma membrane ATP binding cassette (ABC) transporter, multidrug transporter and general stress response factor implicated in cellular detoxification; regulated by Pdr1p, Pdr3p and Pdr8p; promoter contains a PDR responsive element ‐1.1257 0.0002
NA YPR172W ‐1.1220 0.0004
SKN1 YGR143W ‐1.1034 0.0003
MDS3 YGL197W Protein of unknown function, transcriptionally activated by Yrm1p along with genes involved in multidrug resistance Protein involved in sphingolipid biosynthesis; type II membrane protein with similarity to Kre6p Putative component of the TOR regulatory pathway; negative regulator of early meiotic gene expression; required, with Pmd1p, for growth under alkaline conditions; has an N‐terminal kelch‐like domain ‐1.0982 0.0010
COA4 YLR218C Twin Cx(9)C protein involved in cytochrome c oxidase assembly or stability; localizes to the mitochondrial intermembrane space via the Mia40p‐Erv1p system; interacts genetically with CYC1 and with cytochrome c oxidase assembly factors ‐1.0981 0.0001
URA1 YKL216W Dihydroorotate dehydrogenase, catalyzes the fourth enzymatic step in the de novo biosynthesis of pyrimidines, converting dihydroorotic acid into orotic acid ‐1.0842 0.0005
ULA1 YPL003W Protein that acts together with Uba3p to activate Rub1p before its conjugation to proteins (neddylation), which may play a role in protein degradation ‐1.0828 0.0007
148
adj.p.val log2(mtr10
.Tf/WT.Tf) Symbols ORF Description NA YMR102C Protein of unknown function; transcription is activated by paralogous transcription factors Yrm1p and Yrr1p along with genes involved in multidrug resistance; mutant shows increased resistance to azoles; YMR102C is not an essential gene ‐1.0802 0.0002
NA YNL040W Putative protein of unknown function with strong similarity to alanyl‐tRNA synthases from Eubacteria; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; YNL040W is not an essential gene ‐1.0736 0.0004
RPL18B YNL301C ‐1.0700 0.0009
YPC1 YBR183W ‐1.0673 0.0003
PXA1 YPL147W Protein component of the large (60S) ribosomal subunit, identical to Rpl18Ap and has similarity to rat L18 ribosomal protein Alkaline ceramidase that also has reverse (CoA‐independent) ceramide synthase activity, catalyzes both breakdown and synthesis of phytoceramide; overexpression confers fumonisin B1 resistance Subunit of a heterodimeric peroxisomal ATP‐binding cassette transporter complex (Pxa1p‐Pxa2p), required for import of long‐
chain fatty acids into peroxisomes; similarity to human adrenoleukodystrophy transporter and ALD‐related proteins ‐1.0534 0.0005
GPD1 YDL022W ‐1.0485 0.0008
NA YHR131C ‐1.0441 0.0005
TCA17 YEL048C ‐1.0432 0.0006
NA NA YBL029W YHL044W NAD‐dependent glycerol‐3‐phosphate dehydrogenase, key enzyme of glycerol synthesis, essential for growth under osmotic stress; expression regulated by high‐osmolarity glycerol response pathway; homolog of Gpd2p Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; overexpression causes a cell cycle delay or arrest Protein that interacts with subunits of the TRAPP complex and may play a role its assembly or stability; mutation is synthetically lethal with gcs1 deletion; Sedlin_N family member; human Sedlin mutations cause the skeletal disorder SEDT Non‐essential protein of unknown function
Putative integral membrane protein, member of DUP240 gene family; green fluorescent protein (GFP)‐fusion protein localizes to the plasma membrane in a punctate pattern ‐1.0329 ‐1.0264 0.0004
0.0007
COX11 YPL132W ‐1.0067 0.0003
NPP1 YCR026C ‐1.0040 0.0007
PPT2 YPL148C Mitochondrial inner membrane protein required for delivery of copper to the Cox1p subunit of cytochrome c oxidase; association with mitochondrial ribosomes suggests that copper delivery may occur during translation of Cox1p Nucleotide pyrophosphatase/phosphodiesterase family member; mediates extracellular nucleotide phosphate hydrolysis along with Npp2p and Pho5p; activity and expression enhanced during conditions of phosphate starvation Phosphopantetheine:protein transferase (PPTase), activates mitochondrial acyl carrier protein (Acp1p) by phosphopantetheinylation ‐0.9971 0.0002
PET111 YMR257C ‐0.9938 0.0003
FAA3 YIL009W Mitochondrial translational activator specific for the COX2 mRNA; located in the mitochondrial inner membrane Long chain fatty acyl‐CoA synthetase, activates imported fatty acids; green fluorescent protein (GFP)‐fusion protein localizes to the cell periphery ‐0.9862 0.0002
PCI8 YIL071C Possible shared subunit of Cop9 signalosome (CSN) and eIF3, binds eIF3b subunit Prt1p, has possible dual functions in transcriptional and translational control, contains a PCI (Proteasome‐COP9 signalosome (CSN)‐eIF3) domain ‐0.9855 0.0006
SCW11 YGL028C Cell wall protein with similarity to glucanases; may play a role in conjugation during mating based on its regulation by Ste12p ‐0.9825 0.0003
149
adj.p.val log2(mtr10
.Tf/WT.Tf) Symbols ORF Description RDS2 YPL133C Transcription factor involved in regulating gluconeogenesis and glyoxylate cycle genes; member of the zinc cluster family of proteins; confers resistance to ketoconazole ‐0.9706 0.0004
NA YNL234W Protein of unknown function with similarity to globins; has a functional heme‐binding domain; mutant has aneuploidy tolerance; transcription induced by stress conditions; may be involved in glucose signaling or metabolism; regulated by Rgt1 ‐0.9686 0.0010
NA YIL151C ‐0.9617 0.0005
AIM41 YOR215C Putative protein of unknown function, predicted to contain a PINc domain Putative protein of unknown function; the authentic protein is detected in highly purified mitochondria in high‐throughput studies; null mutant displays reduced frequency of mitochondrial genome loss ‐0.9591 0.0005
PCL6 YER059W Pho85p cyclin of the Pho80p subfamily; forms the major Glc8p kinase together with Pcl7p and Pho85p; involved in the control of glycogen storage by Pho85p; stabilized by Elongin C binding ‐0.9587 0.0004
YPK9 YOR291W Vacuolar protein with a possible role in sequestering heavy metals; has similarity to the type V P‐type ATPase Spf1p; homolog of human ATP13A2 (PARK9), mutations in which are associated with Parkinson disease and Kufor‐Rakeb syndrome ‐0.9567 0.0002
NA YGR122W Probable ortholog of A. nidulans PalC, which is involved in pH regulation and binds to the ESCRT‐III complex; null mutant does not properly process Rim101p and has decreased resistance to rapamycin; GFP‐fusion protein is cytoplasmic ‐0.9528 0.0004
BNA5 YLR231C ‐0.9440 0.0005
MNN1 YER001W Kynureninase, required for the de novo biosynthesis of NAD from tryptophan via kynurenine; expression regulated by Hst1p Alpha‐1,3‐mannosyltransferase, integral membrane glycoprotein of the Golgi complex, required for addition of alpha1,3‐mannose linkages to N‐linked and O‐linked oligosaccharides, one of five S. cerevisiae proteins of the MNN1 family ‐0.9379 0.0004
VPS62 YGR141W ‐0.9327 0.0005
CMC4 YMR194C‐
B ‐0.9317 0.0008
CMK1 YFR014C Calmodulin‐dependent protein kinase; may play a role in stress response, many CA++/calmodulan dependent phosphorylation substrates demonstrated in vitro, amino acid sequence similar to Cmk2p and mammalian Cam Kinase II ‐0.9263 0.0004
RRN10 YBL025W ‐0.9259 0.0003
MRF1 YGL143C Protein involved in promoting high level transcription of rDNA, subunit of UAF (upstream activation factor) for RNA polymerase I Mitochondrial translation release factor, involved in stop codon recognition and hydrolysis of the peptidyl‐tRNA bond during mitochondrial translation; lack of MRF1 causes mitochondrial genome instability ‐0.9250 0.0003
NA YOR292C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the vacuole; YOR292C is not an essential gene ‐0.9242 0.0002
NA YPR147C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and is induced in response to the DNA‐damaging agent MMS ‐0.9219 0.0002
Vacuolar protein sorting (VPS) protein required for cytoplasm to vacuole targeting of proteins Protein that localizes to the mitochondrial intermembrane space via the Mia40p‐Erv1p system; contains twin cysteine‐x(9)‐cysteine motifs 150
adj.p.val log2(mtr10
.Tf/WT.Tf) Symbols ORF Description adj.p.val NA YBL095W Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies ‐0.9141 0.0002
COX10 YPL172C ‐0.9025 0.0005
LAG1 YHL003C ‐0.9025 0.0005
PSY2 YNL201C Heme A:farnesyltransferase, catalyzes the first step in the conversion of protoheme to the heme A prosthetic group required for cytochrome c oxidase activity; human ortholog is associated with mitochondrial disorders Ceramide synthase component, involved in synthesis of ceramide from C26(acyl)‐coenzyme A and dihydrosphingosine or phytosphingosine, functionally equivalent to Lac1p Putative subunit of an evolutionarily conserved protein phosphatase complex containing the catalytic subunit Pph3p and the regulatory subunit Psy4p; required for cisplatin and oxaliplatin resistance; putative homolog of mammalian R3 ‐0.9007 0.0003
CPS1 YJL172W Vacuolar carboxypeptidase yscS; expression is induced under low‐
nitrogen conditions Putative S‐adenosylmethionine‐dependent methyltransferase
‐0.8991 0.0010
‐0.8976 0.0002
Phosphoesterase involved in downregulation of the unfolded protein response, at least in part via dephosphorylation of Ire1p; dosage‐
dependent positive regulator of the G1/S phase transition through control of the timing of START Choline kinase, catalyzing the first step in phosphatidylcholine synthesis via the CDP‐choline (Kennedy pathway); exhibits some ethanolamine kinase activity contributing to phosphatidylethanolamine synthesis via the CDP‐ethanolamine pathway Putative protein of unknown function, has some homology to Ugp1p, which encodes UDP‐glucose pyrophosphorylase Putative protein of unknown function; expression repressed in carbon limited vs carbon replete chemostat cultures; YJR030C is a non‐essential gene ‐0.8970 0.0009
‐0.8898 0.0004
‐0.8837 0.0004
‐0.8808 0.0003
NA YLR137W DCR2 YLR361C CKI1 YLR133W NA YHL012W NA YJR030C RTT105 YGK3 YER104W YOL128C Protein with a role in regulation of Ty1 transposition
Protein kinase related to mammalian glycogen synthase kinases of the GSK‐3 family; GSK‐3 homologs (Mck1p, Rim11p, Mrk1p, Ygk3p) are involved in control of Msn2p‐dependent transcription of stress responsive genes and in protein degradation ‐0.8801 ‐0.8783 0.0009
0.0007
NA YMR262W ‐0.8782 0.0005
AIM22 YJL046W ‐0.8759 0.0003
NA AFT2 YLR031W YPL202C ‐0.8722 ‐0.8697 0.0004
0.0002
ARI1 YGL157W Protein of unknown function; interacts weakly with Knr4p; YMR262W is not an essential gene Putative lipoate‐protein ligase, required along with Lip2 and Lip5 for lipoylation of Lat1p and Kgd2p; similar to E. coli LplA; null mutant displays reduced frequency of mitochondrial genome loss Putative protein of unknown function
Iron‐regulated transcriptional activator; activates genes involved in intracellular iron use and required for iron homeostasis and resistance to oxidative stress; similar to Aft1p NADPH‐dependent aldehyde reductase, utilizes aromatic and alophatic aldehyde substrates; member of the short‐chain dehydrogenase/reductase superfamily ‐0.8694 0.0003
SPI1 YER150W ‐0.8671 0.0006
SMF3 YLR034C GPI‐anchored cell wall protein involved in weak acid resistance; basal expression requires Msn2p/Msn4p; expression is induced under conditions of stress and during the diauxic shift; similar to Sed1p Putative divalent metal ion transporter involved in iron homeostasis; transcriptionally regulated by metal ions; member of the Nramp family of metal transport proteins ‐0.8656 0.0005
NA YPR013C ‐0.8648 0.0002
Putative zinc finger protein; YPR013C is not an essential gene
151
log2(mtr10
.Tf/WT.Tf) Symbols ORF Description YOR1 YGR281W Plasma membrane ATP‐binding cassette (ABC) transporter, multidrug transporter mediates export of many different organic anions including oligomycin; similar to human cystic fibrosis transmembrane receptor (CFTR) ‐0.8613 0.0002
NA YER130C ‐0.8566 0.0004
ELO1 YJL196C Protein of unknown function; transcription is regulated by Haa1p, Sok2p and Zap1p transcriptional activators; the C. Albicans homolog (MNL1) plays a role in adaptation to stress Elongase I, medium‐chain acyl elongase, catalyzes carboxy‐terminal elongation of unsaturated C12‐C16 fatty acyl‐CoAs to C16‐C18 fatty acids ‐0.8537 0.0002
MSF1 YPR047W Mitochondrial phenylalanyl‐tRNA synthetase, active as a monomer, unlike the cytoplasmic subunit which is active as a dimer complexed to a beta subunit dimer; similar to the alpha subunit of E. coli phenylalanyl‐tRNA synthetase ‐0.8411 0.0003
TRZ1 YKR079C ‐0.8386 0.0004
NA YKR070W tRNA 3'‐end processing endonuclease tRNase Z; also localized to mitochondria and interacts genetically with Rex2 exonuclease; homolog of the human candidate prostate cancer susceptibility gene ELAC2 Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies ‐0.8352 0.0009
SPT14 YPL175W UDP‐GlcNAc‐binding and catalytic subunit of the enzyme that mediates the first step in glycosylphosphatidylinositol (GPI) biosynthesis, mutations cause defects in transcription and in biogenesis of cell wall proteins ‐0.8336 0.0005
NA YGL140C ‐0.8322 0.0002
OCT1 YKL134C Putative protein of unknown function; non‐essential gene; contains multiple predicted transmembrane domains Mitochondrial intermediate peptidase, cleaves N‐terminal residues of a subset of proteins upon import, after their cleavage by mitochondrial processing peptidase (Mas1p‐Mas2p); may contribute to mitochondrial iron homeostasis ‐0.8304 0.0005
FLX1 YIL134W ‐0.8250 0.0010
NMA1 YLR328W ‐0.8160 0.0002
RMR1 YGL250W ‐0.8142 0.0004
BUR2 YLR226W Cyclin for the Sgv1p (Bur1p) protein kinase; Sgv1p and Bur2p comprise a CDK‐cyclin complex involved in transcriptional regulation through its phosphorylation of the carboxy‐terminal domain of the largest subunit of RNA polymerase II ‐0.8083 0.0002
TOR1 YJR066W PIK‐related protein kinase and rapamycin target; subunit of TORC1, a complex that controls growth in response to nutrients by regulating translation, transcription, ribosome biogenesis, nutrient transport and autophagy; involved in meiosis ‐0.8081 0.0008
RIM15 YFL033C Glucose‐repressible protein kinase involved in signal transduction during cell proliferation in response to nutrients, specifically the establishment of stationary phase; identified as a regulator of IME2; substrate of Pho80p‐Pho85p kinase ‐0.8070 0.0007
RTC4 YNL254C Protein of unknown function; null mutation suppresses cdc13‐1 temperature sensitivity; (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus ‐0.7990 0.0006
Protein required for transport of flavin adenine dinucleotide (FAD), a synthesis product of riboflavin, across the mitochondrial membrane Nicotinic acid mononucleotide adenylyltransferase, involved in pathways of NAD biosynthesis, including the de novo, NAD(+) salvage, and nicotinamide riboside salvage pathways Protein required for meiotic recombination and gene conversion; null mutant displays reduced PIS1 expression and growth defects on non‐fermentable carbon sources and minimal media; GFP‐fusion protein localizes to both cytoplasm and nucleus 152
adj.p.val log2(mtr10
.Tf/WT.Tf) Symbols ORF Description UBR2 YLR024C ‐0.7978 0.0009
POL12 YBL035C ‐0.7921 0.0004
RIB4 YOL143C ‐0.7916 0.0002
GPI12 YMR281W Cytoplasmic ubiquitin‐protein ligase (E3); required for ubiquitylation of Rpn4p; mediates formation of a Mub1p‐Ubr2p‐Rad6p complex B subunit of DNA polymerase alpha‐primase complex, required for initiation of DNA replication during mitotic and premeiotic DNA synthesis; also functions in telomere capping and length regulation Lumazine synthase (6,7‐dimethyl‐8‐ribityllumazine synthase, also known as DMRL synthase); catalyzes synthesis of immediate precursor to riboflavin ER membrane protein involved in the second step of glycosylphosphatidylinositol (GPI) anchor assembly, the de‐N‐
acetylation of the N‐acetylglucosaminylphosphatidylinositol intermediate; functional homolog of human PIG‐Lp ‐0.7909 0.0009
RIM2 YBR192W ‐0.7889 0.0004
RPL8A YHL033C ‐0.7880 0.0005
MGA1 YGR249W Mitochondrial pyrimidine nucleotide transporter; imports pyrimidine nucleoside triphosphates and exports pyrimidine nucleoside monophosphates; member of the mitochondrial carrier family Ribosomal protein L4 of the large (60S) ribosomal subunit, nearly identical to Rpl8Bp and has similarity to rat L7a ribosomal protein; mutation results in decreased amounts of free 60S subunits Protein similar to heat shock transcription factor; multicopy suppressor of pseudohyphal growth defects of ammonium permease mutants ‐0.7877 0.0008
MDM32 YOR147W ‐0.7823 0.0006
RAD16 YBR114W Mitochondrial inner membrane protein with similarity to Mdm31p, required for normal mitochondrial morphology and inheritance; interacts genetically with MMM1, MDM10, MDM12, and MDM34 Protein that recognizes and binds damaged DNA in an ATP‐
dependent manner (with Rad7p) during nucleotide excision repair; subunit of Nucleotide Excision Repair Factor 4 (NEF4) and the Elongin‐Cullin‐Socs (ECS) ligase complex ‐0.7820 0.0002
CAX4 YGR036C Dolichyl pyrophosphate (Dol‐P‐P) phosphatase with a luminally oriented active site in the ER, cleaves the anhydride linkage in Dol‐P‐
P, required for Dol‐P‐P‐linked oligosaccharide intermediate synthesis and protein N‐glycosylation ‐0.7805 0.0004
COS9 YKL219W ‐0.7794 0.0009
NA YCR015C ‐0.7785 0.0002
MNS1 YJR131W Protein of unknown function, member of the DUP380 subfamily of conserved, often subtelomerically‐encoded proteins Putative protein of unknown function; YCR015C is not an essential gene Alpha‐1,2‐mannosidase involved in ER quality control; catalyzes the removal of one mannose residue from Man9GlcNAc to produce a single isomer of Man8GlcNAc in N‐linked oligosaccharide biosynthesis; integral to ER membrane ‐0.7763 0.0007
AKR2 YOR034C Ankyrin repeat‐containing protein similar to Akr1p; member of a family of putative palmitoyltransferases containing an Asp‐His‐His‐
Cys‐cysteine rich (DHHC‐CRD) domain; possibly involved in constitutive endocytosis of Ste3p ‐0.7750 0.0005
TNA1 YGR260W High affinity nicotinic acid plasma membrane permease, responsible for uptake of low levels of nicotinic acid; expression of the gene increases in the absence of extracellular nicotinic acid or para‐
aminobenzoate (PABA) ‐0.7745 0.0004
NA YMR210W ‐0.7716 0.0007
YAP5 NA YIR018W YBR220C Putative acyltransferase with similarity to Eeb1p and Eht1p, has a minor role in medium‐chain fatty acid ethyl ester biosynthesis; may be involved in lipid metabolism and detoxification Basic leucine zipper (bZIP) transcription factor
Putative protein of unknown function; YBR220C is not an essential gene ‐0.7633 ‐0.7625 0.0003
0.0004
153
adj.p.val log2(mtr10
.Tf/WT.Tf) Symbols ORF Description NA YMR010W ‐0.7545 0.0009
TUF1 YOR187W Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; YMR010W is not an essential gene; YMR010W mRNA is transcribed with ADI1 Mitochondrial translation elongation factor Tu; comprises both GTPase and guanine nucleotide exchange factor activities, while these activities are found in separate proteins in S. pombe and humans ‐0.7500 0.0003
GDT1 YBR187W Putative protein of unknown function; expression is reduced in a gcr1 null mutant; GFP‐fusion protein localizes to the vacuole; expression pattern and physical interactions suggest a possible role in ribosome biogenesis ‐0.7455 0.0003
NA VPS75 YOR390W YNL246W Putative protein of unknown function
NAP family histone chaperone; binds to histones and Rtt109p, stimulating histone acetyltransferase activity; possesses nucleosome assembly activity in vitro; proposed role in vacuolar protein sorting and in double‐strand break repair ‐0.7427 ‐0.7414 0.0004
0.0004
AMD1 YML035C ‐0.7304 0.0006
MRPS35 HEK2 YGR165W YBL032W AMP deaminase, tetrameric enzyme that catalyzes the deamination of AMP to form IMP and ammonia; may be involved in regulation of intracellular adenine nucleotide pools Mitochondrial ribosomal protein of the small subunit
RNA binding protein involved in the asymmetric localization of ASH1 mRNA; represses translation of ASH1 mRNA, an effect reversed by Yck1p‐dependent phosphoryation; regulates telomere position effect and length; similarity to hnRNP‐K ‐0.7297 ‐0.7296 0.0009
0.0004
ATP2 YJR121W ‐0.7208 0.0008
MSG5 YNL053W Beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase, which is a large, evolutionarily conserved enzyme complex required for ATP synthesis; phosphorylated Dual‐specificity protein phosphatase; exists in 2 isoforms; required for maintenance of a low level of signaling through the cell integrity pathway, adaptive response to pheromone; regulates and is regulated by Slt2p; dephosphorylates Fus3p ‐0.7194 0.0005
ARO4 YBR249C ‐0.7156 0.0009
STE4 YOR212W 3‐deoxy‐D‐arabino‐heptulosonate‐7‐phosphate (DAHP) synthase, catalyzes the first step in aromatic amino acid biosynthesis and is feedback‐inhibited by tyrosine or high concentrations of phenylalanine or tryptophan G protein beta subunit, forms a dimer with Ste18p to activate the mating signaling pathway, forms a heterotrimer with Gpa1p and Ste18p to dampen signaling; may recruit Rho1p to the polarized growth site during mating; contains WD40 repeats ‐0.7112 0.0009
SCS7 YMR272C ‐0.7091 0.0008
SCS3 YGL126W Sphingolipid alpha‐hydroxylase, functions in the alpha‐hydroxylation of sphingolipid‐associated very long chain fatty acids, has both cytochrome b5‐like and hydroxylase/desaturase domains, not essential for growth Protein required for inositol prototrophy, identified as an ortholog of the FIT family of proteins involved in triglyceride droplet biosynthesis; disputed role in the synthesis of inositol phospholipids from inositol ‐0.7065 0.0009
MKK1 YOR231W Mitogen‐activated kinase kinase involved in protein kinase C signaling pathway that controls cell integrity; upon activation by Bck1p phosphorylates downstream target, Slt2p; functionally redundant with Mkk2p ‐0.7036 0.0003
SSY5 YJL156C Serine protease of SPS plasma membrane amino acid sensor system (Ssy1p‐Ptr3p‐Ssy5p); contains an inhibitory domain that dissociates in response to extracellular amino acids, freeing a catalytic domain to activate transcription factor Stp1p ‐0.7007 0.0008
154
adj.p.val log2(mtr10
.Tf/WT.Tf) Symbols ORF Description VBA1 MNP1 YMR088C YGL068W ‐0.6986 ‐0.6984 0.0009
0.0003
LEU5 YHR002W ‐0.6910 0.0004
PET117 COT1 YER058W YOR316C ‐0.6893 ‐0.6873 0.0005
0.0009
BLM10 YFL007W Permease of basic amino acids in the vacuolar membrane
Protein associated with the mitochondrial nucleoid; putative mitochondrial ribosomal protein with similarity to E. coli L7/L12 ribosomal protein; required for normal respiratory growth Mitochondrial carrier protein involved in the accumulation of CoA in the mitochondrial matrix; homolog of human Graves disease protein; does not encode an isozyme of Leu4p, as first hypothesized Protein required for assembly of cytochrome c oxidase
Vacuolar transporter that mediates zinc transport into the vacuole; overexpression confers resistance to cobalt and rhodium Proteasome activator subunit; found in association with core particles, with and without the 19S regulatory particle; required for resistance to bleomycin, may be involved in protecting against oxidative damage; similar to mammalian PA200 ‐0.6859 0.0004
NA YMR291W Putative kinase of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; YMR291W is not an essential gene ‐0.6857 0.0007
NA YLR278C Zinc‐cluster protein; GFP‐fusion protein localizes to the nucleus; mutant shows moderate growth defect on caffeine; has a prion‐
domain like fragment that increases frequency of [URE3]; YLR278C is not an essential gene ‐0.6741 0.0004
YLF2 YHL014C ‐0.6738 0.0010
CIN2 YPL241C Protein of unknown function, has weak similarity to E. coli GTP‐
binding protein gtp1; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies GTPase‐activating protein (GAP) for Cin4p; tubulin folding factor C involved in beta‐tubulin (Tub2p) folding; mutants display increased chromosome loss and benomyl sensitivity; deletion complemented by human GAP, retinitis pigmentosa 2 ‐0.6734 0.0007
NA POL2 YOL098C YNL262W Putative metalloprotease
Catalytic subunit of DNA polymerase (II) epsilon, a chromosomal DNA replication polymerase that exhibits processivity and proofreading exonuclease activity; also involved in DNA synthesis during DNA repair; interacts extensively with Mrc1p ‐0.6659 ‐0.6624 0.0006
0.0009
SAT4 YCR008W Ser/Thr protein kinase involved in salt tolerance; funtions in regulation of Trk1p‐Trk2p potassium transporter; partially redundant with Hal5p; has similarity to Npr1p ‐0.6603 0.0009
HIR2 YOR038C Subunit of the HIR complex, a nucleosome assembly complex involved in regulation of histone gene transcription; recruits Swi‐Snf complexes to histone gene promoters; promotes heterochromatic gene silencing with Asf1p ‐0.6587 0.0009
CAN1 YEL063C ‐0.6553 0.0003
PSD1 YNL169C Plasma membrane arginine permease, requires phosphatidyl ethanolamine (PE) for localization, exclusively associated with lipid rafts; mutation confers canavanine resistance Phosphatidylserine decarboxylase of the mitochondrial inner membrane, converts phosphatidylserine to phosphatidylethanolamine ‐0.6495 0.0006
DIA4 YHR011W ‐0.6491 0.0005
KGD1 YIL125W Probable mitochondrial seryl‐tRNA synthetase, mutant displays increased invasive and pseudohyphal growth Component of the mitochondrial alpha‐ketoglutarate dehydrogenase complex, which catalyzes a key step in the tricarboxylic acid (TCA) cycle, the oxidative decarboxylation of alpha‐
ketoglutarate to form succinyl‐CoA ‐0.6467 0.0006
MRPL6 YHR147C Mitochondrial ribosomal protein of the large subunit
‐0.6456 0.0008
155
adj.p.val log2(mtr10
.Tf/WT.Tf) Symbols ORF Description POR2 YIL114C PET127 YOR017W RPO41 YFL036W EGT2 YNL327W Putative mitochondrial porin (voltage‐dependent anion channel), related to Por1p but not required for mitochondrial membrane permeability or mitochondrial osmotic stability Protein with a role in 5'‐end processing of mitochondrial RNAs, located in the mitochondrial membrane Mitochondrial RNA polymerase; single subunit enzyme similar to those of T3 and T7 bacteriophages; requires a specificity subunit encoded by MTF1 for promoter recognition Glycosylphosphatidylinositol (GPI)‐anchored cell wall endoglucanase required for proper cell separation after cytokinesis, expression is activated by Swi5p and tightly regulated in a cell cycle‐dependent manner CDH1 YGL003C PEX32 adj.p.val ‐0.6446 0.0004
‐0.6425 0.0007
‐0.6413 0.0005
‐0.6364 0.0005
Cell‐cycle regulated activator of the anaphase‐promoting complex/cyclosome (APC/C), which directs ubiquitination of cyclins resulting in mitotic exit; targets the APC/C to specific substrates including Cdc20p, Ase1p, Cin8p and Fin1p ‐0.6317 0.0009
YBR168W Peroxisomal integral membrane protein, involved in negative regulation of peroxisome size; partially functionally redundant with Pex31p; genetic interactions suggest action at a step downstream of steps mediated by Pex28p and Pex29p ‐0.6298 0.0004
OST6 YML019W ‐0.6281 0.0008
PIR1 YKL164C Subunit of the oligosaccharyltransferase complex of the ER lumen, which catalyzes asparagine‐linked glycosylation of newly synthesized proteins; similar to and partially functionally redundant with Ost3p O‐glycosylated protein required for cell wall stability; attached to the cell wall via beta‐1,3‐glucan; mediates mitochondrial translocation of Apn1p; expression regulated by the cell integrity pathway and by Swi5p during the cell cycle ‐0.6244 0.0006
CDS1 YBR029C Phosphatidate cytidylyltransferase (CDP‐diglyceride synthetase); an enzyme that catalyzes that conversion of CTP + phosphate into diphosphate + CDP‐diaclglyerol, a critical step in the synthesis of all major yeast phospholipids ‐0.6241 0.0010
PEX2 YJL210W RING‐finger peroxin and E3 ubiquitin ligase, peroxisomal membrane protein with a C‐terminal zinc‐binding RING domain, forms translocation subcomplex with Pex10p and Pex12p which functions in peroxisomal matrix protein import ‐0.6189 0.0010
FAA1 YOR317W Long chain fatty acyl‐CoA synthetase, activates imported fatty acids with a preference for C12:0‐C16:0 chain lengths; functions in long chain fatty acid import; accounts for most acyl‐CoA synthetase activity; localized to lipid particles ‐0.6161 0.0006
IGO2 YHR132W‐
A Protein required for initiation of G0 program; prevents degradation of nutrient‐regulated mRNAs via the 5'‐3' mRNA decay pathway; phosphorylated by Rim15p; GFP protein localizes to the cytoplasm and nucleus; similar to Igo1p ‐0.6088 0.0009
NA YKL100C Putative protein of unknown function with similarity to a human minor histocompatibility antigen and signal peptide peptidases; YKL100C is not an essential gene ‐0.6087 0.0008
CFT2 YLR115W ‐0.6062 0.0008
NA YOR093C Subunit of the mRNA cleavage and polyadenlylation factor (CPF); required for pre‐mRNA cleavage, polyadenylation and poly(A) site recognition, 43% similarity with the mammalian CPSF‐100 protein. Putative protein of unknown function; deletion causes sensitivity to unfolded protein response‐inducing agents ‐0.6029 0.0007
156
APPENDIX H: Up-regulated genes in mtr10Δ
cells in fed condition
This section includes the list of transcriptionally differentially expressed genes (cutoff
conditions: log2 FC
0.6 and adjusted p-value < 0.001) in mtr10Δ cells in fed condition.
Up-regulated genes in mtr10Δ cells in fed condition
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Adhesion subunit of a‐agglutinin of a‐cells, C‐terminal sequence acts as a ligand for alpha‐agglutinin (Sag1p) during agglutination, modified with O‐linked oligomannosyl chains, linked to anchorage subunit Aga1p via two disulfide bonds 3.6923 0.0001
YDR461W Mating pheromone a‐factor, made by a cells; interacts with alpha cells to induce cell cycle arrest and other responses leading to mating; biogenesis involves C‐terminal modification, N‐terminal proteolysis, and export; also encoded by MFA2 3.5838 0.0000
NA YDL114W 3.2686 0.0000
MFA2 YNL145W Putative protein of unknown function with similarity to acyl‐carrier‐
protein reductases; YDL114W is not an essential gene Mating pheromone a‐factor, made by a cells; interacts with alpha cells to induce cell cycle arrest and other responses leading to mating; biogenesis involves C‐terminal modification, N‐terminal proteolysis, and export; also encoded by MFA1 3.2579 0.0001
STL1 YDR536W 3.2372 0.0000
ARO10 YDR380W Glycerol proton symporter of the plasma membrane, subject to glucose‐induced inactivation, strongly but transiently induced when cells are subjected to osmotic shock Phenylpyruvate decarboxylase, catalyzes decarboxylation of phenylpyruvate to phenylacetaldehyde, which is the first specific step in the Ehrlich pathway 2.9917 0.0004
Symbols ORF Description AGA2 YGL032C MFA1 NA YNR062C Putative membrane protein of unknown function
2.9628 0.0000
SRT1 YMR101C Cis‐prenyltransferase involved in synthesis of long‐chain dolichols (19‐22 isoprene units; as opposed to Rer2p which synthesizes shorter‐chain dolichols); localizes to lipid bodies; transcription is induced during stationary phase 2.6672 0.0000
SPG4 YMR107W 2.6514 0.0002
NA YDR374C Protein required for survival at high temperature during stationary phase; not required for growth on nonfermentable carbon sources Putative protein of unknown function
2.5782 0.0000
157
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Putative protein of unknown function; transcription dependent upon Azf1p Aromatic aminotransferase II, catalyzes the first step of tryptophan, phenylalanine, and tyrosine catabolism Sporulation‐specific homolog of the yeast CDC3/10/11/12 family of bud neck microfilament genes; septin protein involved in sporulation; regulated by ABFI 2.4575 0.0002
2.3991 0.0002
2.3575 0.0001
YDR034W‐B Predicted tail‐anchored plasma membrane protein containing a conserved CYSTM module; related proteins in other organisms may be involved in response to stress; green fluorescent protein (GFP)‐
fusion protein localizes to the cell periphery 2.2665 0.0000
CDA1 YLR307W Chitin deacetylase, together with Cda2p involved in the biosynthesis ascospore wall component, chitosan; required for proper rigidity of the ascospore wall 2.2479 0.0001
RNP1 YLL046C Ribonucleoprotein that contains two RNA recognition motifs (RRM) 2.1298 0.0002
NA YNR064C 2.1183 0.0000
CSN9 YDR179C Epoxide hydrolase, member of the alpha/beta hydrolase fold family; may have a role in detoxification of epoxides Subunit of the Cop9 signalosome, which is required for deneddylation, or removal of the ubiquitin‐like protein Rub1p from Cdc53p (cullin); involved in adaptation to pheromone signaling 2.1149 0.0001
ECM8 YBR076W Non‐essential protein of unknown function
2.0530 0.0001
BOP2 YLR267W Protein of unknown function
2.0185 0.0001
FMP16 YDR070C Putative protein of unknown function; proposed to be involved in responding to conditions of stress; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies 1.9711 0.0007
DAL80 YKR034W Negative regulator of genes in multiple nitrogen degradation pathways; expression is regulated by nitrogen levels and by Gln3p; member of the GATA‐binding family, forms homodimers and heterodimers with Deh1p 1.9184 0.0002
NA YBR056W‐A Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the dubious ORF YBR056C‐B 1.8641 0.0002
DIT1 YDR403W Sporulation‐specific enzyme required for spore wall maturation, involved in the production of a soluble LL‐dityrosine‐containing precursor of the spore wall; transcripts accumulate at the time of prospore enclosure 1.7701 0.0002
NA YDR042C 1.7677 0.0000
NA YFR012W‐A Putative protein of unknown function; expression is increased in ssu72‐ts69 mutant Putative protein of unknown function; identified by homology
1.7649 0.0001
PES4 YFR023W 1.7269 0.0001
PRR2 YDL214C Poly(A) binding protein, suppressor of DNA polymerase epsilon mutation, similar to Mip6p Serine/threonine protein kinase that inhibits pheromone induced signalling downstream of MAPK, possibly at the level of the Ste12p transcription factor; mutant has increased aneuploidy tolerance 1.7018 0.0000
ZIP1 YDR285W Transverse filament protein of the synaptonemal complex; required for normal levels of meiotic recombination and pairing between homologous chromosome during meiosis; potential Cdc28p substrate 1.7002 0.0001
NA YJR149W Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm 1.6709 0.0001
Symbols ORF Description ANS1 YHR126C ARO9 YHR137W SPR3 YGR059W NA 158
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Putative transmembrane protein involved in export of ammonia, a starvation signal that promotes cell death in aging colonies; phosphorylated in mitochondria; member of the TC 9.B.33 YaaH family; homolog of Ady2p and Y. lipolytica Gpr1p 1.6697 0.0003
YLL057C Fe(II)‐dependent sulfonate/alpha‐ketoglutarate dioxygenase, involved in sulfonate catabolism for use as a sulfur source; contains sequence that resembles a J domain (typified by the E. coli DnaJ protein); induced by sulphur starvation 1.6563 0.0002
BNA2 YJR078W Putative tryptophan 2,3‐dioxygenase or indoleamine 2,3‐
dioxygenase, required for de novo biosynthesis of NAD from tryptophan via kynurenine; interacts genetically with telomere capping gene CDC13; regulated by Hst1p and Aftp 1.6391 0.0003
LYS20 YDL182W Homocitrate synthase isozyme, catalyzes the condensation of acetyl‐
CoA and alpha‐ketoglutarate to form homocitrate, which is the first step in the lysine biosynthesis pathway; highly similar to the other isozyme, Lys21p 1.6276 0.0002
MCH2 YKL221W Protein with similarity to mammalian monocarboxylate permeases, which are involved in transport of monocarboxylic acids across the plasma membrane; mutant is not deficient in monocarboxylate transport 1.6150 0.0005
HXT9 YJL219W Putative hexose transporter that is nearly identical to Hxt11p, has similarity to major facilitator superfamily (MFS) transporters, expression of HXT9 is regulated by transcription factors Pdr1p and Pdr3p 1.6118 0.0004
NA YGL015C 1.6100 0.0001
BAR1 YIL015W Putative protein of unknown function; null mutants accumulate cargo in the Golgi Aspartyl protease secreted into the periplasmic space of mating type a cells, helps cells find mating partners, cleaves and inactivates alpha factor allowing cells to recover from alpha‐factor‐induced cell cycle arrest 1.5974 0.0005
PUT1 YLR142W Proline oxidase, nuclear‐encoded mitochondrial protein involved in utilization of proline as sole nitrogen source; PUT1 transcription is induced by Put3p in the presence of proline and the absence of a preferred nitrogen source 1.5578 0.0001
NA YML083C Putative protein of unknown function; strong increase in transcript abundance during anaerobic growth compared to aerobic growth; cells deleted for YML083C do not exhibit growth defects in anerobic or anaerobic conditions 1.5547 0.0001
DON1 YDR273W 1.5545 0.0001
TFB5 YDR079C‐A Meiosis‐specific component of the spindle pole body, part of the leading edge protein (LEP) coat, forms a ring‐like structure at the leading edge of the prospore membrane during meiosis II Component of the RNA polymerase II general transcription and DNA repair factor TFIIH; involved in transcription initiation and in nucleotide‐excision repair; homolog of Chlamydomonas reinhardtii REX1‐S protein involved in DNA repair 1.5532 0.0001
GSC2 YGR032W Catalytic subunit of 1,3‐beta‐glucan synthase, involved in formation of the inner layer of the spore wall; activity positively regulated by Rho1p and negatively by Smk1p; has similarity to an alternate catalytic subunit, Fks1p (Gsc1p) 1.5527 0.0001
LOH1 YJL038C Protein of unknown function with proposed roles in maintenance of genome integrity and also in spore wall assembly; induced during sporulation; repressed during vegetative growth by Sum1p and Hst1p; sequence similar to IRC1 1.5458 0.0002
Symbols ORF Description ATO2 YNR002C JLP1 159
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Putative protein of unknown function; YDL186W is not an essential gene Transcriptional regulator involved in activation of the GAL genes in response to galactose; forms a complex with Gal80p to relieve Gal80p inhibition of Gal4p; binds galactose and ATP but does not have galactokinase activity 1.5209 0.0002
1.5134 0.0000
Putative protein of unknown function; similar to the mouse IMPACT gene; YDL177C is not an essential gene Permease that serves as a gamma‐aminobutyrate (GABA) transport protein involved in the utilization of GABA as a nitrogen source; catalyzes the transport of putrescine and delta‐aminolevulinic acid (ALA); localized to the vacuolar membrane 1.4974 0.0000
1.4882 0.0001
YGL018C Specialized J‐protein that functions with Hsp70 in Fe‐S cluster biogenesis in mitochondria, involved in iron metabolism; contains a J domain typical to J‐type chaperones; localizes to the mitochondrial matrix 1.4697 0.0000
SMA1 YPL027W 1.4625 0.0006
MGT1 YDL200C 1.4582 0.0001
DIT2 YDR402C 1.4464 0.0001
KRE28 YDR532C Protein of unknown function involved in the assembly of the prospore membrane during sporulation; interacts with Spo14p DNA repair methyltransferase (6‐O‐methylguanine‐DNA methylase) involved in protection against DNA alkylation damage N‐formyltyrosine oxidase, sporulation‐specific microsomal enzyme involved in the production of N,N‐bisformyl dityrosine required for spore wall maturation, homologous to cytochrome P‐450s Subunit of a kinetochore‐microtubule binding complex with Spc105p that bridges centromeric heterochromatin and kinetochore MAPs and motors, and is also required for sister chromatid bi‐orientation and kinetochore binding of SAC components 1.3761 0.0003
DIA3 YDL024C 1.3759 0.0002
STF1 YDL130W‐A 1.3700 0.0001
CWC15 YDR163W 1.3445 0.0001
IRC18 YJL037W 1.3377 0.0004
PLM2 YDR501W Forkhead Associated domain containing protein and putative transcription factor found associated with chromatin; target of SBF transcription factor; induced in response to DNA damaging agents and deletion of telomerase; similar to TOS4 1.3218 0.0001
CYB2 YML054C Cytochrome b2 (L‐lactate cytochrome‐c oxidoreductase), component of the mitochondrial intermembrane space, required for lactate utilization; expression is repressed by glucose and anaerobic conditions 1.3192 0.0001
BUG1 YDL099W Cis‐golgi localized protein involved in ER to Golgi transport; forms a complex with the mammalian GRASP65 homolog, Grh1p; mutants are compromised for the fusion of ER‐derived vesicles with Golgi membranes 1.3176 0.0002
PAR32 YDL173W Putative protein of unknown function; hyperphosphorylated upon rapamycin treatment in a Tap42p‐dependent manner; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; PAR32 is not an essential gene 1.3165 0.0001
Symbols ORF Description NA YDL186W GAL3 YDR009W NA YDL177C UGA4 YDL210W JAC1 Protein of unknown function, involved in invasive and pseudohyphal growth Protein involved in regulation of the mitochondrial F1F0‐ATP synthase; Stf1p and Stf2p may act as stabilizing factors that enhance inhibitory action of the Inh1p protein Non‐essential protein involved in pre‐mRNA splicing, component of a complex containing Cef1p; has similarity to S. pombe Cwf15p Putative protein of unknown function; expression induced in respiratory‐deficient cells and in carbon‐limited chemostat cultures; similar to adjacent ORF, YJL038C; null mutant displays increased levels of spontaneous Rad52p foci 160
log2(mtr10
.Tf/WT.Tf) adj.p.va
l 1.2996 0.0002
1.2986 0.0004
1.2845 0.0002
1.2753 0.0001
Plasma membrane sulfite pump involved in sulfite metabolism and required for efficient sulfite efflux; major facilitator superfamily protein 1.2676 0.0004
Homocitrate synthase isozyme, catalyzes the condensation of acetyl‐
CoA and alpha‐ketoglutarate to form homocitrate, which is the first step in the lysine biosynthesis pathway; highly similar to the other isozyme, Lys20p 1.2633 0.0006
Symbols ORF Description RAD34 YDR314C MAL32 YBR299W Protein involved in nucleotide excision repair (NER); homologous to RAD4 Maltase (alpha‐D‐glucosidase), inducible protein involved in maltose catabolism; encoded in the MAL3 complex locus; functional in genomic reference strain S288C; hydrolyzes the disaccharides maltose, turanose, maltotriose, and sucrose CRR1 YLR213C PAU4 YLR461W SSU1 YPL092W LYS21 YDL131W HIM1 YDR317W Protein of unknown function involved in DNA repair
1.2462 0.0001
MPC54 YOR177C Component of the meiotic outer plaque, a membrane‐organizing center which is assembled on the cytoplasmic face of the spindle pole body during meiosis II and triggers the formation of the prospore membrane; potential Cdc28p substrate 1.2229 0.0002
MUP3 YHL036W Low affinity methionine permease, similar to Mup1p
1.2217 0.0010
OSW2 YLR054C 1.2215 0.0005
HXT14 YNL318C Protein of unknown function proposed to be involved in the assembly of the spore wall Protein with similarity to hexose transporter family members, expression is induced in low glucose and repressed in high glucose; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies 1.2165 0.0006
YSW1 YBR148W Protein required for normal prospore membrane formation; interacts with Gip1p, which is the meiosis‐specific regulatory subunit of the Glc7p protein phosphatase; expressed specifically in spores and localizes to the prospore membrane 1.2147 0.0001
ECM11 YDR446W 1.2101 0.0003
THI13 YDL244W 1.2080 0.0002
NA YDR379C‐A 1.2051 0.0007
SSP2 YOR242C 1.2000 0.0005
NA YLL066W‐B 1.1877 0.0008
UGA3 YDL170W Non‐essential protein apparently involved in meiosis, GFP fusion protein is present in discrete clusters in the nucleus throughout mitosis; may be involved in maintaining chromatin structure Protein involved in synthesis of the thiamine precursor hydroxymethylpyrimidine (HMP); member of a subtelomeric gene family including THI5, THI11, THI12, and THI13 Protein involved in the assembly of the mitochondrial succinate dehydrogenase complex; mutations in human ortholog SDHAF1 are associated with infantile leukoencephalopathy Sporulation specific protein that localizes to the spore wall; required for sporulation at a point after meiosis II and during spore wall formation; SSP2 expression is induced midway in meiosis Putative protein of unknown function; overexpression causes a cell cycle delay or arrest Transcriptional activator necessary for gamma‐aminobutyrate (GABA)‐dependent induction of GABA genes (such as UGA1, UGA2, UGA4); zinc‐finger transcription factor of the Zn(2)‐Cys(6) binuclear cluster domain type; localized to the nucleus 1.1791 0.0003
Putative glycoside hydrolase of the spore wall envelope; required for normal spore wall assembly, possibly for cross‐linking between the glucan and chitosan layers; expressed during sporulation Member of the seripauperin multigene family encoded mainly in subtelomeric regions; active during alcoholic fermentation, regulated by anaerobiosis, negatively regulated by oxygen, repressed by heme 161
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Putative protein of unknown function, involved in copper metabolism; similar to C. carbonum toxD gene; member of the quinone oxidoreductase family 1.1627 0.0002
YOL058W Arginosuccinate synthetase, catalyzes the formation of L‐
argininosuccinate from citrulline and L‐aspartate in the arginine biosynthesis pathway; potential Cdc28p substrate 1.1627 0.0007
HNT2 YDR305C Dinucleoside triphosphate hydrolase; has similarity to the tumor suppressor FHIT and belongs to the histidine triad (HIT) superfamily of nucleotide‐binding proteins 1.1561 0.0001
NA YDR018C 1.1517 0.0003
DAL1 YIR027C Probable membrane protein with three predicted transmembrane domains; homologous to Ybr042cp, similar to C. elegans F55A11.5 and maize 1‐acyl‐glycerol‐3‐phosphate acyltransferase Allantoinase, converts allantoin to allantoate in the first step of allantoin degradation; expression sensitive to nitrogen catabolite repression 1.1459 0.0004
NA YLR466C‐B 1.1438 0.0001
DSF1 YEL070W Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data Deletion suppressor of mpt5 mutation
1.1398 0.0004
NA YLR460C 1.1386 0.0002
MTH1 YDR277C Member of the quinone oxidoreductase family, up‐regulated in response to the fungicide mancozeb; possibly up‐regulated by iodine Negative regulator of the glucose‐sensing signal transduction pathway, required for repression of transcription by Rgt1p; interacts with Rgt1p and the Snf3p and Rgt2p glucose sensors; phosphorylated by Yck1p, triggering Mth1p degradation 1.1369 0.0006
CTS2 YDR371W 1.1306 0.0004
REC8 YPR007C Putative chitinase, functionally complements A. gossypii cts2 mutant sporulation defect Meiosis‐specific component of sister chromatid cohesion complex; maintains cohesion between sister chromatids during meiosis I; maintains cohesion between centromeres of sister chromatids until meiosis II; homolog of S. pombe Rec8p 1.1304 0.0007
CTA1 YDR256C Catalase A, breaks down hydrogen peroxide in the peroxisomal matrix formed by acyl‐CoA oxidase (Pox1p) during fatty acid beta‐
oxidation 1.1300 0.0005
SNA4 YDL123W 1.1236 0.0002
SHS1 YDL225W 1.1057 0.0008
NDT80 YHR124W Protein of unknown function, localized to the vacuolar outer membrane; predicted to be palmitoylated One of five related septins (Cdc3p, Cdc10p, Cdc11p, Cdc12p, Shs1p) that form a cortical filamentous collar at the mother‐bud neck which is necessary for normal morphogenesis and cytokinesis Meiosis‐specific transcription factor required for exit from pachytene and for full meiotic recombination; activates middle sporulation genes; competes with Sum1p for binding to promoters containing middle sporulation elements (MSE) 1.1043 0.0003
NA YDL233W Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; YDL233W is not an essential gene 1.1031 0.0001
NA YDR186C 1.0952 0.0001
GYP7 YDL234C Putative protein of unknown function; may interact with ribosomes, based on co‐purification experiments; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm GTPase‐activating protein for yeast Rab family members including: Ypt7p (most effective), Ypt1p, Ypt31p, and Ypt32p (in vitro); involved in vesicle mediated protein trafficking 1.0918 0.0002
NA YLL066W‐B 1.0896 0.0007
Symbols ORF Description NA YCR102C ARG1 Putative protein of unknown function; overexpression causes a cell cycle delay or arrest 162
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Cytoplasmic light chain dynein, microtubule motor protein; proposed to be involved in the assembly of the nuclear pore complex 1.0875 0.0002
Mitochondrial protein required for degradation of unstable forms of cytochrome c Putative protein kinase, potentially phosphorylated by Cdc28p; interacts with ribosome biogenesis factors, Cka2, Gus1 and Arc1 Component of the CCR4‐NOT complex, which has multiple roles in regulating mRNA levels including regulation of transcription and destabilizing mRNAs by deadenylation; basal transcription factor 1.0856 0.0002
1.0824 0.0002
1.0794 0.0002
Protein involved in RNA splicing by the spliceosome; component of a complex containing Cef1p; interacts genetically with ISY1 and BUD13; may bind RNA; has similarity to S. pombe Cwf21p Protein of unknown function; associates with meiosis‐specific protein Spo1p Putative aryl‐alcohol dehydrogenase with similarity to P. chrysosporium aryl‐alcohol dehydrogenase, involved in the oxidative stress response; expression induced in cells treated with the mycotoxin patulin 1.0788 0.0001
1.0787 0.0003
1.0740 0.0002
Member of the seripauperin multigene family encoded mainly in subtelomeric regions, active during alcoholic fermentation, regulated by anaerobiosis, negatively regulated by oxygen, repressed by heme DNA damage‐dependent checkpoint protein, required for cell‐cycle arrest in G1/S, intra‐S, and G2/M; transmits checkpoint signal by activating Rad53p and Chk1p; hyperphosphorylated by Mec1p and Tel1p; potential Cdc28p substrate 1.0732 0.0004
1.0708 0.0004
Putative aryl‐alcohol dehydrogenase with similarity to P. chrysosporium aryl‐alcohol dehydrogenase, involved in the oxidative stress response; expression induced in cells treated with the mycotoxin patulin 1.0706 0.0002
Putative protein of unknown function; proposed to be a palmitoylated membrane protein Protein with similarity to mammalian monocarboxylate permeases, which are involved in transport of monocarboxylic acids across the plasma membrane; mutant is not deficient in monocarboxylate transport 1.0621 0.0010
1.0609 0.0003
YDR308C Subunit of the RNA polymerase II mediator complex; associates with core polymerase subunits to form the RNA polymerase II holoenzyme; essential for transcriptional regulation; target of the global repressor Tup1p 1.0608 0.0001
YOS9 YDR057W ER quality‐control lectin; integral subunit of the HRD ligase; binds to glycans with terminal alpha‐1,6 linked mannose on misfolded N‐
glycosylated proteins and participates in targeting proteins to ERAD; member of the OS‐9 protein family 1.0606 0.0005
PAU18 YLL064C 1.0587 0.0002
NA YDR366C Protein of unknown function, member of the seripauperin multigene family encoded mainly in subtelomeric regions; identical to Pau6p Putative protein of unknown function
1.0567 0.0001
LCD1 YDR499W Essential protein required for the DNA integrity checkpoint pathways; interacts physically with Mec1p; putative homolog of S. pombe Rad26 and human ATRIP 1.0543 0.0009
Symbols ORF Description DYN2 YDR424C SUE1 YPR151C RTK1 YDL025C CDC36 YDL165W CWC21 YDR482C SPO23 YBR250W AAD4 YDL243C PAU3 YCR104W RAD9 YDR217C AAD4 YDL243C NA YKL107W MCH1 YDL054C SRB7 163
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Chaperone that specifically facilitates the assembly of cytochrome c oxidase, integral to the mitochondrial inner membrane; interacts with a subcomplex of subunits VII, VIIa, and VIII (Cox7p, Cox9p, and Cox8p) but not with the holoenzyme 1.0495 0.0001
YHL016C Plasma membrane transporter for both urea and polyamines, expression is highly sensitive to nitrogen catabolite repression and induced by allophanate, the last intermediate of the allantoin degradative pathway 1.0471 0.0001
COA2 YPL189C‐A Cytochrome oxidase assembly factor; null mutation results in respiratory deficiency with specific loss of cytochrome oxidase activity; functions downstream of assembly factors Mss51p and Coa1p and interacts with assembly factor Shy1p 1.0452 0.0006
MTD1 YKR080W NAD‐dependent 5,10‐methylenetetrahydrafolate dehydrogenase, plays a catalytic role in oxidation of cytoplasmic one‐carbon units; expression is regulated by Bas1p and Bas2p, repressed by adenine, and may be induced by inositol and choline 1.0384 0.0001
NA YLR466C‐B 1.0374 0.0002
DFM1 YDR411C Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data Endoplasmic reticulum (ER) localized protein involved in ER‐
associated protein degradation (ERAD), ER stress and homeostasis; interacts with components of ERAD‐L and ERAD‐C and Cdc48p; derlin‐like family member similar to Der1p 1.0350 0.0002
NA YDL073W 1.0313 0.0002
NA YDR248C 1.0260 0.0002
BUR6 YER159C Subunit of a heterodimeric NC2 transcription regulator complex with Ncb2p; complex binds to TBP and can repress transcription by preventing preinitiation complex assembly or stimulate activated transcription; homologous to human NC2alpha 1.0236 0.0003
RTC2 YBR147W Protein of unknown function; identified in a screen for mutants with decreased levels of rDNA transcription; detected in highly purified mitochondria; null mutant suppresses cdc13‐1; similar to a G‐protein coupled receptor from S. pombe 1.0235 0.0003
SLM3 YDL033C 1.0226 0.0003
PAU8 YAL068C 1.0213 0.0002
NA YBR085C‐A 1.0140 0.0003
LYS1 YIR034C 1.0115 0.0009
LRS4 YDR439W tRNA‐specific 2‐thiouridylase, responsible for 2‐thiolation of the wobble base of mitochondrial tRNAs; human ortholog is implicated in myoclonus epilepsy associated with ragged red fibers (MERRF) Protein of unknown function, member of the seripauperin multigene family encoded mainly in subtelomeric regions Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and to the nucleus Saccharopine dehydrogenase (NAD+, L‐lysine‐forming), catalyzes the conversion of saccharopine to L‐lysine, which is the final step in the lysine biosynthesis pathway; also has mRNA binding activity Nucleolar protein that forms a complex with Csm1p, and then Mam1p at kinetochores during meiosis I to mediate accurate homolog segregation; required for condensin recruitment to the replication fork barrier site and rDNA repeat segregation 1.0093 0.0003
POL3 YDL102W 1.0085 0.0001
Symbols ORF Description PET100 YDR079W DUR3 Putative protein of unknown function; YDL073W is not an essential gene Putative protein of unknown function; sequence similarity to bacterial and human gluconokinase; green fluorescent protein (GFP)‐
fusion protein localizes to the cytoplasm; upregulated by deletion of the RNAP‐II associated factor, PAF1 Catalytic subunit of DNA polymerase delta; required for chromosomal DNA replication during mitosis and meiosis, intragenic recombination, repair of double strand DNA breaks, and DNA replication during nucleotide excision repair (NER) 164
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Highly conserved mitochondrial protein, essential for t6A modification of mitochondrial tRNAs that decode ANN codons; similar to Kae1p and E. coli YgjD, both of which are also required for tRNA t6A modification 1.0077 0.0006
Putative protein of unknown function; likely member of BLOC complex involved in endosomal cargo sorting; green fluorescent protein (GFP)‐fusion protein localizes to endosomes Ethanolamine kinase, primarily responsible for phosphatidylethanolamine synthesis via the CDP‐ethanolamine pathway; exhibits some choline kinase activity, thus contributing to phosphatidylcholine synthesis via the CDP‐choline pathway 1.0006 0.0002
0.9881 0.0001
Non‐essential kinetochore protein, subunit of the Ctf19 central kinetochore complex (Ctf19p‐Mcm21p‐Okp1p‐Mcm22p‐Mcm16p‐
Ctf3p‐Chl4p‐Mcm19p‐Nkp1p‐Nkp2p‐Ame1p‐Mtw1p) Putative protein of unknown function
0.9880 0.0001
0.9870 0.0002
YDR263C Mitochondrial nuclease functioning in DNA repair and replication, modulates the stability of the mitochondrial genome, induced by exposure to mutagens, also induced during meiosis at a time nearly coincident with commitment to recombination 0.9836 0.0003
GCV1 YDR019C 0.9817 0.0003
SHU2 YDR078C T subunit of the mitochondrial glycine decarboxylase complex, required for the catabolism of glycine to 5,10‐methylene‐THF; expression is regulated by levels of levels of 5,10‐methylene‐THF in the cytoplasm Protein involved in a Rad51p‐, Rad54p‐dependent pathway for homologous recombination repair, important for error‐free repair of spontaneous and induced DNA lesions to protect the genome from mutation; associates with Shu1p, Psy3p, and Csm2p 0.9733 0.0002
ARO80 YDR421W Zinc finger transcriptional activator of the Zn2Cys6 family; activates transcription of aromatic amino acid catabolic genes in the presence of aromatic amino acids 0.9711 0.0001
RNH202 YDR279W 0.9698 0.0001
UBX3 YDL091C 0.9661 0.0004
CBS1 YDL069C Ribonuclease H2 subunit, required for RNase H2 activity; related to human AGS2 that causes Aicardi‐Goutieres syndrome UBX (ubiquitin regulatory X) domain‐containing protein that interacts with Cdc48p, green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern Mitochondrial translational activator of the COB mRNA; membrane protein that interacts with translating ribosomes, acts on the COB mRNA 5'‐untranslated leader 0.9651 0.0007
MBR1 YKL093W Protein involved in mitochondrial functions and stress response; overexpression suppresses growth defects of hap2, hap3, and hap4 mutants 0.9647 0.0003
SCM3 YDL139C Nonhistone component of centromeric chromatin that binds stoichiometrically to CenH3‐H4 histones, required for kinetochore assembly; required for G2/M progression and localization of Cse4p; may protect Cse4p from ubiquitylation 0.9641 0.0001
PFA5 YDR459C Palmitoyltransferase with autoacylation activity; likely functions in pathway(s) outside Ras; member of a family of putative palmitoyltransferases containing an Asp‐His‐His‐Cys‐cysteine rich (DHHC‐CRD) domain 0.9595 0.0003
QCR7 YDR529C Subunit 7 of the ubiquinol cytochrome‐c reductase complex, which is a component of the mitochondrial inner membrane electron transport chain; oriented facing the mitochondrial matrix; N‐
terminus appears to play a role in complex assembly 0.9559 0.0001
POX1 YGL205W Fatty‐acyl coenzyme A oxidase, involved in the fatty acid beta‐
oxidation pathway; localized to the peroxisomal matrix 0.9550 0.0006
Symbols ORF Description QRI7 YDL104C SNN1 YNL086W EKI1 YDR147W NKP1 YDR383C NA YDR132C DIN7 165
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Putative GPI‐anchored aspartic protease, member of the yapsin family of proteases involved in cell wall growth and maintenance; located in the cytoplasm and endoplasmic reticulum Putative kinase
0.9548 0.0001
0.9515 0.0001
Putative protein of unknown function; identified by fungal homology and RT‐PCR Membrane anchor subunit of succinate dehydrogenase (Sdh1p, Sdh2p, Sdh3p, Sdh4p), which couples the oxidation of succinate to the transfer of electrons to ubiquinone as part of the TCA cycle and the mitochondrial respiratory chain 0.9512 0.0009
0.9420 0.0004
Anti‐silencing protein that causes derepression of silent loci when overexpressed Protein that interacts with CCT (chaperonin containing TCP‐1) complex and has a role in actin and tubulin folding; has weak similarity to phosducins, which are G‐protein regulators 0.9388 0.0002
0.9385 0.0002
Symbols ORF Description YPS7 YDR349C NA YDR109C NA YER078W‐A SDH4 YDR178W ASF2 YDL197C PLP1 YDR183W PEX3 YDR329C Peroxisomal membrane protein (PMP) required for proper localization and stability of PMPs; anchors peroxisome retention factor Inp1p at the peroxisomal membrane; interacts with Pex19p 0.9377 0.0001
NA YDR239C 0.9375 0.0002
SEC1 YDR164C 0.9349 0.0001
REF2 YDR195W Protein of unknown function that may interact with ribosomes, based on co‐purification experiments Sm‐like protein involved in docking and fusion of exocytic vesicles through binding to assembled SNARE complexes at the membrane; localization to sites of secretion (bud neck and bud tip) is dependent on SNARE function RNA‐binding protein involved in the cleavage step of mRNA 3'‐end formation prior to polyadenylation, and in snoRNA maturation; part of holo‐CPF subcomplex APT, which associates with 3'‐ends of snoRNA‐ and mRNA‐encoding genes 0.9342 0.0002
VPS60 YDR486C 0.9334 0.0002
NA YGR146C‐A Putative protein of unknown function
0.9322 0.0004
SPC19 YDR201W Essential subunit of the Dam1 complex (aka DASH complex), couples kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; also localized to nuclear side of spindle pole body 0.9291 0.0003
NA YCR108C 0.9270 0.0002
PRM9 YAR031W Putative protein of unknown function; identified by fungal homology and RT‐PCR Pheromone‐regulated protein with 3 predicted transmembrane segments and an FF sequence, a motif involved in COPII binding; member of DUP240 gene family 0.9258 0.0002
AAD14 YNL331C Putative aryl‐alcohol dehydrogenase with similarity to P. chrysosporium aryl‐alcohol dehydrogenase; mutational analysis has not yet revealed a physiological role 0.9206 0.0002
CRG1 YHR209W 0.9196 0.0003
QRI1 YDL103C mRNA binding protein and putative S‐adenosylmethionine‐
dependent methyltransferase; mediates cantharidin resistance UDP‐N‐acetylglucosamine pyrophosphorylase, catalyzes the formation of UDP‐N‐acetylglucosamine (UDP‐GlcNAc), which is important in cell wall biosynthesis, protein N‐glycosylation, and GPI anchor biosynthesis 0.9185 0.0002
Cytoplasmic and vacuolar membrane protein involved in late endosome to vacuole transport; required for normal filament maturation during pseudohyphal growth; may function in targeting cargo proteins for degradation; interacts with Vta1p 166
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Subunit of TFIIH and nucleotide excision repair factor 3 complexes, involved in transcription initiation, required for nucleotide excision repair; ring finger protein similar to mammalian CAK and TFIIH subunit 0.9177 0.0002
YDR058C Triacylglycerol lipase that is localized to the mitochondria; has lipolytic activity towards triacylglycerols and diacylglycerols when expressed in E. coli 0.9150 0.0004
TAF10 YDR167W 0.9088 0.0009
ADE17 YMR120C Subunit (145 kDa) of TFIID and SAGA complexes, involved in RNA polymerase II transcription initiation and in chromatin modification Enzyme of 'de novo' purine biosynthesis containing both 5‐
aminoimidazole‐4‐carboxamide ribonucleotide transformylase and inosine monophosphate cyclohydrolase activities, isozyme of Ade16p; ade16 ade17 mutants require adenine and histidine 0.9074 0.0002
MCT1 YOR221C Predicted malonyl‐CoA:ACP transferase, putative component of a type‐II mitochondrial fatty acid synthase that produces intermediates for phospholipid remodeling 0.9028 0.0002
NA YDR514C Putative protein of unknown function
0.8995 0.0009
NA YNL195C 0.8991 0.0004
NA YDR056C Putative protein of unknown function; shares a promoter with YNL194C; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the endoplasmic reticulum; YDR056C is not an essential protein 0.8946 0.0002
NA YAL064W 0.8929 0.0003
NA YPL071C Protein of unknown function; may interact with ribosomes, based on co‐purification experiments Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus 0.8918 0.0004
PTP1 YDL230W Phosphotyrosine‐specific protein phosphatase that dephosphorylates a broad range of substrates in vivo, including Fpr3p; localized to the cytoplasm and the mitochondria 0.8882 0.0002
APA2 YDR530C Diadenosine 5',5''‐P1,P4‐tetraphosphate phosphorylase II (AP4A phosphorylase), involved in catabolism of bis(5'‐nucleosidyl) tetraphosphates; has similarity to Apa1p 0.8841 0.0002
PEP7 YDR323C Multivalent adaptor protein that facilitates vesicle‐mediated vacuolar protein sorting by ensuring high‐fidelity vesicle docking and fusion, which are essential for targeting of vesicles to the endosome; required for vacuole inheritance 0.8804 0.0007
ADE4 YMR300C Phosphoribosylpyrophosphate amidotransferase (PRPPAT; amidophosphoribosyltransferase), catalyzes first step of the 'de novo' purine nucleotide biosynthetic pathway 0.8738 0.0007
RAM1 YDL090C Beta subunit of the CAAX farnesyltransferase (FTase) that prenylates the a‐factor mating pheromone and Ras proteins; required for the membrane localization of Ras proteins and a‐factor; homolog of the mammalian FTase beta subunit 0.8734 0.0002
DOS2 YDR068W 0.8733 0.0002
KIN1 YDR122W Protein of unknown function, green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm Serine/threonine protein kinase involved in regulation of exocytosis; localizes to the cytoplasmic face of the plasma membrane; closely related to Kin2p 0.8690 0.0006
VMS1 YDR049W 0.8680 0.0002
Symbols ORF Description TFB3 YDR460W TGL2 Zinc finger protein, forms a mitochondrially‐associated complex with Cdc48p and Npl4p under oxidative stress that is required for ubiquitin‐mediated mitochondria‐associated protein degradation (MAD); conserved in C. elegans and human 167
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Putative protein of unknown function; identified by fungal homology and RT‐PCR Protein of unknown function that may interact with ribosomes, based on co‐purification experiments; Myb‐like DNA‐binding protein that may bind to the Ter region of rDNA; interacts physically with Fob1p 0.8669 0.0009
0.8669 0.0003
YDL194W Plasma membrane low glucose sensor that regulates glucose transport; contains 12 predicted transmembrane segments and a long C‐terminal tail required for induction of hexose transporters; also senses fructose and mannose; similar to Rgt2p 0.8669 0.0003
NRG1 YDR043C Transcriptional repressor that recruits the Cyc8p‐Tup1p complex to promoters; mediates glucose repression and negatively regulates a variety of processes including filamentous growth and alkaline pH response 0.8664 0.0009
QCR2 YPR191W Subunit 2 of the ubiquinol cytochrome‐c reductase complex, which is a component of the mitochondrial inner membrane electron transport chain; phosphorylated; transcription is regulated by Hap1p, Hap2p/Hap3p, and heme 0.8652 0.0003
NBP2 YDR162C Protein involved in the HOG (high osmolarity glycerol) pathway, negatively regulates Hog1p by recruitment of phosphatase Ptc1p the Pbs2p‐Hog1p complex, found in the nucleus and cytoplasm, contains an SH3 domain that binds Pbs2p 0.8637 0.0003
DAL4 YIR028W Allantoin permease; expression sensitive to nitrogen catabolite repression and induced by allophanate, an intermediate in allantoin degradation 0.8630 0.0007
NA YDR179W‐A Putative protein of unknown function
0.8618 0.0004
DAD1 YDR016C Essential subunit of the Dam1 complex (aka DASH complex), couples kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; is transferred to the kinetochore prior to mitosis 0.8603 0.0006
NA YDR262W Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the vacuole and is induced in response to the DNA‐damaging agent MMS; gene expression increases in response to Zymoliase treatment 0.8577 0.0003
ATG10 YLL042C 0.8574 0.0008
YPD1 YDL235C Conserved E2‐like conjugating enzyme that mediates formation of the Atg12p‐Atg5p conjugate, which is a critical step in autophagy Phosphorelay intermediate protein, phosphorylated by the plasma membrane sensor Sln1p in response to osmotic stress and then in turn phosphorylates the response regulators Ssk1p in the cytosol and Skn7p in the nucleus 0.8542 0.0004
NA YJL144W Cytoplasmic hydrophilin of unknown function, possibly involved in the dessication response; expression induced by osmotic stress, starvation and during stationary phase; GFP‐fusion protein is induced by the DNA‐damaging agent MMS 0.8533 0.0004
DPB4 YDR121W 0.8505 0.0009
NA YHL048C‐A 0.8493 0.0006
NA YDR131C 0.8471 0.0002
RAV2 YDR202C Shared subunit of DNA polymerase (II) epsilon and of ISW2/yCHRAC chromatin accessibility complex; involved in both chromosomal DNA replication and in inheritance of telomeric silencing Putative protein of unknown function; identified by expression profiling and mass spectrometry F‐box protein, substrate‐specific adaptor subunit that recruits substrates to a core ubiquitination complex Subunit of RAVE (Rav1p, Rav2p, Skp1p), a complex that associates with the V1 domain of the vacuolar membrane (H+)‐ATPase (V‐
ATPase) and promotes assembly and reassembly of the holoenzyme 0.8461 0.0003
Symbols ORF Description NA YDR246W‐A NA YDR026C SNF3 168
log2(mtr10
.Tf/WT.Tf) adj.p.va
l ATPase involved in protein folding and the response to stress; plays a role in SRP‐dependent cotranslational protein‐membrane targeting and translocation; member of the heat shock protein 70 (HSP70) family; localized to the cytoplasm 0.8460 0.0005
YJR022W Lsm (Like Sm) protein; forms heteroheptameric complex (with Lsm2p, Lsm3p, Lsm4p, Lsm5p, Lsm6p, and Lsm7p) that is part of spliceosomal U6 snRNP and is also implicated in processing of pre‐
tRNA, pre‐snoRNA, and pre‐rRNA 0.8442 0.0009
CKS1 YBR135W Cyclin‐dependent protein kinase regulatory subunit and adaptor; modulates proteolysis of M‐phase targets through interactions with the proteasome; role in transcriptional regulation, recruiting proteasomal subunits to target gene promoters 0.8431 0.0003
NA YIL082W‐A Retrotransposon TYA Gag and TYB Pol genes; transcribed/translated as one unit; polyprotein is processed to make a nucleocapsid‐like protein (Gag), reverse transcriptase (RT), protease (PR), and integrase (IN); similar to retroviral genes 0.8429 0.0004
PEX19 YDL065C Chaperone and import receptor for newly‐synthesized class I peroxisomal membrane proteins (PMPs), binds PMPs in the cytoplasm and delivers them to the peroxisome for subsequent insertion into the peroxisomal membrane 0.8410 0.0008
DAL3 YIR032C Ureidoglycolate hydrolase, converts ureidoglycolate to glyoxylate and urea in the third step of allantoin degradation; expression sensitive to nitrogen catabolite repression 0.8359 0.0005
NA YDL086W 0.8359 0.0003
NA YOL155W‐A 0.8341 0.0003
OCA6 YDR067C Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies; YDL086W is not an essential gene Putative protein of unknown function; identified by expression profiling and mass spectrometry Cytoplasmic protein required for replication of Brome mosaic virus in S. cerevisiae, which is a model system for studying positive‐strand RNA virus replication; null mutation confers sensitivity to tunicamycin and DTT 0.8333 0.0002
SNU23 YDL098C 0.8318 0.0004
SDC1 YDR469W Component of U4/U6.U5 snRNP involved in mRNA splicing via spliceosome Subunit of the COMPASS (Set1C) complex, which methylates lysine 4 of histone H3 and is required in chromatin silencing at telomeres; contains a Dpy‐30 domain that mediates interaction with Bre2p; similar to C. elegans and human DPY‐30 0.8307 0.0008
CDC7 YDL017W DDK (Dbf4‐dependent kinase) catalytic subunit required for firing origins and replication fork progression in S phase through phosphorylation of Mcm2‐7p complexes and Cdc45p; kinase activity correlates with cyclical DBF4 expression 0.8304 0.0003
PDS1 YDR113C Securin, inhibits anaphase by binding separin Esp1p; blocks cyclin destruction and mitotic exit, essential for meiotic progression and mitotic cell cycle arrest; localization is cell‐cycle dependent and regulated by Cdc28p phosphorylation 0.8265 0.0004
IPK1 YDR315C Inositol 1,3,4,5,6‐pentakisphosphate 2‐kinase, nuclear protein required for synthesis of 1,2,3,4,5,6‐hexakisphosphate (phytate), which is integral to cell function; has 2 motifs conserved in other fungi; ipk1 gle1 double mutant is inviable 0.8220 0.0009
REG1 YDR028C Regulatory subunit of type 1 protein phosphatase Glc7p, involved in negative regulation of glucose‐repressible genes 0.8218 0.0004
Symbols ORF Description SSA3 YBL075C LSM8 169
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Ubiquitin‐conjugating enzyme that mediates selective degradation of short‐lived and abnormal proteins; plays a role in vesicle biogenesis and ER‐associated protein degradation (ERAD); component of the cellular stress response 0.8193 0.0005
YDR125C Protein of unknown function, similar to Rlp24p
0.8192 0.0002
LYS9 YNR050C Saccharopine dehydrogenase (NADP+, L‐glutamate‐forming); catalyzes the formation of saccharopine from alpha‐aminoadipate 6‐
semialdehyde, the seventh step in lysine biosynthesis pathway; exhibits genetic and physical interactions with TRM112 0.8153 0.0007
EAF7 YNL136W 0.8142 0.0005
DIG2 YDR480W Subunit of the NuA4 histone acetyltransferase complex, which acetylates the N‐terminal tails of histones H4 and H2A MAP kinase‐responsive inhibitor of the Ste12p transcription factor, involved in the regulation of mating‐specific genes and the invasive growth pathway; related regulators Dig1p and Dig2p bind to Ste12p 0.8129 0.0004
ACN9 YDR511W Protein of the mitochondrial intermembrane space, required for acetate utilization and gluconeogenesis; has orthologs in higher eukaryotes 0.8123 0.0003
HIS4 YCL030C Multifunctional enzyme containing phosphoribosyl‐ATP pyrophosphatase, phosphoribosyl‐AMP cyclohydrolase, and histidinol dehydrogenase activities; catalyzes the second, third, ninth and tenth steps in histidine biosynthesis 0.8070 0.0003
RBS1 YDL189W 0.8008 0.0003
SSF2 YDR312W 0.8005 0.0006
DLD2 YDL178W Protein of unknown function, identified as a high copy suppressor of psk1 psk2 mutations that confer temperature‐sensitivity for galactose utilization; proposed to bind single‐stranded nucleic acids via its R3H domain Protein required for ribosomal large subunit maturation, functionally redundant with Ssf1p; member of the Brix family D‐lactate dehydrogenase, located in the mitochondrial matrix
0.7929 0.0008
SMD3 YLR147C Core Sm protein Sm D3; part of heteroheptameric complex (with Smb1p, Smd1p, Smd2p, Sme1p, Smx3p, and Smx2p) that is part of the spliceosomal U1, U2, U4, and U5 snRNPs; homolog of human Sm D3 0.7861 0.0008
SNM1 YDR478W Subunit of RNase MRP, which cleaves pre‐rRNA and has a role in cell cycle‐regulated degradation of daughter cell‐specific mRNAs; binds to the NME1 RNA subunit of RNase MRP 0.7850 0.0004
PRM5 YIL117C 0.7824 0.0005
UFD2 YDL190C Pheromone‐regulated protein, predicted to have 1 transmembrane segment; induced during cell integrity signaling Ubiquitin chain assembly factor (E4) that cooperates with a ubiquitin‐activating enzyme (E1), a ubiquitin‐conjugating enzyme (E2), and a ubiquitin protein ligase (E3) to conjugate ubiquitin to substrates; also functions as an E3 0.7821 0.0007
SSP1 YHR184W Protein involved in the control of meiotic nuclear division and coordination of meiosis with spore formation; transcription is induced midway through meiosis 0.7797 0.0004
MRP10 YDL045W‐A 0.7797 0.0004
PTC1 YDL006W Mitochondrial ribosomal protein of the small subunit; contains twin cysteine‐x9‐cysteine motifs Type 2C protein phosphatase (PP2C); dephosphorylates Hog1p, inactivating osmosensing MAPK cascade; involved in Fus3p activation during pheromone response; deletion affects precursor tRNA splicing, mitochondrial inheritance, and sporulation 0.7767 0.0003
Symbols ORF Description UBC1 YDR177W ECM18 170
log2(mtr10
.Tf/WT.Tf) adj.p.va
l GTPase‐activating protein for the polarity‐establishment protein Cdc42p; implicated in control of septin organization, pheromone response, and haploid invasive growth; regulated by Pho85p and Cdc28p 0.7750 0.0009
YDR027C Component of the GARP (Golgi‐associated retrograde protein) complex, Vps51p‐Vps52p‐Vps53p‐Vps54p, which is required for the recycling of proteins from endosomes to the late Golgi; potentially phosphorylated by Cdc28p 0.7746 0.0003
GCD6 YDR211W Catalytic epsilon subunit of the translation initiation factor eIF2B, the guanine‐nucleotide exchange factor for eIF2; activity subsequently regulated by phosphorylated eIF2; first identified as a negative regulator of GCN4 expression 0.7711 0.0006
MCM21 YDR318W Protein involved in minichromosome maintenance; component of the COMA complex (Ctf19p, Okp1p, Mcm21p, Ame1p) that bridges kinetochore subunits that are in contact with centromeric DNA and the subunits bound to microtubules 0.7708 0.0009
KIN28 YDL108W Serine/threonine protein kinase, subunit of the transcription factor TFIIH; involved in transcription initiation at RNA polymerase II promoters 0.7704 0.0002
JNM1 YMR294W Component of the yeast dynactin complex, consisting of Nip100p, Jnm1p, and Arp1p; required for proper nuclear migration and spindle partitioning during mitotic anaphase B 0.7699 0.0008
COX20 YDR231C 0.7690 0.0004
HEM13 YDR044W Mitochondrial inner membrane protein, required for proteolytic processing of Cox2p and its assembly into cytochrome c oxidase Coproporphyrinogen III oxidase, an oxygen requiring enzyme that catalyzes the sixth step in the heme biosynthetic pathway; transcription is repressed by oxygen and heme (via Rox1p and Hap1p) 0.7686 0.0006
STP1 YDR463W Transcription factor, undergoes proteolytic processing by SPS (Ssy1p‐
Ptr3p‐Ssy5p)‐sensor component Ssy5p in response to extracellular amino acids; activates transcription of amino acid permease genes and may have a role in tRNA processing 0.7677 0.0004
SWA2 YDR320C 0.7654 0.0009
AIR2 YDL175C Auxilin‐like protein involved in vesicular transport; clathrin‐binding protein required for uncoating of clathrin‐coated vesicles Zinc knuckle protein, involved in nuclear RNA processing and degredation as a component of the TRAMP complex; stimulates the poly(A) polymerase activity of Pap2p in vitro; functionally redundant with Air1p 0.7639 0.0004
DET1 YDR051C Acid phosphatase involved in the non‐vesicular transport of sterols in both directions between the endoplasmic reticulum and plasma membrane; deletion confers sensitivity to nickel 0.7615 0.0004
COX9 YDL067C 0.7525 0.0003
DUN1 YDL101C Subunit VIIa of cytochrome c oxidase, which is the terminal member of the mitochondrial inner membrane electron transport chain Cell‐cycle checkpoint serine‐threonine kinase required for DNA damage‐induced transcription of certain target genes, phosphorylation of Rad55p and Sml1p, and transient G2/M arrest after DNA damage; also regulates postreplicative DNA repair 0.7516 0.0006
NA YDL012C Tail‐anchored plasma membrane protein containing a conserved CYSTM module, possibly involved in response to stress; may contribute to non‐homologous end‐joining (NHEJ) based on ydl012c htz1 double null phenotype 0.7508 0.0003
PAU14 YIL176C Protein of unknown function, member of the seripauperin multigene family encoded mainly in subtelomeric regions; identical to Pau1p 0.7465 0.0005
Symbols ORF Description RGA2 YDR379W VPS54 171
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Subunit of a heterodimeric nuclear SUMO activating enzyme (E1) with Aos1p; activates Smt3p (SUMO) before its conjugation to proteins (sumoylation), which may play a role in protein targeting; essential for viability 0.7462 0.0003
YDR059C Ubiquitin‐conjugating enzyme that mediates selective degradation of short‐lived, abnormal, or excess proteins, including histone H3; central component of the cellular stress response; expression is heat inducible 0.7460 0.0008
SPO13 YHR014W Meiosis‐specific protein, involved in maintaining sister chromatid cohesion during meiosis I as well as promoting proper attachment of kinetochores to the spindle during meiosis I and meiosis II 0.7424 0.0009
FRQ1 YDR373W N‐myristoylated calcium‐binding protein that may have a role in intracellular signaling through its regulation of the phosphatidylinositol 4‐kinase Pik1p; member of the recoverin/frequenin branch of the EF‐hand superfamily 0.7416 0.0003
NPL3 YDR432W RNA‐binding protein that promotes elongation, regulates termination, and carries poly(A) mRNA from nucleus to cytoplasm; required for pre‐mRNA splicing; dissociation from mRNAs promoted by Mtr10p; phosphorylated by Sky1p in the cytoplasm 0.7413 0.0003
Symbols ORF Description UBA2 YDR390C UBC5 MRPL28 YDR462W Mitochondrial ribosomal protein of the large subunit
0.7407 0.0004
GIC2 YDR309C Redundant rho‐like GTPase Cdc42p effector; homolog of Gic1p; involved in initiation of budding and cellular polarization; interacts with Cdc42p via the Cdc42/Rac‐interactive binding (CRIB) domain and with PI(4,5)P2 via a polybasic region 0.7396 0.0004
GIR2 YDR152W Highly‐acidic cytoplasmic RWD domain‐containing protein of unknown function; forms a complex with Rbg2p; interacts with Rbg1p and Gcn1p; associates with translating ribosomes; putative intrinsically unstructured protein 0.7382 0.0007
STE7 YDL159W Signal transducing MAP kinase kinase involved in pheromone response, where it phosphorylates Fus3p, and in the pseudohyphal/invasive growth pathway, through phosphorylation of Kss1p; phosphorylated by Ste11p, degraded by ubiquitin pathway 0.7365 0.0004
PDC2 YDR081C Transcription factor required for the synthesis of the glycolytic enzyme pyruvate decarboxylase, required for high level expression of both the THI and the PDC genes 0.7351 0.0003
APC4 YDR118W Subunit of the Anaphase‐Promoting Complex/Cyclosome (APC/C), which is a ubiquitin‐protein ligase required for degradation of anaphase inhibitors, including mitotic cyclins, during the metaphase/anaphase transition 0.7349 0.0004
GCS1 YDL226C ADP‐ribosylation factor GTPase activating protein (ARF GAP), involved in ER‐Golgi transport; shares functional similarity with Glo3p 0.7328 0.0010
NA YDL176W Protein of unknown function, predicted by computational methods to be involved in fructose‐1,6‐bisphosphatase (Fbp1p) degradation; interacts with components of the GID complex; YDL176W is not an essential gene 0.7307 0.0008
CWC2 YDL209C Member of the NineTeen Complex (NTC) that contains Prp19p and stabilizes U6 snRNA in catalytic forms of the spliceosome containing U2, U5, and U6 snRNAs; binds directly to U6 snRNA; similar to S. pombe Cwf2 0.7295 0.0006
OPT2 YPR194C Oligopeptide transporter; member of the OPT family, with potential orthologs in S. pombe and C. albicans; also plays a role in formation of mature vacuoles 0.7236 0.0008
172
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Dethiobiotin synthetase, catalyzes the third step in the biotin biosynthesis pathway; BIO4 is in a cluster of 3 genes (BIO3, BIO4, and BIO5) that mediate biotin synthesis; expression appears to be repressed at low iron levels 0.7226 0.0006
YDR251W Essential protein of unknown function; exhibits variable expression during colony morphogenesis; overexpression permits survival without protein phosphatase 2A, inhibits growth, and induces a filamentous phenotype 0.7219 0.0004
TRS23 YDR246W One of 10 subunits of the transport protein particle (TRAPP) complex of the cis‐Golgi which mediates vesicle docking and fusion; involved in endoplasmic reticulum (ER) to Golgi membrane traffic; human homolog is TRAPPC4 0.7207 0.0006
TMN2 YDR107C Protein with a role in cellular adhesion and filamentous growth; similar to Emp70p and Tmn3p; member of the evolutionarily conserved Transmembrane Nine family of proteins with nine membrane‐spanning segments 0.7190 0.0006
IVY1 YDR229W 0.7179 0.0004
NA YDR348C Phospholipid‐binding protein that interacts with both Ypt7p and Vps33p, may partially counteract the action of Vps33p and vice versa, localizes to the rim of the vacuole as cells approach stationary phase Protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cell periphery and bud neck; potential Cdc28p substrate 0.7140 0.0003
STN1 YDR082W Telomere end‐binding and capping protein, plays a key role with Pol12p in linking telomerase action with completion of lagging strand synthesis, and in a regulatory step required for telomere capping 0.7138 0.0005
PCF11 YDR228C mRNA 3' end processing factor, essential component of cleavage and polyadenylation factor IA (CF IA), involved in pre‐mRNA 3' end processing and in transcription termination; binds C‐terminal domain of largest subunit of RNA pol II (Rpo21p) 0.7107 0.0004
HDA2 YDR295C Subunit of a possibly tetrameric trichostatin A‐sensitive class II histone deacetylase complex containing an Hda1p homodimer and an Hda2p‐Hda3p heterodimer; involved in telomere maintenance 0.7102 0.0006
SPG1 YGR236C Protein required for survival at high temperature during stationary phase; not required for growth on nonfermentable carbon sources; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies 0.7072 0.0008
NA YGR067C 0.7071 0.0005
PBP4 YDL053C Putative protein of unknown function; contains a zinc finger motif similar to that of Adr1p Pbp1p binding protein, interacts strongly with Pab1p‐binding protein 1 (Pbp1p) in the yeast two‐hybrid system; also interacts with Lsm12p in a copurification assay 0.7068 0.0008
NA YGR226C Dubious open reading frame, unlikely to encode a protein; not conserved in closely related Saccharomyces species; overlaps significantly with a verified ORF, AMA1/YGR225W 0.7066 0.0009
RPC11 YDR045C RNA polymerase III subunit C11; mediates pol III RNA cleavage activity and is important for termination of transcription; homologous to TFIIS 0.7057 0.0005
SIZ1 YDR409W SUMO/Smt3 ligase that promotes the attachment of sumo (Smt3p; small ubiquitin‐related modifier) to proteins; binds Ubc9p and may bind septins; specifically required for sumoylation of septins in vivo; localized to the septin ring 0.7030 0.0003
Symbols ORF Description BIO4 YNR057C PAM1 173
log2(mtr10
.Tf/WT.Tf) adj.p.va
l 0.7028 0.0004
0.7024 0.0010
0.7013 0.0004
0.6979 0.0003
Bifunctional enzyme containing both alcohol dehydrogenase and glutathione‐dependent formaldehyde dehydrogenase activities, functions in formaldehyde detoxification and formation of long chain and complex alcohols, regulated by Hog1p‐Sko1p 0.6977 0.0004
YMR263W Subunit of a histone deacetylase complex, along with Rpd3p and Sin3p, that is involved in silencing at telomeres, rDNA, and silent mating‐type loci; involved in telomere maintenance 0.6971 0.0009
GRX3 YDR098C Hydroperoxide and superoxide‐radical responsive glutathione‐
dependent oxidoreductase; monothiol glutaredoxin subfamily member along with Grx4p and Grx5p; protects cells from oxidative damage 0.6967 0.0003
THI7 YLR237W Plasma membrane transporter responsible for the uptake of thiamine, member of the major facilitator superfamily of transporters; mutation of human ortholog causes thiamine‐
responsive megaloblastic anemia 0.6912 0.0006
NA YDR115W 0.6897 0.0009
GDH2 YDL215C Putative mitochondrial ribosomal protein of the large subunit, has similarity to E. coli L34 ribosomal protein; required for respiratory growth, as are most mitochondrial ribosomal proteins NAD(+)‐dependent glutamate dehydrogenase, degrades glutamate to ammonia and alpha‐ketoglutarate; expression sensitive to nitrogen catabolite repression and intracellular ammonia levels 0.6887 0.0004
SPT3 YDR392W Subunit of the SAGA and SAGA‐like transcriptional regulatory complexes, interacts with Spt15p to activate transcription of some RNA polymerase II‐dependent genes, also functions to inhibit transcription at some promoters 0.6878 0.0008
PCK1 YKR097W Phosphoenolpyruvate carboxykinase, key enzyme in gluconeogenesis, catalyzes early reaction in carbohydrate biosynthesis, glucose represses transcription and accelerates mRNA degradation, regulated by Mcm1p and Cat8p, located in the cytosol 0.6870 0.0003
PEX5 YDR244W Peroxisomal membrane signal receptor for the C‐terminal tripeptide signal sequence (PTS1) of peroxisomal matrix proteins, required for peroxisomal matrix protein import; also proposed to have PTS1‐
receptor independent functions 0.6823 0.0008
NTG2 YOL043C 0.6777 0.0004
GLE1 YDL207W DNA N‐glycosylase and apurinic/apyrimidinic (AP) lyase involved in base excision repair, localizes to the nucleus; sumoylated Cytoplasmic nucleoporin required for polyadenylated RNA export but not for protein import; component of Nup82p nuclear pore subcomplex; contains a nuclear export signal 0.6772 0.0004
GPR1 YDL035C Plasma membrane G protein coupled receptor (GPCR) that interacts with the heterotrimeric G protein alpha subunit, Gpa2p, and with Plc1p; sensor that integrates nutritional signals with the modulation of cell fate via PKA and cAMP synthesis 0.6758 0.0005
Symbols ORF Description TMS1 YDR105C YSP2 YDR326C GIP2 YER054C ENT1 YDL161W Vacuolar membrane protein of unknown function that is conserved in mammals; predicted to contain eleven transmembrane helices; interacts with Pdr5p, a protein involved in multidrug resistance Protein involved in programmed cell death; mutant shows resistance to cell death induced by amiodarone or intracellular acidification Putative regulatory subunit of the protein phosphatase Glc7p, involved in glycogen metabolism; contains a conserved motif (GVNK motif) that is also found in Gac1p, Pig1p, and Pig2p Epsin‐like protein involved in endocytosis and actin patch assembly and functionally redundant with Ent2p; binds clathrin via a clathrin‐
binding domain motif at C‐terminus SFA1 YDL168W SAP30 174
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Exosome non‐catalytic core component; involved in 3'‐5' RNA processing and degradation in both the nucleus and the cytoplasm; has similarity to E. coli RNase PH and to human hRrp42p (EXOSC7) 0.6737 0.0005
YNL146W Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the endoplasmic reticulum; YNL146W is not an essential gene 0.6725 0.0006
YSY6 YBR162W‐A Protein whose expression suppresses a secretory pathway mutation in E. coli; has similarity to the mammalian RAMP4 protein involved in secretion 0.6723 0.0010
NA YDR391C Putative protein of unknown function, possibly involved in zinc homeostasis; Bdf1p‐dependent transcription induced by salt stress; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus 0.6706 0.0004
SYF1 YDR416W Member of the NineTeen Complex (NTC) that contains Prp19p and stabilizes U6 snRNA in catalytic forms of the spliceosome containing U2, U5, and U6 snRNAs; null mutant has splicing defect and arrests in G2/M; homologs in human and C. elegans 0.6684 0.0007
MSL1 YIR009W U2B component of U2 snRNP, involved in splicing, binds the U2 snRNA stem‐loop IV in vitro but requires association of Lea1p for in vivo binding; does not contain the conserved C‐terminal RNA binding domain found in other family members 0.6682 0.0008
PSF1 YDR013W Subunit of the GINS complex (Sld5p, Psf1p, Psf2p, Psf3p), which is localized to DNA replication origins and implicated in assembly of the DNA replication machinery 0.6675 0.0005
SPO12 YHR152W 0.6662 0.0003
NA YDL157C Nucleolar protein of unknown function, positive regulator of mitotic exit; involved in regulating release of Cdc14p from the nucleolus in early anaphase, may play similar role in meiosis Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies 0.6653 0.0007
ADE1 YAR015W 0.6634 0.0006
PKH1 YDR490C N‐succinyl‐5‐aminoimidazole‐4‐carboxamide ribotide (SAICAR) synthetase, required for 'de novo' purine nucleotide biosynthesis; red pigment accumulates in mutant cells deprived of adenine Serine/threonine protein kinase involved in sphingolipid‐mediated signaling pathway that controls endocytosis; activates Ypk1p and Ykr2p, components of signaling cascade required for maintenance of cell wall integrity; redundant with Pkh2p 0.6596 0.0009
NA YCR076C 0.6595 0.0010
SLY1 YDR189W Putative protein of unknown function; YCR076C is not an essential gene Hydrophilic protein involved in vesicle trafficking between the ER and Golgi; SM (Sec1/Munc‐18) family protein that binds the tSNARE Sed5p and stimulates its assembly into a trans‐SNARE membrane‐
protein complex 0.6574 0.0007
PHO8 YDR481C Repressible alkaline phosphatase, a glycoprotein localized to the vacuole; regulated by levels of inorganic phosphate and by a system consisting of Pho4p, Pho9p, Pho80p, Pho81p and Pho85p; dephosphorylates phosphotyrosyl peptides 0.6553 0.0005
DAL2 YIR029W Allantoicase, converts allantoate to urea and ureidoglycolate in the second step of allantoin degradation; expression sensitive to nitrogen catabolite repression and induced by allophanate, an intermediate in allantoin degradation 0.6542 0.0008
PRM3 YPL192C Pheromone‐regulated protein required for nuclear envelope fusion during karyogamy; localizes to the outer face of the nuclear membrane; interacts with Kar5p at the spindle pole body 0.6539 0.0005
Symbols ORF Description RRP42 YDL111C NA 175
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Mitochondrial outer membrane protein, required for assembly of the translocase of the outer membrane (TOM) complex and thereby for mitochondrial protein import; N terminus is exposed to the cytosol: transmembrane segment is highly conserved 0.6496 0.0004
YDR108W Subunit of TRAPPIII (transport protein particle), a multimeric guanine nucleotide‐exchange factor for Ypt1p, required for membrane expansion during autophagy and the CVT pathway; directs Ypt1p to the PAS; late post‐replication meiotic role 0.6490 0.0007
MSS2 YDL107W Peripherally bound inner membrane protein of the mitochondrial matrix involved in membrane insertion of C‐terminus of Cox2p, interacts genetically and physically with Cox18p 0.6489 0.0009
DIF1 YLR437C Protein that regulates the nuclear localization of ribonucleotide reductase Rnr2p and Rnr4p subunits; phosphorylated by Dun1p in response to DNA damage and degraded; N‐terminal half has similarity to S. pombe Spd1 protein 0.6489 0.0008
NTG1 YAL015C DNA N‐glycosylase and apurinic/apyrimidinic (AP) lyase involved in base excision repair; acts in both nucleus and mitochondrion; creates a double‐strand break at mtDNA origins that stimulates replication in response to oxidative stress 0.6471 0.0005
PRP9 YDL030W Subunit of the SF3a splicing factor complex, required for spliceosome assembly; acts after the formation of the U1 snRNP‐
pre‐mRNA complex 0.6412 0.0005
SME1 YOR159C 0.6371 0.0005
SLX5 YDL013W Core Sm protein Sm E; part of heteroheptameric complex (with Smb1p, Smd1p, Smd2p, Smd3p, Smx3p, and Smx2p) that is part of the spliceosomal U1, U2, U4, and U5 snRNPs; homolog of human Sm E Subunit of the Slx5‐Slx8 SUMO‐targeted ubiquitin ligase (STUbL) complex, stimulated by SUMO‐modified substrates; contains a RING domain and two SIMs (SUMO‐interacting motifs); forms SUMO‐
dependent nuclear foci, including DNA repair centers 0.6345 0.0009
CRP1 YHR146W Protein that binds to cruciform DNA structures
0.6345 0.0004
FMP32 YFL046W Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies 0.6308 0.0006
SEC20 YDR498C Membrane glycoprotein v‐SNARE involved in retrograde transport from the Golgi to the ER; required for N‐ and O‐glycosylation in the Golgi but not in the ER; interacts with the Dsl1p complex through Tip20p 0.6284 0.0010
NA YDR061W Protein with similarity to ATP‐binding cassette (ABC) transporter family members; lacks predicted membrane‐spanning regions; transcriptionally activated by Yrm1p along with genes involved in multidrug resistance 0.6282 0.0009
CTH1 YDR151C 0.6258 0.0007
SLI15 YBR156C Member of the CCCH zinc finger family; has similarity to mammalian Tis11 protein, which activates transcription and also has a role in mRNA degradation; may function with Tis11p in iron homeostasis Subunit of the conserved chromosomal passenger complex (CPC; Ipl1p‐Sli15p‐Bir1p‐Nbl1p), which regulates kinetochore‐microtubule attachments, activation of the spindle tension checkpoint, and mitotic spindle disassembly 0.6227 0.0004
SOK1 YDR006C 0.6209 0.0007
Symbols ORF Description MIM1 YOL026C TRS85 Protein whose overexpression suppresses the growth defect of mutants lacking protein kinase A activity; involved in cAMP‐
mediated signaling; localized to the nucleus; similar to the mouse testis‐specific protein PBS13 176
log2(mtr10
.Tf/WT.Tf) adj.p.va
l Flavin adenine dinucleotide (FAD) synthetase, performs the second step in synthesis of FAD from riboflavin Transcription factor that stimulates expression of proteasome genes; Rpn4p levels are in turn regulated by the 26S proteasome in a negative feedback control mechanism; RPN4 is transcriptionally regulated by various stress responses 0.6176 0.0006
0.6161 0.0009
Protein of unknown function that associates with ribosomes; has a putative RNA binding domain; in mammals the corresponding protein, eIF2D, has been shown to possess translation initiation factor activity Mitochondrial ribosomal protein of the small subunit, has similarity to E. coli S10 ribosomal protein; essential for viability, unlike most other mitoribosomal proteins 0.6159 0.0007
0.6157 0.0009
YLR408C Putative protein of unknown function; likely member of BLOC complex involved in endosomal cargo sorting; green fluorescent protein (GFP)‐fusion protein localizes to the endosome; YLR408C is not an essential gene 0.6137 0.0005
NA YDR319C Putative protein of unknown function, identified as an ortholog of the highly conserved FIT family of proteins involved in triglyceride droplet biosynthesis; interacts with Sst2p and Hsp82p in high‐
throughput two‐hybrid screens 0.6133 0.0008
MTC5 YDR128W Protein of unknown function; mtc5 is synthetically sick with cdc13‐1 0.6131 0.0006
RAD30 YDR419W DNA polymerase eta, involved in translesion synthesis during post‐
replication repair; catalyzes the synthesis of DNA opposite cyclobutane pyrimidine dimers and other lesions; mutations in human pol eta are responsible for XPV 0.6125 0.0008
TFB1 YDR311W Subunit of TFIIH and nucleotide excision repair factor 3 complexes, required for nucleotide excision repair, target for transcriptional activators 0.6007 0.0005
Symbols ORF Description FAD1 YDL045C RPN4 YDL020C TMA64 YDR117C RSM10 YDR041W BLS1 177
APPENDIX I: Down-regulated genes in mtr10Δ
cells in amino acid starvation condition
This section includes the list of transcriptionally differentially expressed genes (cutoff
conditions: log2 FC
0.6 and adjusted p-value < 0.001) in mtr10Δ cells in amino acid
starved condition.
Down-regulated genes in mtr10Δ cells in amino acid starved condition
log2(mtr10.
Ts/WT.TS) adj.p.v
al Nuclear import receptor, mediates the nuclear localization of proteins involved in mRNA‐nucleus export; promotes dissociation of mRNAs from the nucleus‐cytoplasm mRNA shuttling protein Npl3p; required for retrograde import of mature tRNAs ‐6.5259 0.0000
YMR251W Omega class glutathione transferase; putative cytosolic localization
‐3.5739 0.0000
FCY21 YER060W ‐2.9267 0.0000
PNS1 YOR161C Putative purine‐cytosine permease, very similar to Fcy2p but cannot substitute for its function Protein of unknown function; has similarity to Torpedo californica tCTL1p, which is postulated to be a choline transporter, neither null mutation nor overexpression affects choline transport ‐2.9240 0.0000
NA YHR022C ‐2.8403 0.0000
QDR2 YIL121W Putative protein of unknown function; YHR022C is not an essential gene Multidrug transporter of the major facilitator superfamily, required for resistance to quinidine, barban, cisplatin, and bleomycin; may have a role in potassium uptake ‐2.7694 0.0000
NA FRE5 YHR140W YOR384W Putative integral membrane protein of unknown function
Putative ferric reductase with similarity to Fre2p; expression induced by low iron levels; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies ‐2.6771 ‐2.6487 0.0000
0.0005
ASG7 YJL170C Protein that regulates signaling from a G protein beta subunit Ste4p and its relocalization within the cell; specific to a‐cells and induced by alpha‐factor ‐2.6013 0.0001
NA YHL012W Putative protein of unknown function, has some homology to Ugp1p, which encodes UDP‐glucose pyrophosphorylase ‐2.5857 0.0000
Symbols ORF Description MTR10 YOR160W GTO3 178
log2(mtr10.
Ts/WT.TS) adj.p.v
al Meiosis‐specific DNA binding protein that displays Red1p dependent localization to the unsynapsed axial‐lateral elements of the synaptonemal complex; required for homologous chromosome synapsis and chiasma formation ‐2.5684 0.0001
YLR136C mRNA‐binding protein expressed during iron starvation; binds to a sequence element in the 3'‐untranslated regions of specific mRNAs to mediate their degradation; involved in iron homeostasis ‐2.5208 0.0003
ECM13 YBL043W ‐2.4759 0.0002
IRC15 YPL017C Non‐essential protein of unknown function; induced by treatment with 8‐methoxypsoralen and UVA irradiation Microtubule associated protein; regulates microtubule dynamics; required for accurate meiotic chromosome segregation; null mutant displays large budded cells due to delayed mitotic progression, increased levels of spontaneous Rad52 foci ‐2.4546 0.0000
FIT2 YOR382W Mannoprotein that is incorporated into the cell wall via a glycosylphosphatidylinositol (GPI) anchor, involved in the retention of siderophore‐iron in the cell wall ‐2.4289 0.0001
NA NA RGS2 NA NA YOR107W NA NA Negative regulator of glucose‐induced cAMP signaling; directly activates the GTPase activity of the heterotrimeric G protein alpha subunit Gpa2p ‐2.3974 ‐2.3489 ‐2.2947 0.0000
0.0001
0.0000
NA YHL044W Putative integral membrane protein, member of DUP240 gene family; green fluorescent protein (GFP)‐fusion protein localizes to the plasma membrane in a punctate pattern ‐2.2924 0.0000
BSC5 YNR069C Protein of unknown function, ORF exhibits genomic organization compatible with a translational readthrough‐dependent mode of expression ‐2.2588 0.0000
SFK1 YKL051W ‐2.2187 0.0000
NA YOL163W ‐2.2123 0.0002
BDH2 YAL061W ‐2.2117 0.0001
DCI1 YOR180C ‐2.0800 0.0000
FTR1 YER145C Plasma membrane protein that may act together with or upstream of Stt4p to generate normal levels of the essential phospholipid PI4P, at least partially mediates proper localization of Stt4p to the plasma membrane Putative protein of unknown function; member of the Dal5p subfamily of the major facilitator family Putative medium‐chain alcohol dehydrogenase with similarity to BDH1; transcription induced by constitutively active PDR1 and PDR3 Peroxisomal protein; identification as a delta(3,5)‐delta(2,4)‐dienoyl‐
CoA isomerase involved in fatty acid metabolism is disputed High affinity iron permease involved in the transport of iron across the plasma membrane; forms complex with Fet3p; expression is regulated by iron ‐2.0392 0.0001
ARN1 YHL040C ‐1.9903 0.0000
PTH1 YHR189W ‐1.9587 0.0004
RSB1 YOR049C Transporter, member of the ARN family of transporters that specifically recognize siderophore‐iron chelates; responsible for uptake of iron bound to ferrirubin, ferrirhodin, and related siderophores One of two (see also PTH2) mitochondrially‐localized peptidyl‐tRNA hydrolases; dispensable for respiratory growth on rich medium, but required for respiratory growth on minimal medium Suppressor of sphingoid long chain base (LCB) sensitivity of an LCB‐
lyase mutation; putative integral membrane transporter or flippase that may transport LCBs from the cytoplasmic side toward the extracytoplasmic side of the membrane ‐1.9518 0.0001
ENT4 YLL038C ‐1.9459 0.0002
Symbols ORF Description HOP1 YIL072W TIS11 Protein of unknown function, contains an N‐terminal epsin‐like domain; proposed to be involved in the trafficking of Arn1p in the absence of ferrichrome 179
log2(mtr10.
Ts/WT.TS) adj.p.v
al Cell wall mannoprotein that localizes specifically to birth scars of daughter cells, linked to a beta‐1,3‐ and beta‐1,6‐glucan heteropolymer through a phosphodiester bond; required for propionic acid resistance ‐1.9204 0.0001
Transporter, member of the ARN family of transporters that specifically recognize siderophore‐iron chelates; responsible for uptake of iron bound to the siderophore triacetylfusarinine C Phosphoglucomutase, catalyzes the conversion from glucose‐1‐
phosphate to glucose‐6‐phosphate, which is a key step in hexose metabolism; functions as the acceptor for a Glc‐phosphotransferase Putative GPI protein
Peroxisomal 2,4‐dienoyl‐CoA reductase, auxiliary enzyme of fatty acid beta‐oxidation; homodimeric enzyme required for growth and sporulation on petroselineate medium; expression induced during late sporulation and in the presence of oleate ‐1.9007 0.0002
‐1.8989 0.0000
‐1.8971 ‐1.8932 0.0000
0.0000
YHL018W Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to mitochondria and is induced in response to the DNA‐damaging agent MMS ‐1.8807 0.0001
VPS73 YGL104C ‐1.8740 0.0001
VMR1 YHL035C Mitochondrial protein; mutation affects vacuolar protein sorting; putative transporter; member of the sugar porter family Vacuolar membrane protein involved in multiple drug resistance and metal sensitivity; ATP‐binding cassette (ABC) family member involved in drug transport; potential Cdc28p substrate; induced under respiratory conditions ‐1.8671 0.0000
ICS2 YBR157C Protein of unknown function; null mutation does not confer any obvious defects in growth, spore germination, viability, or carbohydrate utilization ‐1.8568 0.0001
SAP4 YGL229C ‐1.8559 0.0000
BAR1 YIL015W ‐1.8466 0.0002
NRT1 YOR071C ‐1.8354 0.0001
NA YPL113C ‐1.8255 0.0001
MAL13 YGR288W ‐1.8198 0.0001
FIT3 YOR383C Protein required for function of the Sit4p protein phosphatase, member of a family of similar proteins that form complexes with Sit4p, including Sap155p, Sap185p, and Sap190p Aspartyl protease secreted into the periplasmic space of mating type a cells, helps cells find mating partners, cleaves and inactivates alpha factor allowing cells to recover from alpha‐factor‐induced cell cycle arrest High‐affinity nicotinamide riboside transporter; also transports thiamine with low affinity; shares sequence similarity with Thi7p and Thi72p; proposed to be involved in 5‐fluorocytosine sensitivity Glyoxylate reductase; acts on glyoxylate and hydroxypyruvate substrates; YPL113C is not an essential gene MAL‐activator protein, part of complex locus MAL1; nonfunctional in genomic reference strain S288C Mannoprotein that is incorporated into the cell wall via a glycosylphosphatidylinositol (GPI) anchor, involved in the retention of siderophore‐iron in the cell wall ‐1.8045 0.0002
CMC4 YMR194C‐
B Protein that localizes to the mitochondrial intermembrane space via the Mia40p‐Erv1p system; contains twin cysteine‐x(9)‐cysteine motifs ‐1.8038 0.0000
AAR2 YBL074C ‐1.7559 0.0000
FRE8 YLR047C Component of the U5 snRNP, required for splicing of U3 precursors; originally described as a splicing factor specifically required for splicing pre‐mRNA of the MATa1 cistron Protein with sequence similarity to iron/copper reductases, involved in iron homeostasis; deletion mutant has iron deficiency/accumulation growth defects; expression increased in the absence of copper‐responsive transcription factor Mac1p ‐1.7489 0.0006
Symbols ORF Description CWP1 YKL096W ARN2 YHL047C PGM2 YMR105C NA SPS19 YAR066W YNL202W NA 180
log2(mtr10.
Ts/WT.TS) adj.p.v
al Receptor for alpha‐factor pheromone; seven transmembrane‐
domain GPCR that interacts with both pheromone and a heterotrimeric G protein to initiate the signaling response that leads to mating between haploid a and alpha cells ‐1.7461 0.0003
Protein of unknown function, member of the DUP380 subfamily of conserved, often subtelomerically‐encoded proteins Putative protein of unknown function; non‐essential gene identified in a screen for mutants with increased levels of rDNA transcription; contains two putative transmembrane spans, but no significant homology to other known proteins ‐1.7450 0.0000
‐1.7288 0.0003
YCR100C YKL217W Putative protein of unknown function
Lactate transporter, required for uptake of lactate and pyruvate; phosphorylated; expression is derepressed by transcriptional activator Cat8p during respiratory growth, and repressed in the presence of glucose, fructose, and mannose ‐1.7260 ‐1.7220 0.0001
0.0003
PPT2 YPL148C Phosphopantetheine:protein transferase (PPTase), activates mitochondrial acyl carrier protein (Acp1p) by phosphopantetheinylation ‐1.6967 0.0000
PMA2 YPL036W Plasma membrane H+‐ATPase, isoform of Pma1p, involved in pumping protons out of the cell; regulator of cytoplasmic pH and plasma membrane potential ‐1.6932 0.0000
RDS1 YCR106W ‐1.6585 0.0001
NA YJR154W ‐1.6521 0.0000
FRE2 YKL220C ‐1.6436 0.0000
TPO4 YOR273C Zinc cluster transcription factor involved in conferring resistance to cycloheximide Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm Ferric reductase and cupric reductase, reduces siderophore‐bound iron and oxidized copper prior to uptake by transporters; expression induced by low iron levels but not by low copper levels Polyamine transport protein, recognizes spermine, putrescine, and spermidine; localizes to the plasma membrane; member of the major facilitator superfamily ‐1.6415 0.0000
STE3 YKL178C Receptor for a factor pheromone, couples to MAP kinase cascade to mediate pheromone response; transcribed in alpha cells and required for mating by alpha cells, ligand bound receptors endocytosed and recycled to the plasma membrane; GPCR ‐1.6289 0.0000
ENB1 YOL158C Endosomal ferric enterobactin transporter, expressed under conditions of iron deprivation; member of the major facilitator superfamily; expression is regulated by Rcs1p and affected by chloroquine treatment ‐1.6237 0.0001
NA YLR152C ‐1.6226 0.0000
PRM1 YNL279W Putative protein of unknown function; YLR152C is not an essential gene Pheromone‐regulated multispanning membrane protein involved in membrane fusion during mating; predicted to have 5 transmembrane segments and a coiled coil domain; localizes to the shmoo tip; regulated by Ste12p ‐1.6171 0.0002
GEM1 YAL048C Evolutionarily‐conserved tail‐anchored outer mitochondrial membrane GTPase which regulates mitochondrial morphology; cells lacking Gem1p contain collapsed, globular, or grape‐like mitochondria; not required for pheromone‐induced cell death ‐1.6141 0.0001
PEX18 YHR160C Peroxin required for targeting of peroxisomal matrix proteins containing PTS2; interacts with Pex7p; partially redundant with Pex21p ‐1.5940 0.0002
Symbols ORF Description STE2 YFL026W COS9 YKL219W RRT6 YGL146C NA JEN1 181
log2(mtr10.
Ts/WT.TS) adj.p.v
al GTPase‐activating protein for Gpa1p, regulates desensitization to alpha factor pheromone; also required to prevent receptor‐
independent signaling of the mating pathway; member of the RGS (regulator of G‐protein signaling) family Glycogen synthase with similarity to Gsy2p, the more highly expressed yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary phase ‐1.5914 0.0002
‐1.5879 0.0001
Ceramide synthase component, involved in synthesis of ceramide from C26(acyl)‐coenzyme A and dihydrosphingosine or phytosphingosine, functionally equivalent to Lac1p Serine‐rich protein that contains a basic‐helix‐loop‐helix (bHLH) DNA binding motif; binds E‐boxes of glycolytic genes and contributes to their activation; may function as a transcriptional activator in Ty1‐
mediated gene expression Ferrioxamine B transporter, member of the ARN family of transporters that specifically recognize siderophore‐iron chelates; transcription is induced during iron deprivation and diauxic shift; potentially phosphorylated by Cdc28p ‐1.5733 0.0000
‐1.5672 0.0001
‐1.5529 0.0004
YEL048C Protein that interacts with subunits of the TRAPP complex and may play a role its assembly or stability; mutation is synthetically lethal with gcs1 deletion; Sedlin_N family member; human Sedlin mutations cause the skeletal disorder SEDT ‐1.5262 0.0001
0.0006
‐1.5230 0.0005
SCS7 YMR272C ‐1.5021 0.0000
FCY22 ‐1.5015 0.0001
NFT1 YER060W‐
A YKR103W ‐1.5011 0.0006
PPM2 YOL141W Putative protein of unknown function; identified by fungal homology and RT‐PCR NADP(+)‐dependent glutamate dehydrogenase, synthesizes glutamate from ammonia and alpha‐ketoglutarate; rate of alpha‐
ketoglutarate utilization differs from Gdh1p; expression regulated by nitrogen and carbon sources Sphingolipid alpha‐hydroxylase, functions in the alpha‐hydroxylation of sphingolipid‐associated very long chain fatty acids, has both cytochrome b5‐like and hydroxylase/desaturase domains, not essential for growth Putative purine‐cytosine permease, very similar to Fcy2p but cannot substitute for its function Putative transporter of the multidrug resistance‐associated protein (MRP) subfamily; adjacent ORFs YKR103W and YKR104W are merged in different strain backgrounds. AdoMet‐dependent tRNA methyltransferase also involved in methoxycarbonylation; required for the synthesis of wybutosine (yW), a modified guanosine found at the 3'‐position adjacent to the anticodon of phe‐tRNA; similarity to Ppm1p ‐1.5260 GDH3 YOR316C‐
A YAL062W ‐1.4985 0.0001
SDP1 YIL113W Stress‐inducible dual‐specificity MAP kinase phosphatase, negatively regulates Slt2p MAP kinase by direct dephosphorylation, diffuse localization under normal conditions shifts to punctate localization after heat shock ‐1.4830 0.0006
NA YCR061W ‐1.4802 0.0001
NA YJL160C Protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern; induced by treatment with 8‐methoxypsoralen and UVA irradiation Putative protein of unknown function; member of the PIR (proteins with internal repeats) family of cell wall proteins; non‐essential gene that is required for sporulation; mRNA is weakly cell cycle regulated, peaking in mitosis ‐1.4756 0.0002
CRC1 YOR100C ‐1.4702 0.0001
Symbols ORF Description SST2 YLR452C GSY1 YFR015C LAG1 YHL003C TYE7 YOR344C SIT1 YEL065W TCA17 NA Mitochondrial inner membrane carnitine transporter, required for carnitine‐dependent transport of acetyl‐CoA from peroxisomes to mitochondria during fatty acid beta‐oxidation 182
log2(mtr10.
Ts/WT.TS) adj.p.v
al Member of the multi‐drug and toxin extrusion (MATE) family of the multidrug/oligosaccharidyl‐lipid/polysaccharide (MOP) exporter superfamily; overproduction confers ethionine resistance and accumulation of S‐adenosylmethionine ‐1.4639 0.0001
Transporter of thiamine or related compound; shares sequence similarity with Thi7p Repressor of G1 transcription that binds to SCB binding factor (SBF) at SCB target promoters in early G1; phosphorylation of Whi5p by the CDK, Cln3p/Cdc28p relieves repression and promoter binding by Whi5; periodically expressed in G1 ‐1.4613 0.0002
‐1.4612 0.0007
Essential protein required for pre‐mRNA splicing; associates transiently with the spliceosomal NTC ("nineteen complex") and acts after Prp2p to promote the first catalytic reaction of splicing ‐1.4600 0.0001
Ferro‐O2‐oxidoreductase required for high‐affinity iron uptake and involved in mediating resistance to copper ion toxicity, belongs to class of integral membrane multicopper oxidases Protein of unknown function; interacts weakly with Knr4p; YMR262W is not an essential gene Galactose‐1‐phosphate uridyl transferase, synthesizes glucose‐1‐
phosphate and UDP‐galactose from UDP‐D‐glucose and alpha‐D‐
galactose‐1‐phosphate in the second step of galactose catabolism ‐1.4573 0.0003
‐1.4455 0.0000
‐1.4409 0.0001
Putative protein of unknown function; non‐essential gene; interacts genetically with CHS5, a gene involved in chitin biosynthesis Putative divalent metal ion transporter involved in iron homeostasis; transcriptionally regulated by metal ions; member of the Nramp family of metal transport proteins ‐1.4402 0.0001
‐1.4194 0.0000
Putative paralog of ATR1, but not required for boron tolerance; identified as a heat‐induced gene in a high‐throughout screen; YMR279C is not an essential gene ‐1.4192 0.0000
YPL147W Subunit of a heterodimeric peroxisomal ATP‐binding cassette transporter complex (Pxa1p‐Pxa2p), required for import of long‐
chain fatty acids into peroxisomes; similarity to human adrenoleukodystrophy transporter and ALD‐related proteins ‐1.4104 0.0001
DCR2 YLR361C Phosphoesterase involved in downregulation of the unfolded protein response, at least in part via dephosphorylation of Ire1p; dosage‐
dependent positive regulator of the G1/S phase transition through control of the timing of START ‐1.3977 0.0001
NA YJL213W Protein of unknown function that may interact with ribosomes; periodically expressed during the yeast metabolic cycle; phosphorylated in vitro by the mitotic exit network (MEN) kinase complex, Dbf2p/Mob1p ‐1.3949 0.0000
ATG29 YPL166W Autophagy‐specific protein that is required for recruitment of other ATG proteins to the pre‐autophagosomal structure (PAS); interacts with Atg17p and localizas to the PAS in a manner interdependent with Atg17p and Cis1p; not conserved ‐1.3914 0.0002
SKN1 YGR143W ‐1.3789 0.0000
GSY2 YLR258W Protein involved in sphingolipid biosynthesis; type II membrane protein with similarity to Kre6p Glycogen synthase, similar to Gsy1p; expression induced by glucose limitation, nitrogen starvation, heat shock, and stationary phase; activity regulated by cAMP‐dependent, Snf1p and Pho85p kinases as well as by the Gac1p‐Glc7p phosphatase ‐1.3707 0.0003
Symbols ORF Description ERC1 YHR032W THI72 YOR192C WHI5 YOR083W YJU2 YKL095W FET3 YMR058W NA YMR262W GAL7 YBR018C NA YGL081W SMF3 YLR034C NA YMR279C PXA1 183
log2(mtr10.
Ts/WT.TS) adj.p.v
al Putative protein of unknown function with similarity to hexokinases; transcript is upregulated during sporulation and the unfolded protein response; YLR446W is not an essential gene ‐1.3653 0.0000
YHR105W Endosomal protein of unknown function that contains a phox (PX) homology domain and binds to both phosphatidylinositol‐3‐
phosphate (PtdIns(3)P) and proteins involved in ER‐Golgi or vesicular transport ‐1.3632 0.0009
AUS1 YOR011W ‐1.3577 0.0003
MCH5 YOR306C Transporter of the ATP‐binding cassette family, involved in uptake of sterols and anaerobic growth Plasma membrane riboflavin transporter; facilitates the uptake of vitamin B2; required for FAD‐dependent processes; sequence similarity to mammalian monocarboxylate permeases, however mutants are not deficient in monocarboxylate transport ‐1.3486 0.0002
VBA2 ATP10 YBR293W YLR393W Permease of basic amino acids in the vacuolar membrane
Mitochondrial inner membrane protein required for assembly of the F0 sector of mitochondrial F1F0 ATP synthase, interacts genetically with ATP6 ‐1.3380 ‐1.3348 0.0002
0.0002
SPS100 YHR139C Protein required for spore wall maturation; expressed during sporulation; may be a component of the spore wall; expression also induced in cells treated with the mycotoxin patulin ‐1.3317 0.0001
RPS28B YLR264W ‐1.3233 0.0001
MRS4 YKR052C Protein component of the small (40S) ribosomal subunit; nearly identical to Rps28Ap and has similarity to rat S28 ribosomal protein Iron transporter that mediates Fe2+ transport across the inner mitochondrial membrane; mitochondrial carrier family member, similar to and functionally redundant with Mrs3p; active under low‐
iron conditions; may transport other cations ‐1.3206 0.0003
NA YGR117C ‐1.3190 0.0001
MMT2 YPL224C ‐1.3181 0.0000
ROD1 YOR018W ‐1.3108 0.0006
KRE5 YOR336W ‐1.3035 0.0000
NA YLR126C Protein required for beta‐1,6 glucan biosynthesis; mutations result in aberrant morphology and severe growth defects Putative protein of unknown function with similarity to glutamine amidotransferase proteins; has Aft1p‐binding motif in the promoter; may be involved in copper and iron homeostasis; YLR126C is not an essential protein ‐1.3034 0.0002
DTR1 YBR180W Putative dityrosine transporter, required for spore wall synthesis; expressed during sporulation; member of the major facilitator superfamily (DHA1 family) of multidrug resistance transporters ‐1.3009 0.0002
NA YKR104W ‐1.2994 0.0000
RTC4 YNL254C Putative transporter of the multidrug resistance‐associated protein (MRP) subfamily; contains a stop codon in S288C; adjacent ORFs YKR103W and YKR104W are merged in different strain backgrounds Protein of unknown function; null mutation suppresses cdc13‐1 temperature sensitivity; (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus ‐1.2966 0.0000
NA NA YER085C YKR041W ‐1.2916 ‐1.2874 0.0004
0.0008
Symbols ORF Description NA YLR446W YPT35 Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm Putative metal transporter involved in mitochondrial iron accumulation; closely related to Mmt1p Membrane protein that binds the ubiquitin ligase Rsp5p via its 2 PY motifs; overexpression confers resistance to the GST substrate o‐
dinitrobenzene,zinc, and calcium; proposed to regulate the endocytosis of plasma membrane proteins Putative protein of unknown function
Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus 184
log2(mtr10.
Ts/WT.TS) adj.p.v
al Protein required for oxidation of specific cysteine residues of the transcription factor Yap1p, resulting in the nuclear localization of Yap1p in response to stress ‐1.2870 0.0002
Minor isoform of pyruvate decarboxylase, decarboxylates pyruvate to acetaldehyde, involved in amino acid catabolism; transcription is glucose‐ and ethanol‐dependent, and is strongly induced during sulfur limitation Lipase required for intravacuolar lysis of autophagic bodies and Cvt bodies; targeted to intravacuolar vesicles during autophagy via the multivesicular body (MVB) pathway ‐1.2821 0.0001
‐1.2792 0.0002
YMR013C Dolichol kinase, catalyzes the terminal step in dolichyl monophosphate (Dol‐P) biosynthesis; required for viability and for normal rates of lipid intermediate synthesis and protein N‐
glycosylation ‐1.2789 0.0000
PRY1 SFP1 YJL079C YLR403W Protein of unknown function
Transcription factor that controls expression of ribosome biogenesis genes in response to nutrients and stress, regulates G2/M transitions during mitotic cell cycle and DNA‐damage response, modulates cell size; regulated by TORC1 and Mrs6p ‐1.2753 ‐1.2672 0.0000
0.0002
RPL8A YHL033C ‐1.2662 0.0000
RRN10 YBL025W ‐1.2646 0.0000
MPD2 YOL088C Ribosomal protein L4 of the large (60S) ribosomal subunit, nearly identical to Rpl8Bp and has similarity to rat L7a ribosomal protein; mutation results in decreased amounts of free 60S subunits Protein involved in promoting high level transcription of rDNA, subunit of UAF (upstream activation factor) for RNA polymerase I Member of the protein disulfide isomerase (PDI) family, exhibits chaperone activity; overexpression suppresses the lethality of a pdi1 deletion but does not complement all Pdi1p functions; undergoes oxidation by Ero1p ‐1.2607 0.0000
NBL1 YHR199C‐
A Subunit of the conserved chromosomal passenger complex (CPC; Ipl1p‐Sli15p‐Bir1p‐Nbl1p), which regulates mitotic chromosome segregation; not required for the kinase activity of the complex; mediates the interaction of Sli15p and Bir1p ‐1.2588 0.0004
NA YPL264C ‐1.2550 0.0000
FUS1 YCL027W Putative membrane protein of unknown function; physically interacts with Hsp82p; YPL264C is not an essential gene Membrane protein localized to the shmoo tip, required for cell fusion; expression regulated by mating pheromone; proposed to coordinate signaling, fusion, and polarization events required for fusion; potential Cdc28p substrate ‐1.2361 0.0004
FMP43 YGR243W ‐1.2345 0.0006
BDS1 YOL164W ‐1.2324 0.0003
AVT6 YER119C ‐1.2318 0.0002
NA YGR205W ‐1.2307 0.0005
SIP4 YJL089W ‐1.2269 0.0004
Symbols ORF Description YBP1 YBR216C PDC6 YGR087C ATG15 YCR068W SEC59 Putative protein of unknown function; expression regulated by osmotic and alkaline stresses; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies Bacterially‐derived sulfatase required for use of alkyl‐ and aryl‐
sulfates as sulfur sources Vacuolar aspartate and glutamate exporter; member of a family of seven genes (AVT1‐7) related to vesicular GABA‐glycine transporters; involved in compartmentalizing acidic amino acids in response to nitrogen starvation ATP‐binding protein of unknown function; crystal structure resembles that of E.coli pantothenate kinase and other small kinases C6 zinc cluster transcriptional activator that binds to the carbon source‐responsive element (CSRE) of gluconeogenic genes; involved in the positive regulation of gluconeogenesis; regulated by Snf1p protein kinase; localized to the nucleus 185
log2(mtr10.
Ts/WT.TS) adj.p.v
al Transcriptional activator related to Msn2p; activated in stress conditions, which results in translocation from the cytoplasm to the nucleus; binds DNA at stress response elements of responsive genes, inducing gene expression ‐1.2260 0.0001
YHR210C Putative protein of unknown function; non‐essential gene; highly expressed under anaeorbic conditions; sequence similarity to aldose 1‐epimerases such as GAL10 ‐1.2259 0.0000
SMF1 YOL122C Divalent metal ion transporter with a broad specificity for di‐valent and tri‐valent metals; post‐translationally regulated by levels of metal ions; member of the Nramp family of metal transport proteins ‐1.2249 0.0001
NA SDS3 NA YIL084C NA Component of the Rpd3p/Sin3p deacetylase complex required for its structural integrity and catalytic activity, involved in transcriptional silencing and required for sporulation; cells defective in SDS3 display pleiotropic phenotypes ‐1.2236 ‐1.2199 0.0002
0.0002
VAC8 YEL013W ‐1.2193 0.0002
ELO1 YJL196C ‐1.2160 0.0000
ULA1 YPL003W Phosphorylated and palmitoylated vacuolar membrane protein that interacts with Atg13p, required for the cytoplasm‐to‐vacuole targeting (Cvt) pathway; interacts with Nvj1p to form nucleus‐
vacuole junctions Elongase I, medium‐chain acyl elongase, catalyzes carboxy‐terminal elongation of unsaturated C12‐C16 fatty acyl‐CoAs to C16‐C18 fatty acids Protein that acts together with Uba3p to activate Rub1p before its conjugation to proteins (neddylation), which may play a role in protein degradation ‐1.2092 0.0002
NA YOR214C ‐1.2084 0.0002
BNA4 YBL098W Putative protein of unknown function; YOR214C is not an essential gene Kynurenine 3‐mono oxygenase, required for the de novo biosynthesis of NAD from tryptophan via kynurenine; expression regulated by Hst1p; putative therapeutic target for Huntington disease ‐1.2011 0.0000
MUC1 YIR019C GPI‐anchored cell surface glycoprotein (flocculin) required for pseudohyphal formation, invasive growth, flocculation, and biofilms; transcriptionally regulated by the MAPK pathway (via Ste12p and Tec1p) and the cAMP pathway (via Flo8p) ‐1.1963 0.0002
NA ICL1 YOL014W YER065C Putative protein of unknown function
Isocitrate lyase, catalyzes the formation of succinate and glyoxylate from isocitrate, a key reaction of the glyoxylate cycle; expression of ICL1 is induced by growth on ethanol and repressed by growth on glucose ‐1.1961 ‐1.1951 0.0004
0.0006
RTG1 YOL067C ‐1.1927 0.0002
GYP6 YJL044C ‐1.1918 0.0000
PDR5 YOR153W Transcription factor (bHLH) involved in interorganelle communication between mitochondria, peroxisomes, and nucleus GTPase‐activating protein (GAP) for the yeast Rab family member, Ypt6p; involved in vesicle mediated protein transport Plasma membrane ATP‐binding cassette (ABC) transporter, multidrug transporter actively regulated by Pdr1p; also involved in steroid transport, cation resistance, and cellular detoxification during exponential growth ‐1.1879 0.0001
NA SFG1 YNR068C YOR315W Putative protein of unknown function
Nuclear protein, putative transcription factor required for growth of superficial pseudohyphae (which do not invade the agar substrate) but not for invasive pseudohyphal growth; may act together with Phd1p; potential Cdc28p substrate ‐1.1876 ‐1.1804 0.0002
0.0006
YAP5 YIR018W Basic leucine zipper (bZIP) transcription factor
‐1.1781 0.0000
Symbols ORF Description MSN4 YKL062W NA 186
log2(mtr10.
Ts/WT.TS) adj.p.v
al ‐1.1708 0.0001
‐1.1673 0.0000
Protein containing a UCS (UNC‐45/CRO1/SHE4) domain, binds to myosin motor domains to regulate myosin function; involved in endocytosis, polarization of the actin cytoskeleton, and asymmetric mRNA localization ‐1.1664 0.0000
ATP‐NADH kinase; phosphorylates both NAD and NADH; homooctameric structure consisting of 60‐kDa subunits; sequence similarity to Utr1p and Pos5p; overexpression complements certain pos5 phenotypes Mitochondrial 3‐oxoacyl‐[acyl‐carrier‐protein] reductase, may comprise a type II mitochondrial fatty acid synthase along with Mct1p ‐1.1660 0.0002
‐1.1610 0.0001
YLR031W YOR080W Putative protein of unknown function
Origin‐binding F‐box protein that forms an SCF ubiquitin ligase complex with Skp1p and Cdc53p; plays a role in DNA replication, involved in invasive and pseudohyphal growth ‐1.1590 ‐1.1574 0.0001
0.0002
STE12 YHR084W Transcription factor that is activated by a MAP kinase signaling cascade, activates genes involved in mating or pseudohyphal/invasive growth pathways; cooperates with Tec1p transcription factor to regulate genes specific for invasive growth ‐1.1567 0.0001
NA YER039C‐A ‐1.1560 0.0003
GLN3 YER040W Putative protein of unknown function; YER039C‐A is not an essential gene Transcriptional activator of genes regulated by nitrogen catabolite repression (NCR), localization and activity regulated by quality of nitrogen source ‐1.1541 0.0003
AGX1 YFL030W Alanine:glyoxylate aminotransferase (AGT), catalyzes the synthesis of glycine from glyoxylate, which is one of three pathways for glycine biosynthesis in yeast; has similarity to mammalian and plant alanine:glyoxylate aminotransferases ‐1.1526 0.0001
YPC1 YBR183W ‐1.1476 0.0001
ROG3 YFR022W Alkaline ceramidase that also has reverse (CoA‐independent) ceramide synthase activity, catalyzes both breakdown and synthesis of phytoceramide; overexpression confers fumonisin B1 resistance Protein that binds the ubiquitin ligase Rsp5p via its 2 PY motifs; has similarity to Rod1p; mutation suppresses the temperature sensitivity of an mck1 rim11 double mutant; proposed to regulate the endocytosis of plasma membrane proteins ‐1.1472 0.0001
TDH1 YJL052W Glyceraldehyde‐3‐phosphate dehydrogenase, isozyme 1, involved in glycolysis and gluconeogenesis; tetramer that catalyzes the reaction of glyceraldehyde‐3‐phosphate to 1,3 bis‐phosphoglycerate; detected in the cytoplasm and cell wall ‐1.1443 0.0003
NA YMR253C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern; YMR253C is not an essential gene ‐1.1336 0.0003
DFG16 YOR030W Probable multiple transmembrane protein, involved in diploid invasive and pseudohyphal growth upon nitrogen starvation; required for accumulation of processed Rim101p ‐1.1248 0.0003
Symbols ORF Description PIC2 YER053C PEX32 YBR168W Mitochondrial phosphate carrier, imports inorganic phosphate into mitochondria; functionally redundant with Mir1p but less abundant than Mir1p under normal conditions; expression is induced at high temperature Peroxisomal integral membrane protein, involved in negative regulation of peroxisome size; partially functionally redundant with Pex31p; genetic interactions suggest action at a step downstream of steps mediated by Pex28p and Pex29p SHE4 YOR035C YEF1 YEL041W OAR1 YKL055C NA DIA2 187
log2(mtr10.
Ts/WT.TS) adj.p.v
al ‐1.1127 0.0004
‐1.1111 ‐1.1105 0.0002
0.0000
One of two redundant DL‐glycerol‐3‐phosphatases (RHR2/GPP1 encodes the other) involved in glycerol biosynthesis; induced in response to hyperosmotic stress and oxidative stress, and during the diauxic transition ‐1.1097 0.0005
YBR093C Repressible acid phosphatase (1 of 3) that also mediates extracellular nucleotide‐derived phosphate hydrolysis; secretory pathway derived cell surface glycoprotein; induced by phosphate starvation and coordinately regulated by PHO4 and PHO2 ‐1.1082 0.0001
RRT13 YER066W ‐1.1061 0.0001
PHO80 YOL001W Putative protein of unknown function; non‐essential gene identified in a screen for mutants with decreased levels of rDNA transcription Cyclin, interacts with cyclin‐dependent kinase Pho85p; regulates the response to nutrient levels and environmental conditions, including the response to phosphate limitation and stress‐dependent calcium signaling ‐1.1057 0.0001
NA YEL025C ‐1.1055 0.0002
FEN2 YCR028C ‐1.1051 0.0001
ICP55 YER078C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus Plasma membrane H+‐pantothenate symporter; confers sensitivity to the antifungal agent fenpropimorph Mitochondrial aminopeptidase; cleaves the N termini of at least 38 imported proteins after cleavage by the mitochondrial processing peptidase (MPP), thereby increasing their stability; member of the aminopeptidase P family ‐1.1051 0.0000
PDR18 YNR070W Putative transporter of the ATP‐binding cassette (ABC) family, implicated in pleiotropic drug resistance; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies ‐1.1007 0.0001
FIT1 YDR534C Mannoprotein that is incorporated into the cell wall via a glycosylphosphatidylinositol (GPI) anchor, involved in the retention of siderophore‐iron in the cell wall ‐1.0976 0.0006
SGF29 YCL010C Probable subunit of SAGA histone acetyltransferase complex
‐1.0947 0.0002
YPK9 YOR291W Vacuolar protein with a possible role in sequestering heavy metals; has similarity to the type V P‐type ATPase Spf1p; homolog of human ATP13A2 (PARK9), mutations in which are associated with Parkinson disease and Kufor‐Rakeb syndrome ‐1.0924 0.0001
SRB8 YCR081W Subunit of the RNA polymerase II mediator complex; associates with core polymerase subunits to form the RNA polymerase II holoenzyme; essential for transcriptional regulation; involved in glucose repression ‐1.0917 0.0001
PDR15 YDR406W Plasma membrane ATP binding cassette (ABC) transporter, multidrug transporter and general stress response factor implicated in cellular detoxification; regulated by Pdr1p, Pdr3p and Pdr8p; promoter contains a PDR responsive element ‐1.0877 0.0001
YPK2 YMR104C Protein kinase with similarity to serine/threonine protein kinase Ypk1p; functionally redundant with YPK1 at the genetic level; participates in a signaling pathway required for optimal cell wall integrity; homolog of mammalian kinase SGK ‐1.0858 0.0009
Symbols ORF Description YSP1 YHR155W NA PPE1 YLR173W YHR075C Mitochondrial protein with a potential role in promoting mitochondrial fragmentation during programmed cell death in response to high levels of alpha‐factor mating pheromone or the drug amiodarone Putative protein of unknown function
Protein with carboxyl methyl esterase activity that may have a role in demethylation of the phosphoprotein phosphatase catalytic subunit; also identified as a small subunit mitochondrial ribosomal protein HOR2 YER062C PHO5 188
log2(mtr10.
Ts/WT.TS) adj.p.v
al Putative protein of unknown function with similarity to a human minor histocompatibility antigen and signal peptide peptidases; YKL100C is not an essential gene ‐1.0832 0.0000
YPL095C Acyl‐coenzymeA:ethanol O‐acyltransferase responsible for the major part of medium‐chain fatty acid ethyl ester biosynthesis during fermentation; possesses short‐chain esterase activity; may be involved in lipid metabolism and detoxification ‐1.0828 0.0002
NA YPR071W Putative membrane protein; YPR071W is not an essential gene
‐1.0822 0.0000
GUT2 YIL155C Mitochondrial glycerol‐3‐phosphate dehydrogenase; expression is repressed by both glucose and cAMP and derepressed by non‐
fermentable carbon sources in a Snf1p, Rsf1p, Hap2/3/4/5 complex dependent manner ‐1.0817 0.0004
TPO1 YLL028W Polyamine transporter that recognizes spermine, putrescine, and spermidine; catalyzes uptake of polyamines at alkaline pH and excretion at acidic pH; phosphorylation enhances activity and sorting to the plasma membrane ‐1.0812 0.0001
FRE6 YLL051C ‐1.0798 0.0001
NA YNL040W Putative ferric reductase with similarity to Fre2p; expression induced by low iron levels Putative protein of unknown function with strong similarity to alanyl‐
tRNA synthases from Eubacteria; green fluorescent protein (GFP)‐
fusion protein localizes to the cytoplasm; YNL040W is not an essential gene ‐1.0787 0.0002
NA YPR157W ‐1.0739 0.0006
AQY2 YLL052C ‐1.0738 0.0001
NA YMR102C Protein of unknown function; transcription is activated by paralogous transcription factors Yrm1p and Yrr1p along with genes involved in multidrug resistance; mutant shows increased resistance to azoles; YMR102C is not an essential gene ‐1.0731 0.0001
TAL1 YLR354C ‐1.0717 0.0000
NA YLR164W Transaldolase, enzyme in the non‐oxidative pentose phosphate pathway; converts sedoheptulose 7‐phosphate and glyceraldehyde 3‐phosphate to erythrose 4‐phosphate and fructose 6‐phosphate Mitochondrial inner membrane of unknown function; similar to Tim18p and Sdh4p; expression induced by nitrogen limitation in a GLN3, GAT1‐dependent manner ‐1.0683 0.0000
ECL1 YGR146C Protein of unknown function, affects chronological lifespan; induced by iron homeostasis transcription factor Aft2p; multicopy suppressor of temperature sensitive hsf1 mutant; induced by treatment with 8‐
methoxypsoralen and UVA irradiation ‐1.0671 0.0003
PAC1 YOR269W Protein involved in nuclear migration, part of the dynein/dynactin pathway; targets dynein to microtubule tips, which is necessary for sliding of microtubules along bud cortex; synthetic lethal with bni1; homolog of human LIS1 ‐1.0662 0.0001
MAL33 YBR297W ‐1.0646 0.0003
PIP2 YOR363C MAL‐activator protein, part of complex locus MAL3; nonfunctional in genomic reference strain S288C Autoregulatory oleate‐specific transcriptional activator of peroxisome proliferation, contains Zn(2)‐Cys(6) cluster domain, forms heterodimer with Oaf1p, binds oleate response elements (OREs), activates beta‐oxidation genes ‐1.0645 0.0001
Symbols ORF Description NA YKL100C EEB1 Putative protein of unknown function; induced by treatment with 8‐
methoxypsoralen and UVA irradiation Water channel that mediates the transport of water across cell membranes, only expressed in proliferating cells, controlled by osmotic signals, may be involved in freeze tolerance; disrupted by a stop codon in many S. cerevisiae strains 189
log2(mtr10.
Ts/WT.TS) adj.p.v
al Putative protein of unknown function; expression is induced by activation of the HOG1 mitogen‐activated signaling pathway and this induction is Hog1p/Pbs2p dependent; YJL107C and adjacent ORF, YJL108C are merged in related fungi ‐1.0630 0.0000
Self‐glucosylating initiator of glycogen synthesis, also glucosylates n‐
dodecyl‐beta‐D‐maltoside; similar to mammalian glycogenin NA Zinc transporter; localizes to the ER; null mutant is sensitive to calcofluor white, leads to zinc accumulation in cytosol; ortholog of the mouse KE4 and member of the ZIP (ZRT, IRT‐like Protein) family Putative histone acetylase with a role in transcriptional silencing, sequence‐specific activator of histone genes, binds specifically and cooperatively to pairs of UAS elements in core histone promoters, functions at or near the TATA box ‐1.0627 0.0004
‐1.0611 ‐1.0600 0.0002
0.0001
‐1.0592 0.0002
Putative protein of unknown function
Essential membrane protein localized at the nuclear envelope and spindle pole body (SPB), required for insertion of the newly duplicated SPB into the nuclear envelope; potentially phosphorylated by Cdc28p ‐1.0588 ‐1.0585 0.0002
0.0006
Mitochondrial inner membrane protein with a role in maintaining mitochondrial morphology and normal cardiolipin levels; proposed to be involved in N‐acylethanolamine metabolism; related to mammalian N‐acylPE‐specific phospholipase D Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus and is induced in response to the DNA‐damaging agent MMS Protein of unknown function involved in maintenance of proper telomere length NA Putative protein of unknown function; non‐essential gene; contains multiple predicted transmembrane domains Putative zinc finger protein; YPR013C is not an essential gene
‐1.0585 0.0006
‐1.0449 0.0003
‐1.0407 0.0001
‐1.0368 ‐1.0345 0.0004
0.0000
‐1.0341 0.0000
‐1.0308 0.0001
‐1.0293 0.0001
‐1.0274 0.0001
‐1.0235 0.0001
Symbols ORF Description NA YJL107C GLG1 YKR058W NA YKE4 NA YIL023C SPT10 YJL127C NA MPS2 YIL089W YGL075C FMP30 YPL103C NA YGR126W NA YPL041C NA NA NA YGL140C NA YPR013C NA YOR152C OST6 YML019W SAD1 YFR005C NIT1 YIL164C HCM1 YCR065W Forkhead transcription factor that drives S‐phase specific expression of genes involved in chromosome segregation, spindle dynamics, and budding; suppressor of calmodulin mutants with specific SPB assembly defects; telomere maintenance role ‐1.0222 0.0004
ZRT2 YLR130C Low‐affinity zinc transporter of the plasma membrane; transcription is induced under low‐zinc conditions by the Zap1p transcription factor ‐1.0193 0.0003
NA PDR3 YAL037W YBL005W Putative protein of unknown function
Transcriptional activator of the pleiotropic drug resistance network, regulates expression of ATP‐binding cassette (ABC) transporters through binding to cis‐acting sites known as PDREs (PDR responsive elements) ‐1.0187 ‐1.0176 0.0001
0.0003
Putative protein of unknown function; has no similarity to any known protein; YOR152C is not an essential gene Subunit of the oligosaccharyltransferase complex of the ER lumen, which catalyzes asparagine‐linked glycosylation of newly synthesized proteins; similar to and partially functionally redundant with Ost3p Conserved zinc‐finger domain protein involved in pre‐mRNA splicing, required for assembly of U4 snRNA into the U4/U6 particle Nitrilase, member of the nitrilase branch of the nitrilase superfamily; in closely related species and other S. cerevisiae strain backgrounds YIL164C and adjacent ORF, YIL165C, likely constitute a single ORF encoding a nitrilase gene 190
log2(mtr10.
Ts/WT.TS) adj.p.v
al Long chain fatty acyl‐CoA synthetase, activates imported fatty acids; green fluorescent protein (GFP)‐fusion protein localizes to the cell periphery ‐1.0170 0.0001
YAL018C YGR031W Putative protein of unknown function
Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies ‐1.0150 ‐1.0138 0.0009
0.0002
ERS1 YCR075C ‐1.0047 0.0001
ARG80 YMR042W ‐1.0047 0.0006
NA ARG8 YBL029W YOL140W ‐0.9999 ‐0.9993 0.0002
0.0001
HST2 YPL015C Protein with similarity to human cystinosin, which is a H(+)‐driven transporter involved in L‐cystine export from lysosomes and implicated in the disease cystinosis; contains seven transmembrane domains Transcription factor involved in regulation of arginine‐responsive genes; acts with Arg81p and Arg82p Non‐essential protein of unknown function
Acetylornithine aminotransferase, catalyzes the fourth step in the biosynthesis of the arginine precursor ornithine Cytoplasmic member of the silencing information regulator 2 (Sir2) family of NAD(+)‐dependent protein deacetylases; modulates nucleolar (rDNA) and telomeric silencing; possesses NAD(+)‐
dependent histone deacetylase activity in vitro ‐0.9981 0.0008
EDS1 YBR033W Putative zinc cluster protein; YBR033W is not an essential gene
‐0.9975 0.0003
EAR1 YMR171C ‐0.9972 0.0001
TTI1 YKL033W Specificity factor required for Rsp5p‐dependent ubiquitination and sorting of specific cargo proteins at the multivesicular body; mRNA is targeted to the bud via the mRNA transport system involving She2p Putative protein of unknown function; subunit of the ASTRA complex which is part of the chromatin remodeling machinery; similar to S. pombe Tti1p; detected in highly purified mitochondria in high‐
throughput studies ‐0.9968 0.0002
NA YBL095W Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies ‐0.9932 0.0001
MAL11 YGR289C ‐0.9924 0.0004
NA YPR003C Inducible high‐affinity maltose transporter (alpha‐glucoside transporter); encoded in the MAL1 complex locus; broad substrate specificity that includes maltotriose; required for isomaltose utilization Putative sulfate permease; physically interacts with Hsp82p; green fluorescent protein (GFP)‐fusion protein localizes to the ER; YPR003C is not an essential gene ‐0.9902 0.0001
MCM3 YEL032W Protein involved in DNA replication; component of the Mcm2‐7 hexameric complex that binds chromatin as a part of the pre‐
replicative complex ‐0.9890 0.0002
NA YPL191C Putative protein of unknown function; diploid deletion strain exhibits high budding index; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm ‐0.9887 0.0002
ALG6 YOR002W Alpha 1,3 glucosyltransferase, involved in transfer of oligosaccharides from dolichyl pyrophosphate to asparagine residues of proteins during N‐linked protein glycosylation; mutations in human ortholog are associated with disease ‐0.9852 0.0002
SER3 YER081W ‐0.9837 0.0001
DSD1 YGL196W 3‐phosphoglycerate dehydrogenase, catalyzes the first step in serine and glycine biosynthesis; isozyme of Ser33p D‐serine dehydratase (aka D‐serine ammonia‐lyase); converts D‐
serine to pyruvate and ammonia by a reaction dependent on pyridoxal 5'‐phosphate and zinc; may play a role in D‐serine detoxification; L‐serine is not a substrate ‐0.9830 0.0002
Symbols ORF Description FAA3 YIL009W NA NA 191
log2(mtr10.
Ts/WT.TS) adj.p.v
al Probable ortholog of A. nidulans PalC, which is involved in pH regulation and binds to the ESCRT‐III complex; null mutant does not properly process Rim101p and has decreased resistance to rapamycin; GFP‐fusion protein is cytoplasmic ‐0.9814 0.0002
YKL133C Putative protein of unknown function; has similarity to Mgr3p, but unlike MGR3, is not required for growth of cells lacking the mitochondrial genome (null mutation does not confer a petite‐
negative phenotype) ‐0.9811 0.0006
PIR3 YKL163W O‐glycosylated covalently‐bound cell wall protein required for cell wall stability; expression is cell cycle regulated, peaking in M/G1 and also subject to regulation by the cell integrity pathway ‐0.9810 0.0001
THO1 YER063W Conserved nuclear RNA‐binding protein; specifically binds to transcribed chromatin in a THO‐ and RNA‐dependent manner, genetically interacts with shuttling hnRNP NAB2; overproduction suppresses transcriptional defect caused by hpr1 mutation ‐0.9795 0.0002
GUT1 YHL032C Glycerol kinase, converts glycerol to glycerol‐3‐phosphate; glucose repression of expression is mediated by Adr1p and Ino2p‐Ino4p; derepression of expression on non‐fermentable carbon sources is mediated by Opi1p and Rsf1p ‐0.9757 0.0001
HTD2 YHR067W Mitochondrial 3‐hydroxyacyl‐thioester dehydratase involved in fatty acid biosynthesis, required for respiratory growth and for normal mitochondrial morphology ‐0.9748 0.0001
MUM3 YOR298W Protein of unknown function involved in the organization of the outer spore wall layers; has similarity to the tafazzins superfamily of acyltransferases ‐0.9732 0.0010
NA NA YPL236C YOR292C NA Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the vacuole; YOR292C is not an essential gene ‐0.9695 ‐0.9685 0.0001
0.0001
PLB2 YMR006C ‐0.9672 0.0003
NA MRK1 YPR196W YDL079C Phospholipase B (lysophospholipase) involved in phospholipid metabolism; displays transacylase activity in vitro; overproduction confers resistance to lysophosphatidylcholine Putative maltose activator
Glycogen synthase kinase 3 (GSK‐3) homolog; one of four GSK‐3 homologs in S. cerevisiae that function to activate Msn2p‐dependent transcription of stress responsive genes and that function in protein degradation ‐0.9672 ‐0.9658 0.0002
0.0002
LYS5 YGL154C Phosphopantetheinyl transferase involved in lysine biosynthesis; converts inactive apo‐form of Lys2p (alpha‐aminoadipate reductase) into catalytically active holo‐form by posttranslational addition of phosphopantetheine ‐0.9650 0.0002
BUR2 YLR226W Cyclin for the Sgv1p (Bur1p) protein kinase; Sgv1p and Bur2p comprise a CDK‐cyclin complex involved in transcriptional regulation through its phosphorylation of the carboxy‐terminal domain of the largest subunit of RNA polymerase II ‐0.9645 0.0000
MNS1 YJR131W ‐0.9639 0.0001
NA YJR030C Alpha‐1,2‐mannosidase involved in ER quality control; catalyzes the removal of one mannose residue from Man9GlcNAc to produce a single isomer of Man8GlcNAc in N‐linked oligosaccharide biosynthesis; integral to ER membrane Putative protein of unknown function; expression repressed in carbon limited vs carbon replete chemostat cultures; YJR030C is a non‐essential gene ‐0.9639 0.0001
Symbols ORF Description NA YGR122W NA 192
log2(mtr10.
Ts/WT.TS) adj.p.v
al Putative protein of unknown function with similarity to Tfc7p and prokaryotic phosphotransfer enzymes; null mutant shows alterations in glucose metabolism; GFP‐fusion protein localizes to the cytoplasm and nucleus Putative protein of unknown function; expression induced under calcium shortage Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; overexpression causes a cell cycle delay or arrest ‐0.9619 0.0003
‐0.9593 0.0004
‐0.9593 0.0004
YJL164C cAMP‐dependent protein kinase catalytic subunit; promotes vegetative growth in response to nutrients via the Ras‐cAMP signaling pathway; inhibited by regulatory subunit Bcy1p in the absence of cAMP; partially redundant with Tpk2p and Tpk3p ‐0.9571 0.0006
NIS1 YNL078W ‐0.9533 0.0002
STE4 YOR212W ‐0.9501 0.0001
RAD16 YBR114W Protein localized in the bud neck at G2/M phase; physically interacts with septins; possibly involved in a mitotic signaling network G protein beta subunit, forms a dimer with Ste18p to activate the mating signaling pathway, forms a heterotrimer with Gpa1p and Ste18p to dampen signaling; may recruit Rho1p to the polarized growth site during mating; contains WD40 repeats Protein that recognizes and binds damaged DNA in an ATP‐
dependent manner (with Rad7p) during nucleotide excision repair; subunit of Nucleotide Excision Repair Factor 4 (NEF4) and the Elongin‐Cullin‐Socs (ECS) ligase complex ‐0.9497 0.0000
NA YGL036W Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; YGL036W is not an essential gene ‐0.9474 0.0006
HER1 YOR227W Protein of unknown function required for proliferation or remodeling of the ER that is caused by overexpression of Hmg2p; may interact with ribosomes, based on co‐purification experiments ‐0.9443 0.0002
YAT2 YER024W Carnitine acetyltransferase; has similarity to Yat1p, which is a carnitine acetyltransferase associated with the mitochondrial outer membrane ‐0.9440 0.0008
NA YPL272C ‐0.9436 0.0003
RPL9B YNL067W Putative protein of unknown function; gene expression induced in response to ketoconazole; YPL272C is not an essential gene Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl9Ap and has similarity to E. coli L6 and rat L9 ribosomal proteins ‐0.9432 0.0001
FAR1 YJL157C Cyclin‐dependent kinase inhibitor that mediates cell cycle arrest in response to pheromone; also forms a complex with Cdc24p, Ste4p, and Ste18p that may specify the direction of polarized growth during mating; potential Cdc28p substrate ‐0.9400 0.0003
RDS2 YPL133C Transcription factor involved in regulating gluconeogenesis and glyoxylate cycle genes; member of the zinc cluster family of proteins; confers resistance to ketoconazole ‐0.9391 0.0002
KAR9 YPL269W Karyogamy protein required for correct positioning of the mitotic spindle and for orienting cytoplasmic microtubules, localizes at the shmoo tip in mating cells and at the tip of the growing bud in small‐
budded cells through anaphase ‐0.9366 0.0002
FHL1 YPR104C Regulator of ribosomal protein transcription; has forkhead associated domain that binds phosphorylated proteins; also has forkhead DNA‐binding domain but does not bind DNA in vitro; suppresses RNA pol III and splicing factor prp4 mutants ‐0.9336 0.0004
Symbols ORF Description NA YNL108C NA YJR124C NA YHR131C TPK1 193
log2(mtr10.
Ts/WT.TS) adj.p.v
al Mitochondrial NADH kinase, phosphorylates NADH; also phosphorylates NAD(+) with lower specificity; required for the response to oxidative stress ‐0.9297 0.0002
YFL025C GPI inositol deacylase of the ER that negatively regulates COPII vesicle formation, prevents production of vesicles with defective subunits, required for proper discrimination between resident ER proteins and Golgi‐bound cargo molecules ‐0.9257 0.0001
ATG32 YIL146C Mitochondrial‐anchored transmembrane receptor that interacts with the autophagy adaptor protein, Atg11p, and is essential for mitophagy, the selective vacuolar degradation of mitochondria in response to starvation ‐0.9237 0.0002
PRY3 NA YJL078C YER130C Protein of unknown function
Protein of unknown function; transcription is regulated by Haa1p, Sok2p and Zap1p transcriptional activators; the C. Albicans homolog (MNL1) plays a role in adaptation to stress ‐0.9213 ‐0.9211 0.0003
0.0002
NA YEL057C ‐0.9197 0.0005
ART5 YGR068C Protein of unknown function involved in telomere maintenance; target of UME6 regulation Protein proposed to regulate the endocytosis of plasma membrane proteins by recruiting the ubiquitin ligase Rsp5p to its target in the plasma membrane ‐0.9171 0.0002
PSF2 YJL072C Subunit of the GINS complex (Sld5p, Psf1p, Psf2p, Psf3p), which is localized to DNA replication origins and implicated in assembly of the DNA replication machinery ‐0.9164 0.0002
NA YPR147C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and is induced in response to the DNA‐damaging agent MMS ‐0.9160 0.0001
HMLALPHA
1 YCL066W Silenced copy of ALPHA1 at HML, encoding a transcriptional coactivator involved in the regulation of mating‐type alpha‐specific gene expression ‐0.9150 0.0003
TOS3 YGL179C Protein kinase, related to and functionally redundant with Elm1p and Sak1p for the phosphorylation and activation of Snf1p; functionally orthologous to LKB1, a mammalian kinase associated with Peutz‐
Jeghers cancer‐susceptibility syndrome ‐0.9136 0.0002
NA YOL024W ‐0.9128 0.0001
AGP2 YBR132C Putative protein of unknown function; predicted to have thiol‐
disulfide oxidoreductase active site High affinity polyamine permease, preferentially uses spermidine over putrescine; expression is down‐regulated by osmotic stress; plasma membrane carnitine transporter, also functions as a low‐
affinity amino acid permease ‐0.9121 0.0004
IRC23 YOR044W Putative protein of unknown function; green fluorescent protein (GFP)‐fusion localizes to the ER; null mutant displays increased levels of spontaneous Rad52p foci ‐0.9119 0.0001
NA YMR010W ‐0.9113 0.0002
YGK3 YOL128C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; YMR010W is not an essential gene; YMR010W mRNA is transcribed with ADI1 Protein kinase related to mammalian glycogen synthase kinases of the GSK‐3 family; GSK‐3 homologs (Mck1p, Rim11p, Mrk1p, Ygk3p) are involved in control of Msn2p‐dependent transcription of stress responsive genes and in protein degradation ‐0.9102 0.0003
PET127 YOR017W Protein with a role in 5'‐end processing of mitochondrial RNAs, located in the mitochondrial membrane ‐0.9086 0.0001
Symbols ORF Description POS5 YPL188W BST1 194
log2(mtr10.
Ts/WT.TS) adj.p.v
al Probable Hsp40p co‐chaperone, has a DnaJ‐like domain and appears to be involved in ER‐associated degradation of misfolded proteins containing a tightly folded cytoplasmic domain; inhibits replication of Brome mosaic virus in S. cerevisiae ‐0.9078 0.0001
YPR026W Acid trehalase required for utilization of extracellular trehalose
‐0.9075 0.0002
IST2 YBR086C Plasma membrane protein that may be involved in osmotolerance, localizes to the mother cell in small‐budded cells and to the bud in medium‐ and large‐budded cells; mRNA is transported to the bud tip by an actomyosin‐driven process ‐0.9068 0.0004
SCW11 YGL028C ‐0.9062 0.0002
NA YBR220C ‐0.9047 0.0001
NA YLR137W Cell wall protein with similarity to glucanases; may play a role in conjugation during mating based on its regulation by Ste12p Putative protein of unknown function; YBR220C is not an essential gene Putative S‐adenosylmethionine‐dependent methyltransferase
‐0.9044 0.0001
BNA1 YJR025C 3‐hydroxyanthranilic acid dioxygenase, required for the de novo biosynthesis of NAD from tryptophan via kynurenine; expression regulated by Hst1p ‐0.9031 0.0002
ORC5 YNL261W Subunit of the origin recognition complex, which directs DNA replication by binding to replication origins and is also involved in transcriptional silencing ‐0.9023 0.0002
GAL10 YBR019C UDP‐glucose‐4‐epimerase, catalyzes the interconversion of UDP‐
galactose and UDP‐D‐glucose in galactose metabolism; also catalyzes the conversion of alpha‐D‐glucose or alpha‐D‐galactose to their beta‐
anomers ‐0.9008 0.0006
NA YKR070W Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies ‐0.9008 0.0003
ECM3 YOR092W Non‐essential protein of unknown function; involved in signal transduction and the genotoxic response; induced rapidly in response to treatment with 8‐methoxypsoralen and UVA irradiation ‐0.8967 0.0001
USA1 YML029W Scaffold subunit of the Hrd1p ubiquitin ligase that also promotes ligase oligomerization; involved in ER‐associated protein degradation (ERAD); interacts with the U1 snRNP‐specific protein, Snp1p ‐0.8952 0.0002
NA YOR302W ‐0.8937 0.0006
NA YER140W CPA1 uORF, Arginine attenuator peptide, regulates translation of the CPA1 mRNA Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies; genetic interactions suggest a role in folding of ER membrane proteins ‐0.8931 0.0003
RPS7B YNL096C Protein component of the small (40S) ribosomal subunit, nearly identical to Rps7Ap; interacts with Kti11p; deletion causes hypersensitivity to zymocin; has similarity to rat S7 and Xenopus S8 ribosomal proteins ‐0.8891 0.0005
TNA1 YGR260W High affinity nicotinic acid plasma membrane permease, responsible for uptake of low levels of nicotinic acid; expression of the gene increases in the absence of extracellular nicotinic acid or para‐
aminobenzoate (PABA) ‐0.8880 0.0001
APL3 YBL037W Alpha‐adaptin, large subunit of the clathrin associated protein complex (AP‐2); involved in vesicle mediated transport ‐0.8878 0.0003
Symbols ORF Description JID1 YPR061C ATH1 195
log2(mtr10.
Ts/WT.TS) adj.p.v
al Plasma membrane ATP‐binding cassette (ABC) transporter, weak‐
acid‐inducible multidrug transporter required for weak organic acid resistance; induced by sorbate and benzoate and regulated by War1p; mutants exhibit sorbate hypersensitivity ‐0.8864 0.0001
YPR047W Mitochondrial phenylalanyl‐tRNA synthetase, active as a monomer, unlike the cytoplasmic subunit which is active as a dimer complexed to a beta subunit dimer; similar to the alpha subunit of E. coli phenylalanyl‐tRNA synthetase ‐0.8855 0.0001
NA YHR202W Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the vacuole, while HA‐tagged protein is found in the soluble fraction, suggesting cytoplasmic localization ‐0.8824 0.0002
BNA6 YFR047C Quinolinate phosphoribosyl transferase, required for the de novo biosynthesis of NAD from tryptophan via kynurenine; expression regulated by Hst1p ‐0.8819 0.0002
AMD1 YML035C AMP deaminase, tetrameric enzyme that catalyzes the deamination of AMP to form IMP and ammonia; may be involved in regulation of intracellular adenine nucleotide pools ‐0.8779 0.0001
TOR1 YJR066W PIK‐related protein kinase and rapamycin target; subunit of TORC1, a complex that controls growth in response to nutrients by regulating translation, transcription, ribosome biogenesis, nutrient transport and autophagy; involved in meiosis ‐0.8779 0.0003
TEL1 YBL088C Protein kinase primarily involved in telomere length regulation; contributes to cell cycle checkpoint control in response to DNA damage; functionally redundant with Mec1p; homolog of human ataxia telangiectasia (ATM) gene ‐0.8760 0.0001
NA MIG3 YBR074W YER028C Putative metalloprotease
Probable transcriptional repressor involved in response to toxic agents such as hydroxyurea that inhibit ribonucleotide reductase; phosphorylation by Snf1p or the Mec1p pathway inactivates Mig3p, allowing induction of damage response genes ‐0.8758 ‐0.8750 0.0001
0.0006
PRP8 YHR165C Component of the U4/U6‐U5 snRNP complex, involved in the second catalytic step of splicing; mutations of human Prp8 cause retinitis pigmentosa ‐0.8737 0.0001
NA ATR1 YMR147W YML116W ‐0.8728 ‐0.8719 0.0003
0.0004
SPO21 YOL091W Putative protein of unknown function
Multidrug efflux pump of the major facilitator superfamily, required for resistance to aminotriazole and 4‐nitroquinoline‐N‐oxide Component of the meiotic outer plaque of the spindle pole body, involved in modifying the meiotic outer plaque that is required prior to prospore membrane formation ‐0.8718 0.0009
MRF1 YGL143C Mitochondrial translation release factor, involved in stop codon recognition and hydrolysis of the peptidyl‐tRNA bond during mitochondrial translation; lack of MRF1 causes mitochondrial genome instability ‐0.8716 0.0002
NA YOR186W ‐0.8711 0.0005
RTC2 YBR147W Putative protein of unknown function; proper regulation of expression during heat stress is sphingolipid‐dependent Protein of unknown function; identified in a screen for mutants with decreased levels of rDNA transcription; detected in highly purified mitochondria; null mutant suppresses cdc13‐1; similar to a G‐protein coupled receptor from S. pombe ‐0.8693 0.0002
NSE5 YML023C Essential subunit of the Mms21‐Smc5‐Smc6 complex; required for cell viability and DNA repair ‐0.8640 0.0001
Symbols ORF Description PDR12 YPL058C MSF1 196
log2(mtr10.
Ts/WT.TS) adj.p.v
al Ribosomal protein 59 of the small subunit, required for ribosome assembly and 20S pre‐rRNA processing; mutations confer cryptopleurine resistance; nearly identical to Rps14Ap and similar to E. coli S11 and rat S14 ribosomal proteins ‐0.8635 0.0007
Middle sporulation‐specific mitogen‐activated protein kinase (MAPK) required for production of the outer spore wall layers; negatively regulates activity of the glucan synthase subunit Gsc2p Ubiquitin‐specific protease that cleaves ubiquitin from ubiquitinated proteins Protein with similarity to hect domain E3 ubiquitin‐protein ligases, not essential for viability Putative protein of unknown function; deletion mutant has increased glycogen accumulation and displays elongated buds; green fluorescent protein (GFP)‐fusion protein localizes to the nucleus Putative protein of unknown function with similarity to Pip2p, an oleate‐specific transcriptional activator of peroxisome proliferation; YLL054C is not an essential gene ‐0.8620 0.0001
‐0.8615 0.0006
‐0.8606 0.0006
‐0.8586 0.0002
‐0.8578 0.0006
Dipeptidyl aminopeptidase, Golgi integral membrane protein that cleaves on the carboxyl side of repeating ‐X‐Ala‐ sequences, required for maturation of alpha factor, transcription is induced by a‐factor Protein of unknown function, required for growth on glycerol as a carbon source; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies Putative membrane glycoprotein with strong similarity to Vth2p and Pep1p/Vps10p, may be involved in vacuolar protein sorting Putative transcription factor containing a zinc finger; overexpression increases salt tolerance through increased expression of the ENA1 (Na+/Li+ extrusion pump) gene while gene disruption decreases both salt tolerance and ENA1 expression ‐0.8570 0.0001
‐0.8554 0.0006
‐0.8536 0.0001
‐0.8528 0.0002
Putative basic leucine zipper (bZIP) transcription factor
Vacuolar protein sorting protein that forms part of the multimeric membrane‐associated retromer complex along with Vps35p, Vps29p, Vps17p, and Vps5p; essential for endosome‐to‐Golgi retrograde protein transport ‐0.8501 ‐0.8499 0.0007
0.0006
YNR061C YPL134C Putative protein of unknown function
Mitochondrial inner membrane transporter, exports 2‐oxoadipate and 2‐oxoglutarate from the mitochondrial matrix to the cytosol for lysine and glutamate biosynthesis and lysine catabolism; suppresses, in multicopy, an fmc1 null mutation ‐0.8476 ‐0.8435 0.0003
0.0002
NA YBL112C ‐0.8435 0.0006
PCI8 YIL071C Putative protein of unknown function; YBL112C is contained within TEL02L Possible shared subunit of Cop9 signalosome (CSN) and eIF3, binds eIF3b subunit Prt1p, has possible dual functions in transcriptional and translational control, contains a PCI (Proteasome‐COP9 signalosome (CSN)‐eIF3) domain ‐0.8421 0.0006
MSB2 YGR014W Mucin family member involved in the Cdc42p‐ and MAP kinase‐
dependent filamentous growth signaling pathway; also functions as an osmosensor in parallel to the Sho1p‐mediated pathway; potential Cdc28p substrate ‐0.8396 0.0002
DSE2 YHR143W Daughter cell‐specific secreted protein with similarity to glucanases, degrades cell wall from the daughter side causing daughter to separate from mother; expression is repressed by cAMP ‐0.8379 0.0003
Symbols ORF Description RPS14B YJL191W SMK1 YPR054W UBP11 YKR098C HUL4 YJR036C NA YGR071C NA YLL054C STE13 YOR219C GDS1 YOR355W VTH1 YIL173W HAL9 YOL089C YAP7 PEP8 YOL028C YJL053W NA ODC1 197
log2(mtr10.
Ts/WT.TS) adj.p.v
al Minor CTP synthase isozyme (see also URA7), catalyzes the ATP‐
dependent transfer of the amide nitrogen from glutamine to UTP, forming CTP, the final step in de novo biosynthesis of pyrimidines; involved in phospholipid biosynthesis ‐0.8373 0.0002
YLR251W Protein required for ethanol metabolism; induced by heat shock and localized to the inner mitochondrial membrane; homologous to mammalian peroxisomal membrane protein Mpv17 ‐0.8367 0.0008
GLG2 YJL137C ‐0.8360 0.0001
SPO73 YER046W Self‐glucosylating initiator of glycogen synthesis, also glucosylates n‐
dodecyl‐beta‐D‐maltoside; similar to mammalian glycogenin Meiosis‐specific protein of unknown function, required for spore wall formation during sporulation; dispensible for both nuclear divisions during meiosis ‐0.8351 0.0002
CLG1 YGL215W ‐0.8347 0.0006
NA YHR080C ‐0.8346 0.0009
GZF3 YJL110C GATA zinc finger protein and Dal80p homolog that negatively regulates nitrogen catabolic gene expression by competing with Gat1p for GATA site binding; function requires a repressive carbon source; dimerizes with Dal80p and binds to Tor1p ‐0.8323 0.0001
INP52 YNL106C Polyphosphatidylinositol phosphatase, dephosphorylates a number of phosphatidylinositols (PIs) to PI; involved in endocytosis; hyperosmotic stress causes translocation to actin patches; synaptojanin‐like protein with a Sac1 domain ‐0.8315 0.0007
RAD1 YPL022W Single‐stranded DNA endonuclease (with Rad10p), cleaves single‐
stranded DNA during nucleotide excision repair and double‐strand break repair; subunit of Nucleotide Excision Repair Factor 1 (NEF1); homolog of human XPF protein ‐0.8298 0.0003
YSC84 YHR016C ‐0.8286 0.0004
CTL1 YMR180C Actin‐binding protein involved in bundling of actin filaments and endocytosis of actin cortical patches; activity stimulated by Las17p; contains SH3 domain similar to Rvs167p RNA 5'‐triphosphatase, localizes to both the nucleus and cytoplasm
‐0.8259 0.0001
ATP2 YJR121W Beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase, which is a large, evolutionarily conserved enzyme complex required for ATP synthesis; phosphorylated ‐0.8250 0.0002
PET111 YMR257C ‐0.8245 0.0002
DBF20 YPR111W Mitochondrial translational activator specific for the COX2 mRNA; located in the mitochondrial inner membrane Ser/Thr kinase involved in late nuclear division, one of the mitotic exit network (MEN) proteins; necessary for the execution of cytokinesis ‐0.8236 0.0008
ANT1 YPR128C Peroxisomal adenine nucleotide transporter; involved in beta‐
oxidation of medium‐chain fatty acid; required for peroxisome proliferation ‐0.8231 0.0001
AVT1 YJR001W ‐0.8216 0.0003
NA YCR023C ‐0.8214 0.0001
TIR4 YOR009W Vacuolar transporter, imports large neutral amino acids into the vacuole; member of a family of seven S. cerevisiae genes (AVT1‐7) related to vesicular GABA‐glycine transporters Vacuolar membrane protein of unknown function; member of the multidrug resistance family; YCR023C is not an essential gene Cell wall mannoprotein of the Srp1p/Tip1p family of serine‐alanine‐
rich proteins; expressed under anaerobic conditions and required for anaerobic growth; transcription is also induced by cold shock ‐0.8214 0.0003
Symbols ORF Description URA8 YJR103W SYM1 Cyclin‐like protein that interacts with Pho85p; has sequence similarity to G1 cyclins PCL1 and PCL2 Protein of unknown function that may interact with ribosomes, based on co‐purification experiments; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies 198
log2(mtr10.
Ts/WT.TS) adj.p.v
al ‐0.8212 0.0005
‐0.8207 0.0003
‐0.8206 0.0002
Putative protein of unknown function; identified in a screen for mutants with increased levels of rDNA transcription; green fluorescent protein (GFP)‐fusion protein localizes to lipid particles Kynureninase, required for the de novo biosynthesis of NAD from tryptophan via kynurenine; expression regulated by Hst1p Dual‐specificity protein phosphatase; exists in 2 isoforms; required for maintenance of a low level of signaling through the cell integrity pathway, adaptive response to pheromone; regulates and is regulated by Slt2p; dephosphorylates Fus3p ‐0.8196 0.0005
‐0.8181 0.0005
‐0.8162 0.0002
YBR077C Component of the EGO complex, which is involved in the regulation of microautophagy, and of the GSE complex, which is required for proper sorting of amino acid permease Gap1p; gene exhibits synthetic genetic interaction with MSS4 ‐0.8146 0.0002
NA HOL1 YMR265C YNR055C ‐0.8143 ‐0.8129 0.0001
0.0001
RMR1 YGL250W Putative protein of unknown function
Putative transporter in the major facilitator superfamily (DHA1 family) of multidrug resistance transporters; mutations in membrane‐spanning domains permit cation and histidinol uptake Protein required for meiotic recombination and gene conversion; null mutant displays reduced PIS1 expression and growth defects on non‐fermentable carbon sources and minimal media; GFP‐fusion protein localizes to both cytoplasm and nucleus ‐0.8118 0.0002
RPS0B YLR048W Protein component of the small (40S) ribosomal subunit, nearly identical to Rps0Ap; required for maturation of 18S rRNA along with Rps0Ap; deletion of either RPS0 gene reduces growth rate, deletion of both genes is lethal ‐0.8110 0.0002
MNN2 YBR015C Alpha‐1,2‐mannosyltransferase, responsible for addition of the first alpha‐1,2‐linked mannose to form the branches on the mannan backbone of oligosaccharides, localizes to an early Golgi compartment ‐0.8106 0.0006
AKR2 YOR034C Ankyrin repeat‐containing protein similar to Akr1p; member of a family of putative palmitoyltransferases containing an Asp‐His‐His‐
Cys‐cysteine rich (DHHC‐CRD) domain; possibly involved in constitutive endocytosis of Ste3p ‐0.8073 0.0002
RIM15 YFL033C Glucose‐repressible protein kinase involved in signal transduction during cell proliferation in response to nutrients, specifically the establishment of stationary phase; identified as a regulator of IME2; substrate of Pho80p‐Pho85p kinase ‐0.8063 0.0004
FLO10 YKR102W ‐0.8044 0.0006
NA YPL067C Lectin‐like protein with similarity to Flo1p, thought to be involved in flocculation Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; YPL067C is not an essential gene ‐0.8044 0.0003
YBP2 YGL060W ‐0.8033 0.0001
Symbols ORF Description ECM25 YJL201W NA YMR210W NA YGR266W Non‐essential protein of unknown function; promoter contains a consensus binding sequence for factor Abf1p Putative acyltransferase with similarity to Eeb1p and Eht1p, has a minor role in medium‐chain fatty acid ethyl ester biosynthesis; may be involved in lipid metabolism and detoxification Protein of unknown function, predicted to contain a single transmembrane domain; mutant has increased aneuploidy tolerance; localized to both the mitochondrial outer membrane and the plasma membrane RRT8 YOL048C BNA5 YLR231C MSG5 YNL053W SLM4 Central kinetochore associated protein that mediates mitotic progression; interacts with several central kinetochore proteins and the centromeric histone Cse4p; role in resistance to oxidative stress; similarity to Ybp1p and Slk19p 199
log2(mtr10.
Ts/WT.TS) adj.p.v
al Zinc‐finger transcription factor that regulates genes involved in branched chain amino acid biosynthesis and ammonia assimilation; positively regulated by alpha‐isopropylmalate, an intermediate in leucine biosynthesis ‐0.8030 0.0003
YPR005C Cytoplasmic protein involved in halotolerance; decreases intracellular Na+ (via Ena1p) and increases intracellular K+ by decreasing efflux; expression repressed by Ssn6p‐Tup1p and Sko1p and induced by NaCl, KCl, and sorbitol through Gcn4p ‐0.7989 0.0002
GPI10 YGL142C Integral membrane protein involved in glycosylphosphatidylinositol (GPI) anchor synthesis; putative alpha 1,2 mannosyltransferase required for addition of the third mannose onto the GPI core structure; human PIG‐Bp is a functional homolog ‐0.7988 0.0001
ECM38 YLR299W ‐0.7968 0.0006
TKL2 YBR117C Gamma‐glutamyltranspeptidase, major glutathione‐degrading enzyme; involved in detoxification of electrophilic xenobiotics; expression induced mainly by nitrogen starvation Transketolase, similar to Tkl1p; catalyzes conversion of xylulose‐5‐
phosphate and ribose‐5‐phosphate to sedoheptulose‐7‐phosphate and glyceraldehyde‐3‐phosphate in the pentose phosphate pathway; needed for synthesis of aromatic amino acids ‐0.7956 0.0009
GTO1 YGR154C ‐0.7953 0.0004
NA YFL054C ‐0.7943 0.0008
CLN3 YAL040C ‐0.7939 0.0001
EXO5 YBR163W Mitochondrial 5'‐3' exonuclease and sliding exonuclease, required for mitochondrial genome maintenance; distantly related to the RecB nuclease domain of bacterial RecBCD recombinases; may be regulated by the transcription factor Ace2 ‐0.7923 0.0002
DSS1 YMR287C 3'‐5' exoribonuclease, component of the mitochondrial degradosome along with the ATP‐dependent RNA helicase Suv3p; the degradosome associates with the ribosome and mediates turnover of aberrant or unprocessed RNAs ‐0.7906 0.0004
NAM7 YMR080C ATP‐dependent RNA helicase of the SFI superfamily involved in nonsense mediated mRNA decay; required for efficient translation termination at nonsense codons and targeting of NMD substrates to P‐bodies; involved in telomere maintenance ‐0.7897 0.0002
LAA1 YJL207C AP‐1 accessory protein; colocalizes with clathrin to the late‐Golgi apparatus; involved in TGN‐endosome transport; physically interacts with AP‐1; similar to the mammalian p200; may interact with ribosomes; YJL207C is a non‐essential gene ‐0.7891 0.0006
USE1 YGL098W Essential SNARE protein localized to the ER, involved in retrograde traffic from the Golgi to the ER; forms a complex with the SNAREs Sec22p, Sec20p and Ufe1p ‐0.7867 0.0003
NA CYC1 YGR016W YJR048W Putative protein of unknown function
Cytochrome c, isoform 1; electron carrier of the mitochondrial intermembrane space that transfers electrons from ubiquinone‐
cytochrome c oxidoreductase to cytochrome c oxidase during cellular respiration ‐0.7861 ‐0.7861 0.0006
0.0002
Symbols ORF Description LEU3 YLR451W HAL1 Omega‐class glutathione transferase; induced under oxidative stress; putative peroxisomal localization Putative channel‐like protein; similar to Fps1p; mediates passive diffusion of glycerol in the presence of ethanol G1 cyclin involved in cell cycle progression; activates Cdc28p kinase to promote the G1 to S phase transition; plays a role in regulating transcription of the other G1 cyclins, CLN1 and CLN2; regulated by phosphorylation and proteolysis 200
log2(mtr10.
Ts/WT.TS) adj.p.v
al Mitochondrial intermediate peptidase, cleaves N‐terminal residues of a subset of proteins upon import, after their cleavage by mitochondrial processing peptidase (Mas1p‐Mas2p); may contribute to mitochondrial iron homeostasis ‐0.7851 0.0003
Protein component of the large (60S) ribosomal subunit, has similarity to Rpl6Ap and to rat L6 ribosomal protein; binds to 5.8S rRNA Transmembrane protein subunit of the glycosylphosphatidylinositol transamidase complex that adds GPIs to newly synthesized proteins; human PIG‐Tp homolog Catalytic subunit of the mitochondrial inner membrane i‐AAA protease complex, which is responsible for degradation of unfolded or misfolded mitochondrial gene products; mutation causes an elevated rate of mitochondrial turnover ‐0.7845 0.0003
‐0.7839 0.0003
‐0.7835 0.0006
YOR038C Subunit of the HIR complex, a nucleosome assembly complex involved in regulation of histone gene transcription; recruits Swi‐Snf complexes to histone gene promoters; promotes heterochromatic gene silencing with Asf1p ‐0.7819 0.0002
PAU2 YEL049W Member of the seripauperin multigene family encoded mainly in subtelomeric regions, active during alcoholic fermentation, regulated by anaerobiosis, negatively regulated by oxygen, repressed by heme ‐0.7817 0.0003
ERD1 YDR414C Predicted membrane protein required for the retention of lumenal endoplasmic reticulum proteins; mutants secrete the endogenous ER protein, BiP (Kar2p) ‐0.7807 0.0006
CAT2 YML042W ‐0.7803 0.0001
STE6 YKL209C Carnitine acetyl‐CoA transferase present in both mitochondria and peroxisomes, transfers activated acetyl groups to carnitine to form acetylcarnitine which can be shuttled across membranes Plasma membrane ATP‐binding cassette (ABC) transporter required for the export of a‐factor, catalyzes ATP hydrolysis coupled to a‐
factor transport; contains 12 transmembrane domains and two ATP binding domains; expressed only in MATa cells ‐0.7801 0.0006
GCY1 YOR120W ‐0.7769 0.0006
COG4 YPR105C ‐0.7747 0.0006
MEC1 YBR136W Putative NADP(+) coupled glycerol dehydrogenase, proposed to be involved in an alternative pathway for glycerol catabolism; also has mRNA binding activity; member of the aldo‐keto reductase (AKR) family Essential component of the conserved oligomeric Golgi complex (Cog1p through Cog8p), a cytosolic tethering complex that functions in protein trafficking to mediate fusion of transport vesicles to Golgi compartments Genome integrity checkpoint protein and PI kinase superfamily member; signal transducer required for cell cycle arrest and transcriptional responses prompted by damaged or unreplicated DNA; monitors and participates in meiotic recombination ‐0.7746 0.0002
RPL18A YOL120C ‐0.7744 0.0003
SHR5 YOL110W Protein component of the large (60S) ribosomal subunit, identical to Rpl18Bp and has similarity to rat L18 ribosomal protein; intron of RPL18A pre‐mRNA forms stem‐loop structures that are a target for Rnt1p cleavage leading to degradation Subunit of a palmitoyltransferase, composed of Shr5p and Erf2p, that adds a palmitoyl lipid moiety to heterolipidated substrates such as Ras1p and Ras2p through a thioester linkage; palmitoylation is required for Ras2p membrane localization ‐0.7740 0.0008
AGC1 YPR021C ‐0.7738 0.0002
Symbols ORF Description 1‐Oct YKL134C RPL6B YLR448W GPI16 YHR188C YME1 YPR024W HIR2 Mitochondrial amino acid transporter, acts both as a glutamate uniporter and as an aspartate‐glutamate exchanger; involved in nitrogen metabolism and nitrogen compound biosynthesis 201
log2(mtr10.
Ts/WT.TS) adj.p.v
al Membrane protein involved in zinc ion homeostasis, member of the four‐protein IZH family, expression induced by zinc deficiency; deletion reduces sensitivity to elevated zinc and shortens lag phase, overexpression reduces Zap1p activity ‐0.7738 0.0003
S‐adenosylmethionine transporter of the mitochondrial inner membrane, member of the mitochondrial carrier family; required for biotin biosynthesis and respiratory growth Putative protein of unknown function; weak sequence similarity to bis (5'‐nucleotidyl)‐tetraphosphatases; (GFP)‐fusion protein localizes to the vacuole; null mutant is highly sensitive to azaserine and resistant to sodium‐O‐vandate Glucosyl transferase, involved in N‐linked glycosylation; adds glucose to the dolichol‐linked oligosaccharide precursor prior to transfer to protein during lipid‐linked oligosaccharide biosynthesis; similar to Alg6p Protein required for normal prospore membrane formation; interacts with Gip1p, which is the meiosis‐specific regulatory subunit of the Glc7p protein phosphatase; expressed specifically in spores and localizes to the prospore membrane ‐0.7728 0.0003
‐0.7702 0.0006
‐0.7697 0.0002
‐0.7684 0.0002
‐0.7670 0.0001
‐0.7666 0.0002
‐0.7659 0.0009
Putative protein of unknown function, predicted to contain a PINc domain Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the endoplasmic reticulum; YNR021W is not an essential gene ‐0.7623 0.0007
‐0.7622 0.0002
YHR078W YGR097W High osmolarity‐regulated gene of unknown function
Component of RNA polymerase II holoenzyme, phosphorylated in response to oxidative stress; has a role in destruction of Ssn8p; proposed to function in activation of the glycerol channel Fps1p; paralogous to Rgc1p ‐0.7619 ‐0.7610 0.0006
0.0002
HIP1 YGR191W ‐0.7601 0.0008
RPL16B YNL069C ‐0.7586 0.0005
UBP8 YMR223W ‐0.7583 0.0005
ESBP6 YNL125C ‐0.7573 0.0006
CIN2 YPL241C High‐affinity histidine permease, also involved in the transport of manganese ions N‐terminally acetylated protein component of the large (60S) ribosomal subunit, binds to 5.8 S rRNA; has similarity to Rpl16Ap, E. coli L13 and rat L13a ribosomal proteins; transcriptionally regulated by Rap1p Ubiquitin‐specific protease that is a component of the SAGA (Spt‐
Ada‐Gcn5‐Acetyltransferase) acetylation complex; required for SAGA‐mediated deubiquitination of histone H2B Protein with similarity to monocarboxylate permeases, appears not to be involved in transport of monocarboxylates such as lactate, pyruvate or acetate across the plasma membrane GTPase‐activating protein (GAP) for Cin4p; tubulin folding factor C involved in beta‐tubulin (Tub2p) folding; mutants display increased chromosome loss and benomyl sensitivity; deletion complemented by human GAP, retinitis pigmentosa 2 ‐0.7545 0.0002
Symbols ORF Description IZH3 YLR023C PET8 YNL003C NA YNL217W ALG8 YOR067C YSW1 YBR148W MNN5 YJL186W SWD1 YAR003W STO1 YMR125W NA YIL151C NA YNR021W NA ASK10 Alpha‐1,2‐mannosyltransferase, responsible for addition of the second alpha‐1,2‐linked mannose of the branches on the mannan backbone of oligosaccharides, localizes to an early Golgi compartment Subunit of the COMPASS (Set1C) complex, which methylates histone H3 on lysine 4 and is required in transcriptional silencing near telomeres; WD40 beta propeller superfamily member with similarity to mammalian Rbbp7 Large subunit of the nuclear mRNA cap‐binding protein complex, interacts with Npl3p to carry nuclear poly(A)+ mRNA to cytoplasm; also involved in nuclear mRNA degradation and telomere maintenance; orthologous to mammalian CBP80 202
Symbols ORF Description UBP13 YBL067C NAB6 YML117W Putative ubiquitin carboxyl‐terminal hydrolase, ubiquitin‐specific protease that cleaves ubiquitin‐protein fusions Putative RNA‐binding protein that associates with mRNAs encoding cell wall proteins in high‐throughput studies; deletion mutants display increased sensitivity to some cell wall disrupting agents; expression negatively regulated by cAMP NA YGR127W ICE2 YIL090W KSS1 YGR040W TIR1 YER011W NTH2 YBR001C BER1 YLR412W PRM8 YGL053W KSP1 YHR082C GDT1 YBR187W NA YKL091C AIM22 YJL046W HOG1 YLR113W TRZ1 YKR079C MST1 FAR11 YKL194C YNL127W Putative protein of unknown function; expression is regulated by Msn2p/Msn4p, indicating a possible role in stress response Integral ER membrane protein with type‐III transmembrane domains; mutations cause defects in cortical ER morphology in both the mother and daughter cells Mitogen‐activated protein kinase (MAPK) involved in signal transduction pathways that control filamentous growth and pheromone response; the KSS1 gene is nonfunctional in S288C strains and functional in W303 strains Cell wall mannoprotein of the Srp1p/Tip1p family of serine‐alanine‐
rich proteins; expression is downregulated at acidic pH and induced by cold shock and anaerobiosis; abundance is increased in cells cultured without shaking Putative neutral trehalase, required for thermotolerance and may mediate resistance to other cellular stresses Protein involved in microtubule‐related processes, N‐acetylation; GFP‐fusion protein localizes to the cytoplasm and is induced in response to the DNA‐damaging agent MMS; YLR412W is not an essential gene; similar to Arabidopsis SRR1 gene Pheromone‐regulated protein with 2 predicted transmembrane segments and an FF sequence, a motif involved in COPII binding; forms a complex with Prp9p in the ER; member of DUP240 gene family Ser/thr protein kinase; nuclear translocation required for haploid filamentous growth; regulates filamentous growth induced nuclear translocation of Bcy1p, Fus3p, and Sks1p; overproduction causes allele‐specific suppression of prp20‐10 Putative protein of unknown function; expression is reduced in a gcr1 null mutant; GFP‐fusion protein localizes to the vacuole; expression pattern and physical interactions suggest a possible role in ribosome biogenesis Putative homolog of Sec14p, which is a phosphatidylinositol/phosphatidylcholine transfer protein involved in lipid metabolism; localizes to the nucleus Putative lipoate‐protein ligase, required along with Lip2 and Lip5 for lipoylation of Lat1p and Kgd2p; similar to E. coli LplA; null mutant displays reduced frequency of mitochondrial genome loss Mitogen‐activated protein kinase involved in osmoregulation via three independent osmosensors; mediates the recruitment and activation of RNA Pol II at Hot1p‐dependent promoters; localization regulated by Ptp2p and Ptp3p tRNA 3'‐end processing endonuclease tRNase Z; also localized to mitochondria and interacts genetically with Rex2 exonuclease; homolog of the human candidate prostate cancer susceptibility gene ELAC2 Mitochondrial threonyl‐tRNA synthetase
Protein involved in recovery from cell cycle arrest in response to pheromone, in a Far1p‐independent pathway; interacts with Far3p, Far7p, Far8p, Far9p, and Far10p; has similarity to the N‐ and C‐
termini of N. crassa HAM‐2 203
log2(mtr10.
Ts/WT.TS) adj.p.v
al ‐0.7540 0.0004
‐0.7519 0.0006
‐0.7517 0.0007
‐0.7515 0.0004
‐0.7505 0.0005
‐0.7499 0.0004
‐0.7498 0.0002
‐0.7491 0.0003
‐0.7490 0.0001
‐0.7458 0.0006
‐0.7451 0.0001
‐0.7450 0.0007
‐0.7440 0.0002
‐0.7433 0.0003
‐0.7416 0.0003
‐0.7414 ‐0.7404 0.0004
0.0007
log2(mtr10.
Ts/WT.TS) adj.p.v
al Glutamine‐dependent NAD(+) synthetase, essential for the formation of NAD(+) from nicotinic acid adenine dinucleotide Rab escort protein, forms a complex with the Ras‐like small GTPase Ypt1p that is required for the prenylation of Ypt1p by protein geranylgeranyltransferase type II (Bet2p‐Bet4p); sequence similarity to mammalian choroideraemia gene Sterol regulatory element binding protein, regulates transcription of sterol biosynthetic genes; contains Zn[2]‐Cys[6] binuclear cluster; homologous to Upc2p; relocates from intracellular membranes to perinuclear foci on sterol depletion Plasma membrane ATP‐binding cassette (ABC) transporter, multidrug transporter mediates export of many different organic anions including oligomycin; similar to human cystic fibrosis transmembrane receptor (CFTR) Putative protein of unknown function
Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; expressed during copper starvation; YOR296W is not an essential gene Protein involved in regulation of nonhomologous end joining; interacts with DNA ligase IV components Dnl4p and Lif1p; repressed by MAT heterozygosity; regulates cellular distribution of Lif1p Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl12Bp; rpl12a rpl12b double mutant exhibits slow growth and slow translation; has similarity to E. coli L11 and rat L12 ribosomal proteins Vacuolar membrane protein involved in the ATP‐dependent transport of arginine into the vacuole and possibly in balancing ion homeostasis; homolog of human CLN3 involved in Batten disease (juvenile onset neuronal ceroid lipofuscinosis) ‐0.7401 0.0003
‐0.7383 0.0001
‐0.7383 0.0006
‐0.7374 0.0002
‐0.7338 ‐0.7302 0.0002
0.0004
‐0.7282 0.0003
‐0.7282 0.0008
‐0.7275 0.0005
YFR014C Calmodulin‐dependent protein kinase; may play a role in stress response, many CA++/calmodulan dependent phosphorylation substrates demonstrated in vitro, amino acid sequence similar to Cmk2p and mammalian Cam Kinase II ‐0.7269 0.0006
AIM18 YHR198C Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies; null mutant displays elevated frequency of mitochondrial genome loss ‐0.7253 0.0010
UTP22 YGR090W Possible U3 snoRNP protein involved in maturation of pre‐18S rRNA, based on computational analysis of large‐scale protein‐protein interaction data ‐0.7240 0.0002
MAL31 YBR298C Maltose permease, high‐affinity maltose transporter (alpha‐
glucoside transporter); encoded in the MAL3 complex locus; member of the 12 transmembrane domain superfamily of sugar transporters; functional in genomic reference strain S288C ‐0.7239 0.0006
NCR1 YPL006W Vacuolar membrane protein that transits through the biosynthetic vacuolar protein sorting pathway, involved in sphingolipid metabolism; glycoprotein and functional orthologue of human Niemann Pick C1 (NPC1) protein ‐0.7234 0.0009
PEX2 YJL210W RING‐finger peroxin and E3 ubiquitin ligase, peroxisomal membrane protein with a C‐terminal zinc‐binding RING domain, forms translocation subcomplex with Pex10p and Pex12p which functions in peroxisomal matrix protein import ‐0.7187 0.0003
AXL1 YPR122W Haploid specific endoprotease that performs one of two N‐terminal cleavages during maturation of a‐factor mating pheromone; required for axial budding pattern of haploid cells ‐0.7183 0.0007
Symbols ORF Description QNS1 YHR074W MRS6 YOR370C ECM22 YLR228C YOR1 YGR281W NA NA YOR390W YOR296W NEJ1 YLR265C RPL12A YEL054C YHC3 YJL059W CMK1 204
log2(mtr10.
Ts/WT.TS) adj.p.v
al Non‐essential tetra‐spanning membrane protein found mostly in the late Golgi, can suppress some sed5 alleles; may be part of the transport machinery, but precise function is unknown; similar to mammalian syntaxin 5 ‐0.7170 0.0003
Nicotinic acid mononucleotide adenylyltransferase, involved in pathways of NAD biosynthesis, including the de novo, NAD(+) salvage, and nicotinamide riboside salvage pathways Mitochondrial protein of unknown function; homozygous diploid deletion strain has a sporulation defect characterized by elevated dityrosine in the soluble fraction; expression induced by calcium shortage; YJL147W is a non‐essential gene ‐0.7166 0.0001
‐0.7149 0.0008
Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; potential Cdc28p substrate ‐0.7148 0.0003
YIL036W Basic leucine zipper (bZIP) transcription factor of the ATF/CREB family, proposed to be a regulator of oleate responsive genes; involved in utilization of non‐optimal carbon sources and chromosome stability ‐0.7148 0.0010
RFT1 YBL020W Essential integral membrane protein that is required for translocation of Man5GlcNac2‐PP‐Dol from the cytoplasmic side to the lumenal side of the ER membrane but is not the flippase; mutation is suppressed by expression of human p53 protein ‐0.7110 0.0002
PAU5 YFL020C Member of the seripauperin multigene family encoded mainly in subtelomeric regions; induced during alcoholic fermentation; induced by low temperature and also by anaerobic conditions; negatively regulated by oxygen and repressed by heme ‐0.7083 0.0009
NA YHR035W Putative protein of unknown function; not an essential gene
‐0.7073 0.0003
STP22 YCL008C Component of the ESCRT‐I complex, which is involved in ubiquitin‐
dependent sorting of proteins into the endosome; homologous to the mouse and human Tsg101 tumor susceptibility gene; mutants exhibit a Class E Vps phenotype ‐0.7068 0.0004
NUP157 YER105C Abundant subunit of the nuclear pore complex (NPC), present on both sides of the NPC; has similarity to Nup170p; essential role, with Nup170p, in NPC assembly ‐0.7064 0.0004
BTS1 YPL069C Geranylgeranyl diphosphate synthase, increases the intracellular pool of geranylgeranyl diphosphate, suppressor of bet2 mutation that causes defective geranylgeranylation of small GTP‐binding proteins that mediate vesicular traffic ‐0.7058 0.0005
TOK1 YJL093C Outward‐rectifier potassium channel of the plasma membrane with two pore domains in tandem, each of which forms a functional channel permeable to potassium; carboxy tail functions to prevent inner gate closures; target of K1 toxin ‐0.7051 0.0004
PCL8 YPL219W Cyclin, interacts with Pho85p cyclin‐dependent kinase (Cdk) to phosphorylate and regulate glycogen synthase, also activates Pho85p for Glc8p phosphorylation ‐0.7047 0.0003
TUL1 YKL034W Golgi‐localized RING‐finger ubiquitin ligase (E3), involved in ubiquitinating and sorting membrane proteins that contain polar transmembrane domains to multivesicular bodies for delivery to the vacuole for quality control purposes ‐0.7047 0.0009
RSF2 YJR127C Zinc‐finger protein involved in transcriptional control of both nuclear and mitochondrial genes, many of which specify products required for glycerol‐based growth, respiration, and other functions ‐0.7046 0.0006
Symbols ORF Description SFT2 YBL102W NMA1 YLR328W NA YJL147C NA YHR159W CST6 205
log2(mtr10.
Ts/WT.TS) adj.p.v
al ‐0.7045 0.0004
‐0.7041 0.0004
‐0.7027 0.0004
‐0.7024 0.0009
Putative protein of unknown function
Putative protein of unknown function; GFP‐fusion protein localizes to the cytoplasm; conserved in closely related Saccharomyces species ‐0.7022 ‐0.7015 0.0006
0.0002
NA YER150W NA GPI‐anchored cell wall protein involved in weak acid resistance; basal expression requires Msn2p/Msn4p; expression is induced under conditions of stress and during the diauxic shift; similar to Sed1p ‐0.7014 ‐0.7005 0.0007
0.0009
MSN1 YOL116W Transcriptional activator involved in regulation of invertase and glucoamylase expression, invasive growth and pseudohyphal differentiation, iron uptake, chromium accumulation, and response to osmotic stress; localizes to the nucleus ‐0.6982 0.0003
NA YKL027W ‐0.6977 0.0007
ARG2 YJL071W Protein of unknown function, localized to the mitochondrial outer membrane Acetylglutamate synthase (glutamate N‐acetyltransferase), mitochondrial enzyme that catalyzes the first step in the biosynthesis of the arginine precursor ornithine; forms a complex with Arg5,6p ‐0.6976 0.0006
PHO91 YNR013C Low‐affinity phosphate transporter of the vacuolar membrane; deletion of pho84, pho87, pho89, pho90, and pho91 causes synthetic lethality; transcription independent of Pi and Pho4p activity; overexpression results in vigorous growth ‐0.6970 0.0002
NA YJR015W Putative protein of unknown function; localizes to the endoplasmic reticulum and cytoplasm; predicted to encode a membrane transporter based on phylogenetic analysis; YJR015W is a non‐
essential gene ‐0.6967 0.0002
SUR1 YPL057C Probable catalytic subunit of a mannosylinositol phosphorylceramide (MIPC) synthase, forms a complex with probable regulatory subunit Csg2p; function in sphingolipid biosynthesis is overlapping with that of Csh1p ‐0.6954 0.0007
TED1 YIL039W Conserved phosphoesterase domain‐containing protein that acts together with Emp24p/Erv25p in cargo exit from the ER; deletion confers sensitivity to 4‐(N‐(S‐glutathionylacetyl)amino) phenylarsenoxide (GSAO) ‐0.6950 0.0002
SAS5 YOR213C Subunit of the SAS complex (Sas2p, Sas4p, Sas5p), which acetylates free histones and nucleosomes and regulates transcriptional silencing; stimulates Sas2p HAT activity ‐0.6915 0.0008
NA KEG1 YKR051W YFR042W Putative protein of unknown function
Integral membrane protein of the ER; physically interacts with Kre6p; has a role in the synthesis of beta‐1,6‐glucan in the cell wall; required for cell viability ‐0.6914 ‐0.6877 0.0003
0.0007
Symbols ORF Description COT1 YOR316C SGF11 YPL047W Vacuolar transporter that mediates zinc transport into the vacuole; overexpression confers resistance to cobalt and rhodium Integral subunit of SAGA histone acetyltransferase complex, regulates transcription of a subset of SAGA‐regulated genes, required for the Ubp8p association with SAGA and for H2B deubiquitylation NA YIL092W AMN1 YBR158W NA NA YKR005C YJL016W NA SPI1 Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and to the nucleus Protein required for daughter cell separation, multiple mitotic checkpoints, and chromosome stability; contains 12 degenerate leucine‐rich repeat motifs; expression is induced by the Mitotic Exit Network (MEN) 206
log2(mtr10.
Ts/WT.TS) adj.p.v
al Putative sensor/transporter protein involved in cell wall biogenesis; contains 14‐16 transmembrane segments and several putative glycosylation and phosphorylation sites; null mutation is synthetically lethal with pkc1 deletion ‐0.6876 0.0006
Cell‐cycle regulated activator of anaphase‐promoting complex/cyclosome (APC/C), which is required for metaphase/anaphase transition; directs ubiquitination of mitotic cyclins, Pds1p, and other anaphase inhibitors; potential Cdc28p substrate Protein functioning in transport of glycosylphosphatidylinositol intermediates into ER lumen; required for normal intracellular sterol distribution; human ARV1 required for normal cholesterol and bile acid homeostasis; similar to Nup120p ‐0.6843 0.0001
‐0.6839 0.0010
YNL238W Subtilisin‐like protease (proprotein convertase), a calcium‐
dependent serine protease involved in the activation of proproteins of the secretory pathway ‐0.6821 0.0003
NSG1 YHR133C Protein involved in regulation of sterol biosynthesis; specifically stabilizes Hmg2p, one of two HMG‐CoA isoenzymes that catalyze the rate‐limiting step in sterol biosynthesis; homolog of mammalian INSIG proteins ‐0.6797 0.0002
RIM2 YBR192W ‐0.6788 0.0003
POR2 YIL114C ‐0.6786 0.0001
EST3 YIL009C‐A ‐0.6782 0.0007
NA YPR127W Mitochondrial pyrimidine nucleotide transporter; imports pyrimidine nucleoside triphosphates and exports pyrimidine nucleoside monophosphates; member of the mitochondrial carrier family Putative mitochondrial porin (voltage‐dependent anion channel), related to Por1p but not required for mitochondrial membrane permeability or mitochondrial osmotic stability Component of the telomerase holoenzyme, involved in telomere replication Protein of unknown function, differentially expressed during alcoholic fermentation; expression activated by transcription factor YRM1/YOR172W; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus ‐0.6777 0.0005
ERG24 YNL280C C‐14 sterol reductase, acts in ergosterol biosynthesis; mutants accumulate the abnormal sterol ignosterol (ergosta‐8,14 dienol), and are viable under anaerobic growth conditions but inviable on rich medium under aerobic conditions ‐0.6772 0.0008
RML2 YEL050C Mitochondrial ribosomal protein of the large subunit, has similarity to E. coli L2 ribosomal protein; fat21 mutant allele causes inability to utilize oleate and may interfere with activity of the Adr1p transcription factor ‐0.6771 0.0006
CLB4 YLR210W B‐type cyclin involved in cell cycle progression; activates Cdc28p to promote the G2/M transition; may be involved in DNA replication and spindle assembly; accumulates during S phase and G2, then targeted for ubiquitin‐mediated degradation ‐0.6756 0.0003
LSB3 YFR024C‐A ‐0.6733 0.0002
YUR1 YJL139C ‐0.6709 0.0006
TYW3 YGL050W Protein containing a C‐terminal SH3 domain; binds Las17p, which is a homolog of human Wiskott‐Aldrich Syndrome protein involved in actin patch assembly and actin polymerization Mannosyltransferase of the KTR1 family, involved in protein N‐
glycosylation; located in the Golgi apparatus tRNA methyltransferase required for synthesis of wybutosine, a modified guanosine found at the 3'‐position adjacent to the anticodon of phenylalanine tRNA which supports reading frame maintenance by stabilizing codon‐anticodon interactions ‐0.6693 0.0002
Symbols ORF Description CWH43 YCR017C CDC20 YGL116W ARV1 YLR242C KEX2 207
log2(mtr10.
Ts/WT.TS) adj.p.v
al Mannosyltransferase, involved in asparagine‐linked glycosylation in the endoplasmic reticulum (ER); essential for viability, mutation is functionally complemented by human ortholog ‐0.6684 0.0005
YMR258C Protein of unknown function with similarity to F‐box proteins; physically interacts with Skp1p; green fluorescent protein (GFP)‐
fusion protein localizes to the cytoplasm and nucleus; YMR258C is not an essential gene ‐0.6683 0.0004
NA YCR015C ‐0.6653 0.0002
SYP1 YCR030C Putative protein of unknown function; YCR015C is not an essential gene Protein of unknown function that is involved in endocytic site formation; may regulate assembly and disassembly of the septin ring; colocalizes and interacts with septin subunits; potential role in actin cytoskeletal organization ‐0.6649 0.0006
NA YOR019W ‐0.6644 0.0003
PSY2 YNL201C Protein of unknown function that may interact with ribosomes, based on co‐purification experiments Putative subunit of an evolutionarily conserved protein phosphatase complex containing the catalytic subunit Pph3p and the regulatory subunit Psy4p; required for cisplatin and oxaliplatin resistance; putative homolog of mammalian R3 ‐0.6640 0.0005
NA YFR035C ‐0.6639 0.0009
ADH4 YGL256W Putative protein of unknown function, deletion mutant exhibits synthetic phenotype with alpha‐synuclein Alcohol dehydrogenase isoenzyme type IV, dimeric enzyme demonstrated to be zinc‐dependent despite sequence similarity to iron‐activated alcohol dehydrogenases; transcription is induced in response to zinc deficiency ‐0.6615 0.0004
PRR2 YDL214C Serine/threonine protein kinase that inhibits pheromone induced signalling downstream of MAPK, possibly at the level of the Ste12p transcription factor; mutant has increased aneuploidy tolerance ‐0.6613 0.0003
MKK1 YOR231W Mitogen‐activated kinase kinase involved in protein kinase C signaling pathway that controls cell integrity; upon activation by Bck1p phosphorylates downstream target, Slt2p; functionally redundant with Mkk2p ‐0.6594 0.0002
RGD2 MDM38 YFL047W YOL027C GTPase‐activating protein (RhoGAP) for Cdc42p and Rho5p
Mitochondrial inner membrane protein, involved in membrane integration of a subset of mitochondrial proteins; required for K+/H+ exchange; associates with mitochondrial ribosomes; human ortholog Letm1 implicated in Wolf‐Hirschhorn syndrome ‐0.6585 ‐0.6572 0.0002
0.0005
VID28 YIL017C Protein involved in proteasome‐dependent catabolite degradation of fructose‐1,6‐bisphosphatase (FBPase); localized to the nucleus and the cytoplasm ‐0.6572 0.0006
AFI1 YOR129C Arf3p polarization‐specific docking factor, required for the polarized distribution of the ADP‐ribosylation factor, Arf3p; participates in polarity development and maintenance of a normal haploid budding pattern; interacts with Cnm7p ‐0.6569 0.0009
PGA1 YNL158W Essential component of GPI‐mannosyltransferase II, responsible for second mannose addition to GPI precursors as a partner of Gpi18p; required for maturation of Gas1p and Pho8p; has synthetic genetic interations with secretory pathway genes ‐0.6565 0.0009
COX15 YER141W Protein required for the hydroxylation of heme O to form heme A, which is an essential prosthetic group for cytochrome c oxidase ‐0.6562 0.0005
Symbols ORF Description ALG1 YBR110W NA 208
log2(mtr10.
Ts/WT.TS) adj.p.v
al Plasma membrane H+‐ATPase, pumps protons out of the cell; major regulator of cytoplasmic pH and plasma membrane potential; part of the P2 subgroup of cation‐transporting ATPases; Hsp30p plays a role in Pma1p regulation ‐0.6516 0.0003
Protein of unknown function, contains a J‐domain, which is a region with homology to the E. coli DnaJ protein Type II phosphatidylinositol 4‐kinase that binds Las17p, which is a homolog of human Wiskott‐Aldrich Syndrome protein involved in actin patch assembly and actin polymerization ‐0.6508 0.0007
‐0.6499 0.0006
RNA binding protein involved in the asymmetric localization of ASH1 mRNA; represses translation of ASH1 mRNA, an effect reversed by Yck1p‐dependent phosphoryation; regulates telomere position effect and length; similarity to hnRNP‐K ‐0.6497 0.0003
YNR028W Peptidyl‐prolyl cis‐trans isomerase (cyclophilin), catalyzes the cis‐
trans isomerization of peptide bonds N‐terminal to proline residues; similarity to Cpr4p suggests a potential role in the secretory pathway ‐0.6473 0.0003
NA YLR177W Putative protein of unknown function; phosphorylated by Dbf2p‐
Mob1p in vitro; some strains contain microsatellite polymophisms at this locus; YLR177W is not an essential gene ‐0.6469 0.0008
WRS1 YOL097C ‐0.6458 0.0006
AIM19 YIL087C ‐0.6412 0.0004
ATG7 YHR171W Cytoplasmic tryptophanyl‐tRNA synthetase, aminoacylates tryptophanyl‐tRNA Putative protein of unknown function; the authentic, non‐tagged protein is detected in purified mitochondria in high‐throughput studies; null mutant displays reduced respiratory growth Autophagy‐related protein and dual specificity member of the E1 family of ubiquitin‐activating enzymes; mediates the conjugation of Atg12p with Atg5p and Atg8p with phosphatidylethanolamine, required steps in autophagosome formation ‐0.6401 0.0010
DOG1 YHR044C 2‐deoxyglucose‐6‐phosphate phosphatase, similar to Dog2p, member of a family of low molecular weight phosphatases; confers 2‐deoxyglucose resistance when overexpressed, in vivo substrate has not yet been identified ‐0.6398 0.0005
PDR17 YNL264C Phosphatidylinositol transfer protein (PITP), downregulates Plb1p‐
mediated turnover of phosphatidylcholine, found in the cytosol and microsomes, homologous to Pdr16p, deletion affects phospholipid composition ‐0.6393 0.0003
YDC1 YPL087W ‐0.6369 0.0007
RKR1 YMR247C Alkaline dihydroceramidase, involved in sphingolipid metabolism; preferentially hydrolyzes dihydroceramide to a free fatty acid and dihydrosphingosine; has a minor reverse activity RING domain E3 ubiquitin ligase; involved in the ubiquitin‐mediated degradation of non‐stop proteins; functional connections to chromatin modification; nuclear protein that also co‐localizes with ribosomes; homolog of mouse listerin ‐0.6334 0.0002
IRC20 YLR247C Putative helicase; localizes to the mitochondrion and the nucleus; YLR247C is not an essential gene; null mutant displays increased levels of spontaneous Rad52p foci ‐0.6333 0.0008
PTK1 YKL198C Putative serine/threonine protein kinase that regulates spermine uptake; involved in polyamine transport; possible mitochondrial protein ‐0.6332 0.0003
GCD7 YLR291C Beta subunit of the translation initiation factor eIF2B, the guanine‐
nucleotide exchange factor for eIF2; activity subsequently regulated by phosphorylated eIF2; first identified as a negative regulator of GCN4 expression ‐0.6312 0.0003
Symbols ORF Description PMA1 YGL008C JJJ2 YJL162C LSB6 YJL100W HEK2 YBL032W CPR8 209
log2(mtr10.
Ts/WT.TS) adj.p.v
al ‐0.6312 0.0006
‐0.6311 ‐0.6284 0.0010
0.0007
Transcriptional activator of the basic leucine zipper (bZIP) family, required for transcription of genes involved in resistance to arsenic compounds ‐0.6266 0.0006
YBR023C Chitin synthase III, catalyzes the transfer of N‐acetylglucosamine (GlcNAc) to chitin; required for synthesis of the majority of cell wall chitin, the chitin ring during bud emergence, and spore wall chitosan ‐0.6262 0.0004
LDB16 YCL005W Protein of unknown function; null mutants have decreased net negative cell surface charge; GFP‐fusion protein expression is induced in response to the DNA‐damaging agent MMS; native protein is detected in purified mitochondria ‐0.6218 0.0002
RPS18B YML026C Protein component of the small (40S) ribosomal subunit; nearly identical to Rps18Ap and has similarity to E. coli S13 and rat S18 ribosomal proteins ‐0.6213 0.0002
HVG1 CPT1 YER039C YNL130C Protein of unknown function, has homology to Vrg4p
Cholinephosphotransferase, required for phosphatidylcholine biosynthesis and for inositol‐dependent regulation of EPT1 transcription ‐0.6209 ‐0.6207 0.0003
0.0004
NA YBR235W Putative ion transporter, similar to mammalian electroneutral Na(+)‐
(K+)‐C1‐ cotransporter family; YBR235W is not an essential gene ‐0.6202 0.0006
YMD8 YML038C Putative nucleotide sugar transporter, has similarity to Vrg4p
‐0.6174 0.0004
DFG10 YIL049W Protein of unknown function, involved in filamentous growth
‐0.6172 0.0004
NA YHR045W Putative protein of unknown function; possible role in iron metabolism and/or amino acid and carbohydrate metabolism; green fluorescent protein (GFP)‐fusion protein localizes to the endoplasmic reticulum ‐0.6166 0.0004
YCK2 YNL154C Palmitoylated plasma membrane‐bound casein kinase I isoform; shares redundant functions with Yck1p in morphogenesis, proper septin assembly, endocytic trafficking; provides an essential function overlapping with that of Yck1p ‐0.6162 0.0006
CAN1 YEL063C ‐0.6149 0.0002
ODC2 YOR222W Plasma membrane arginine permease, requires phosphatidyl ethanolamine (PE) for localization, exclusively associated with lipid rafts; mutation confers canavanine resistance Mitochondrial inner membrane transporter, exports 2‐oxoadipate and 2‐oxoglutarate from the mitochondrial matrix to the cytosol for use in lysine and glutamate biosynthesis and in lysine catabolism ‐0.6146 0.0002
LEU5 YHR002W Mitochondrial carrier protein involved in the accumulation of CoA in the mitochondrial matrix; homolog of human Graves disease protein; does not encode an isozyme of Leu4p, as first hypothesized ‐0.6127 0.0004
NA CIR2 YOL098C YOR356W Putative metalloprotease
Putative ortholog of human electron transfer flavoprotein dehydrogenase (ETF‐dH); found in a large supramolecular complex with other mitochondrial dehydrogenases; may have a role in oxidative stress response ‐0.6120 ‐0.6118 0.0004
0.0006
Symbols ORF Description NA YBR219C NA RPL17A NA YKL180W Putative protein of unknown function; YBR219C is not an essential gene NA Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl17Bp and has similarity to E. coli L22 and rat L17 ribosomal proteins; copurifies with the Dam1 complex (aka DASH complex) ARR1 YPR199C CHS3 210
log2(mtr10.
Ts/WT.TS) adj.p.v
al Uncharacterized protein of unknown function
Cell wall mannoprotein of the Srp1p/Tip1p family of serine‐alanine‐
rich proteins; expressed under anaerobic conditions and required for anaerobic growth ‐0.6094 ‐0.6073 0.0008
0.0003
YPL202C Iron‐regulated transcriptional activator; activates genes involved in intracellular iron use and required for iron homeostasis and resistance to oxidative stress; similar to Aft1p ‐0.6049 0.0004
MDL2 YPL270W Mitochondrial inner membrane half‐type ATP‐binding cassette (ABC) transporter, required for respiratory growth at high temperature; similar to human TAP1 and TAP2 implicated in bare lymphocyte syndrome and Wegener‐like granulomatosis ‐0.6019 0.0010
SCS3 YGL126W Protein required for inositol prototrophy, identified as an ortholog of the FIT family of proteins involved in triglyceride droplet biosynthesis; disputed role in the synthesis of inositol phospholipids from inositol ‐0.6013 0.0010
Symbols ORF Description NA TIR3 YIL067C YIL011W AFT2 211
APPENDIX J: Up-regulated genes in mtr10Δ cells
in amino acid starved condition
This section includes the list of transcriptionally differentially expressed genes (cutoff
conditions: log2 FC
0.6 and adjusted p-value < 0.001) in mtr10Δ cells in amino acid
starved condition.
Up-regulated genes in mtr10Δ cells in amino acid starved condition.
log2(mtr1
0.Ts/WT.T
s) adj.p.val Subunit of the Cop9 signalosome, which is required for deneddylation, or removal of the ubiquitin‐like protein Rub1p from Cdc53p (cullin); involved in adaptation to pheromone signaling 3.1021 0.0000
Glycerol proton symporter of the plasma membrane, subject to glucose‐induced inactivation, strongly but transiently induced when cells are subjected to osmotic shock Putative membrane protein of unknown function
Predicted tail‐anchored plasma membrane protein containing a conserved CYSTM module; related proteins in other organisms may be involved in response to stress; green fluorescent protein (GFP)‐
fusion protein localizes to the cell periphery 2.4358 0.0000
2.4040 2.3777 0.0000
0.0000
Cis‐golgi localized protein involved in ER to Golgi transport; forms a complex with the mammalian GRASP65 homolog, Grh1p; mutants are compromised for the fusion of ER‐derived vesicles with Golgi membranes 2.1003 0.0000
Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the dubious ORF YBR056C‐B Putative protein of unknown function with similarity to acyl‐carrier‐
protein reductases; YDL114W is not an essential gene 2.0108 0.0001
2.0075 0.0001
1.9835 0.0000
Symbols ORF Description CSN9 YDR179C STL1 YDR536W NA NA YNR062C YDR034W‐B BUG1 YDL099W NA YBR056W‐A NA YDL114W SDC1 YDR469W Subunit of the COMPASS (Set1C) complex, which methylates lysine 4 of histone H3 and is required in chromatin silencing at telomeres; contains a Dpy‐30 domain that mediates interaction with Bre2p; similar to C. elegans and human DPY‐30 212
log2(mtr1
0.Ts/WT.T
s) adj.p.val Subunit of a kinetochore‐microtubule binding complex with Spc105p that bridges centromeric heterochromatin and kinetochore MAPs and motors, and is also required for sister chromatid bi‐
orientation and kinetochore binding of SAC components 1.9616 0.0000
YDR515W RNA binding protein that associates with polysomes; proposed to be involved in regulating mRNA translation; involved in the copper‐
dependent mineralization of copper sulfide complexes on cell surface in cells cultured in copper salts 1.9587 0.0000
NA YFR012W‐A Putative protein of unknown function; identified by homology
1.9170 0.0000
DON1 YDR273W Meiosis‐specific component of the spindle pole body, part of the leading edge protein (LEP) coat, forms a ring‐like structure at the leading edge of the prospore membrane during meiosis II 1.8897 0.0000
NA CSM4 YDR514C YPL200W Putative protein of unknown function
Protein required for accurate chromosome segregation during meiosis; involved in meiotic telomere clustering (bouquet formation) and telomere‐led rapid prophase movements 1.8877 1.8867 0.0000
0.0001
SRT1 YMR101C Cis‐prenyltransferase involved in synthesis of long‐chain dolichols (19‐22 isoprene units; as opposed to Rer2p which synthesizes shorter‐chain dolichols); localizes to lipid bodies; transcription is induced during stationary phase 1.8689 0.0000
NA NSE4 YAR064W YDL105W 1.8530 1.8367 0.0000
0.0001
TFB5 YDR079C‐A Putative protein of unknown function
Nuclear protein that plays a role in the function of the Smc5p‐
Rhc18p complex Component of the RNA polymerase II general transcription and DNA repair factor TFIIH; involved in transcription initiation and in nucleotide‐excision repair; homolog of Chlamydomonas reinhardtii REX1‐S protein involved in DNA repair 1.8357 0.0000
DAD4 YDR320C‐A Essential subunit of the Dam1 complex (aka DASH complex), couples kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; is transferred to the kinetochore prior to mitosis 1.8149 0.0000
PEX19 YDL065C Chaperone and import receptor for newly‐synthesized class I peroxisomal membrane proteins (PMPs), binds PMPs in the cytoplasm and delivers them to the peroxisome for subsequent insertion into the peroxisomal membrane 1.7924 0.0000
NOP6 YDL213C rRNA‐binding protein required for 40S ribosomal subunit biogenesis; contains an RNA recognition motif (RRM) and has similarity to hydrophilins; NOP6 may be a fungal‐specific gene as no homologs have been yet identified in higher eukaryotes 1.7819 0.0000
SNN1 YNL086W Putative protein of unknown function; likely member of BLOC complex involved in endosomal cargo sorting; green fluorescent protein (GFP)‐fusion protein localizes to endosomes 1.7769 0.0000
MSH6 YDR097C Protein required for mismatch repair in mitosis and meiosis, forms a complex with Msh2p to repair both single‐base & insertion‐deletion mispairs; potentially phosphorylated by Cdc28p 1.7721 0.0000
NA NA YDR374C YBR219C Putative protein of unknown function
Putative protein of unknown function; YBR219C is not an essential gene 1.7619 1.7564 0.0000
0.0001
Symbols ORF Description KRE28 YDR532C SLF1 213
log2(mtr1
0.Ts/WT.T
s) adj.p.val Putative protein of unknown function; mutant in a srs2 mutant background displays MMS hypersensitivity; ortholog of human MHF2, a component of the Fanconi anemia (FA) complex that is involved in maintaining genome stability 1.7098 0.0000
YDR412W Component of the pre‐60S pre‐ribosomal particle; required for cell viability under standard (aerobic) conditions but not under anaerobic conditions; exonuclease required for 5&#8242; end processing of pre‐60S ribosomal RNA 1.7033 0.0001
RAD34 YDR314C 1.6958 0.0000
TAF10 YDR167W Protein involved in nucleotide excision repair (NER); homologous to RAD4 Subunit (145 kDa) of TFIID and SAGA complexes, involved in RNA polymerase II transcription initiation and in chromatin modification 1.6930 0.0000
PES4 YFR023W 1.6841 0.0000
JAC1 YGL018C 1.6789 0.0000
ZIP1 YDR285W Transverse filament protein of the synaptonemal complex; required for normal levels of meiotic recombination and pairing between homologous chromosome during meiosis; potential Cdc28p substrate 1.6739 0.0000
DYN2 YDR424C Cytoplasmic light chain dynein, microtubule motor protein; proposed to be involved in the assembly of the nuclear pore complex 1.6724 0.0000
HXT9 YJL219W Putative hexose transporter that is nearly identical to Hxt11p, has similarity to major facilitator superfamily (MFS) transporters, expression of HXT9 is regulated by transcription factors Pdr1p and Pdr3p 1.6722 0.0001
NA YOR072W‐B 1.6602 0.0006
RAD28 YDR030C Putative protein of unknown function; identified by expression profiling and mass spectrometry Protein involved in DNA repair, related to the human CSA protein that is involved in transcription‐coupled repair nucleotide excision repair 1.6540 0.0000
CWC15 YDR163W Non‐essential protein involved in pre‐mRNA splicing, component of a complex containing Cef1p; has similarity to S. pombe Cwf15p 1.6455 0.0000
MGT1 YDL200C DNA repair methyltransferase (6‐O‐methylguanine‐DNA methylase) involved in protection against DNA alkylation damage 1.6327 0.0000
TMA23 YMR269W Nucleolar protein of unknown function implicated in ribosome biogenesis; TMA23 may be a fungal‐specific gene as no homologs have been yet identified in higher eukaryotes 1.6318 0.0006
URM1 YIL008W Ubiquitin‐like protein involved in thiolation of cytoplasmic tRNAs; receives sulfur from the E1‐like enzyme Uba4p and transfers it to tRNA; also functions as a protein tag with roles in nutrient sensing and oxidative stress response 1.6288 0.0001
RPT2 YDL007W One of six ATPases of the 19S regulatory particle of the 26S proteasome involved in the degradation of ubiquitinated substrates; required for normal peptide hydrolysis by the core 20S particle 1.6213 0.0000
Symbols ORF Description NA YDL160C‐A RRP17 Poly(A) binding protein, suppressor of DNA polymerase epsilon mutation, similar to Mip6p Specialized J‐protein that functions with Hsp70 in Fe‐S cluster biogenesis in mitochondria, involved in iron metabolism; contains a J domain typical to J‐type chaperones; localizes to the mitochondrial matrix 214
log2(mtr1
0.Ts/WT.T
s) adj.p.val Hsp90 chaperone required for pheromone signaling and negative regulation of Hsf1p; docks with Tom70p for mitochondrial preprotein delivery; promotes telomerase DNA binding and nucleotide addition; interacts with Cns1p, Cpr6p, Cpr7p, Sti1p 1.6164 0.0002
YGR146C‐A YNL210W Putative protein of unknown function
Protein with RNA‐binding motifs required for meiosis‐specific mRNA splicing; required for chromosome pairing and meiotic recombination 1.6157 1.6117 0.0000
0.0000
FAP7 YDL166C Essential NTPase required for small ribosome subunit synthesis, mediates processing of the 20S pre‐rRNA at site D in the cytoplasm but associates only transiently with 43S preribosomes via Rps14p, may be the endonuclease for site D 1.5956 0.0001
YPS3 YLR121C Aspartic protease, member of the yapsin family of proteases involved in cell wall growth and maintenance; attached to the plasma membrane via a glycosylphosphatidylinositol (GPI) anchor 1.5860 0.0002
CNL1 YDR357C Protein of unknown function; likely member of BLOC complex involved in endosomal cargo sorting; null mutant is sensitive to drug inducing secretion of vacuolar cargo; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm 1.5805 0.0001
MBP1 YDL056W Transcription factor involved in regulation of cell cycle progression from G1 to S phase, forms a complex with Swi6p that binds to MluI cell cycle box regulatory element in promoters of DNA synthesis genes 1.5753 0.0001
SAS10 YDL153C Essential subunit of U3‐containing Small Subunit (SSU) processome complex involved in production of 18S rRNA and assembly of small ribosomal subunit; disrupts silencing when overproduced; mutant has increased aneuploidy tolerance 1.5740 0.0007
CAR1 YPL111W 1.5642 0.0001
RPC53 ESF1 YDL150W YDR365C 1.5616 1.5547 0.0003
0.0001
NA YDL177C 1.5505 0.0000
VPS64 YDR200C Arginase, responsible for arginine degradation, expression responds to both induction by arginine and nitrogen catabolite repression; disruption enhances freeze tolerance RNA polymerase III subunit C53
Nucleolar protein involved in pre‐rRNA processing; depletion causes severely decreased 18S rRNA levels Putative protein of unknown function; similar to the mouse IMPACT gene; YDL177C is not an essential gene Protein required for cytoplasm to vacuole targeting of proteins; forms a complex with Far3p and Far7p to Far11p involved in recovery from pheromone‐induced cell cycle arrest; mutant has increased aneuploidy tolerance 1.5494 0.0002
NA YLR154C‐H 1.5435 0.0003
SEM1 YDR363W‐A Putative protein of unknown function identified by fungal homology comparisons and RT‐PCR; this ORF partially overlaps RND5‐2 Component of the lid subcomplex of the regulatory subunit of the 26S proteasome; involved in mRNA export mediated by the TREX‐2 complex (Sac3p‐Thp1p); ortholog of human DSS1 1.5263 0.0000
SSA2 YLL024C ATP binding protein involved in protein folding and vacuolar import of proteins; member of heat shock protein 70 (HSP70) family; associated with the chaperonin‐containing T‐complex; present in the cytoplasm, vacuolar membrane and cell wall 1.5248 0.0001
RAD9 YDR217C DNA damage‐dependent checkpoint protein, required for cell‐cycle arrest in G1/S, intra‐S, and G2/M; transmits checkpoint signal by activating Rad53p and Chk1p; hyperphosphorylated by Mec1p and Tel1p; potential Cdc28p substrate 1.5213 0.0001
Symbols ORF Description HSP82 YPL240C NA MER1 215
log2(mtr1
0.Ts/WT.T
s) adj.p.val Component of the EKC/KEOPS protein complex with Kae1p, Gon7p, Bud32p, and Cgi121p; EKC/KEOPS complex is required for t6A tRNA modification and may have roles in telomere maintenance and transcription Nucleolar protein involved in rRNA processing, pre‐rRNA cleavage at site A2; also involved in telomere maintenance; mutation is synthetically lethal with a gar1 mutation 1.5068 0.0000
1.5057 0.0007
Nucleolar protein required for maturation of 18S rRNA, member of the eIF4A subfamily of DEAD‐box ATP‐dependent RNA helicases Putative protein of unknown function
Protein involved in RNA splicing by the spliceosome; component of a complex containing Cef1p; interacts genetically with ISY1 and BUD13; may bind RNA; has similarity to S. pombe Cwf21p 1.5047 0.0006
1.5011 1.4971 0.0000
0.0000
YCL069W YDL104C Permease of basic amino acids in the vacuolar membrane
Highly conserved mitochondrial protein, essential for t6A modification of mitochondrial tRNAs that decode ANN codons; similar to Kae1p and E. coli YgjD, both of which are also required for tRNA t6A modification 1.4959 1.4790 0.0001
0.0001
NA YCR108C 1.4760 0.0000
SMD3 YLR147C 1.4698 0.0000
YOS9 YDR057W Putative protein of unknown function; identified by fungal homology and RT‐PCR Core Sm protein Sm D3; part of heteroheptameric complex (with Smb1p, Smd1p, Smd2p, Sme1p, Smx3p, and Smx2p) that is part of the spliceosomal U1, U2, U4, and U5 snRNPs; homolog of human Sm D3 ER quality‐control lectin; integral subunit of the HRD ligase; binds to glycans with terminal alpha‐1,6 linked mannose on misfolded N‐
glycosylated proteins and participates in targeting proteins to ERAD; member of the OS‐9 protein family 1.4680 0.0001
BUR6 YER159C Subunit of a heterodimeric NC2 transcription regulator complex with Ncb2p; complex binds to TBP and can repress transcription by preventing preinitiation complex assembly or stimulate activated transcription; homologous to human NC2alpha 1.4676 0.0000
NA YDR379C‐A Protein involved in the assembly of the mitochondrial succinate dehydrogenase complex; mutations in human ortholog SDHAF1 are associated with infantile leukoencephalopathy 1.4671 0.0002
NA YFL067W Protein of unknown function, down‐regulated at low calcium levels 1.4639 0.0000
BTN2 YGR142W v‐SNARE binding protein that facilitates specific protein retrieval from a late endosome to the Golgi; modulates arginine uptake, possible role in mediating pH homeostasis between the vacuole and plasma membrane H(+)‐ATPase 1.4614 0.0001
GIR2 YDR152W Highly‐acidic cytoplasmic RWD domain‐containing protein of unknown function; forms a complex with Rbg2p; interacts with Rbg1p and Gcn1p; associates with translating ribosomes; putative intrinsically unstructured protein 1.4579 0.0000
SSA1 YAL005C ATPase involved in protein folding and nuclear localization signal (NLS)‐directed nuclear transport; member of heat shock protein 70 (HSP70) family; forms a chaperone complex with Ydj1p; localized to the nucleus, cytoplasm, and cell wall 1.4578 0.0001
PDS1 YDR113C Securin, inhibits anaphase by binding separin Esp1p; blocks cyclin destruction and mitotic exit, essential for meiotic progression and mitotic cell cycle arrest; localization is cell‐cycle dependent and regulated by Cdc28p phosphorylation 1.4565 0.0000
Symbols ORF Description PCC1 YKR095W‐A RRP8 YDR083W FAL1 YDR021W NA CWC21 YLR361C‐A YDR482C VBA3 QRI7 216
log2(mtr1
0.Ts/WT.T
s) adj.p.val Putative protein of unknown function; non‐essential gene; proposed function in rRNA and ribosome biosynthesis based on transcriptional co‐regulation; genetic interactions suggest a role in ER‐associated protein degradation (ERAD) 1.4502 0.0005
YLR194C Structural constituent of the cell wall attached to the plasma membrane by a GPI‐anchor; expression is upregulated in response to cell wall stress 1.4448 0.0000
NA YGR226C Dubious open reading frame, unlikely to encode a protein; not conserved in closely related Saccharomyces species; overlaps significantly with a verified ORF, AMA1/YGR225W 1.4351 0.0000
RNH202 YDR279W 1.4311 0.0000
NA YDL157C Ribonuclease H2 subunit, required for RNase H2 activity; related to human AGS2 that causes Aicardi‐Goutieres syndrome Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies 1.4202 0.0000
NA YLR363W‐A 1.4082 0.0003
DAD1 YDR016C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the nucleus Essential subunit of the Dam1 complex (aka DASH complex), couples kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; is transferred to the kinetochore prior to mitosis 1.4068 0.0000
PET100 YDR079W Chaperone that specifically facilitates the assembly of cytochrome c oxidase, integral to the mitochondrial inner membrane; interacts with a subcomplex of subunits VII, VIIa, and VIII (Cox7p, Cox9p, and Cox8p) but not with the holoenzyme 1.4037 0.0000
SPC19 YDR201W Essential subunit of the Dam1 complex (aka DASH complex), couples kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; also localized to nuclear side of spindle pole body 1.3975 0.0000
VPS60 YDR486C Cytoplasmic and vacuolar membrane protein involved in late endosome to vacuole transport; required for normal filament maturation during pseudohyphal growth; may function in targeting cargo proteins for degradation; interacts with Vta1p 1.3818 0.0000
NA YOL155W‐A 1.3807 0.0000
RTT103 YDR289C Putative protein of unknown function; identified by expression profiling and mass spectrometry Protein that interacts with exonuclease Rat1p and Rai1p and plays a role in transcription termination by RNA polymerase II, has an RPR domain (carboxy‐terminal domain interacting domain); also involved in regulation of Ty1 transposition 1.3805 0.0000
NA YHR214C‐E Putative protein of unknown function; identified by gene‐trapping, microarray‐based expression analysis, and genome‐wide homology searching 1.3786 0.0000
NA YLR154W‐E 1.3693 0.0001
IRC18 YJL037W Dubious open reading frame unlikely to encode a protein; encoded within the the 35S rRNA gene on the opposite strand Putative protein of unknown function; expression induced in respiratory‐deficient cells and in carbon‐limited chemostat cultures; similar to adjacent ORF, YJL038C; null mutant displays increased levels of spontaneous Rad52p foci 1.3632 0.0002
NA EMI1 YDR132C YDR512C Putative protein of unknown function
Non‐essential protein required for transcriptional induction of the early meiotic‐specific transcription factor IME1, also required for sporulation; contains twin cysteine‐x9‐cysteine motifs 1.3617 1.3548 0.0000
0.0001
Symbols ORF Description NA YDR161W NA 217
log2(mtr1
0.Ts/WT.T
s) adj.p.val Essential protein required for the DNA integrity checkpoint pathways; interacts physically with Mec1p; putative homolog of S. pombe Rad26 and human ATRIP 1.3532 0.0002
Mitochondrial ribosomal protein of the small subunit; contains twin cysteine‐x9‐cysteine motifs Putative ATP‐dependent RNA helicase of the DEAD‐box protein family, constituent of 66S pre‐ribosomal particles; essential protein involved in ribosome biogenesis 1.3525 0.0000
1.3512 0.0001
tRNA‐specific 2‐thiouridylase, responsible for 2‐thiolation of the wobble base of mitochondrial tRNAs; human ortholog is implicated in myoclonus epilepsy associated with ragged red fibers (MERRF) 1.3455 0.0001
YDR088C RNA splicing factor, required for ATP‐independent portion of 2nd catalytic step of spliceosomal RNA splicing; interacts with Prp18p; contains zinc knuckle domain 1.3448 0.0001
FYV7 YLR068W 1.3426 0.0009
NA YDL233W Essential protein required for maturation of 18S rRNA; required for survival upon exposure to K1 killer toxin Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; YDL233W is not an essential gene 1.3378 0.0000
SPR3 YGR059W Sporulation‐specific homolog of the yeast CDC3/10/11/12 family of bud neck microfilament genes; septin protein involved in sporulation; regulated by ABFI 1.3268 0.0004
HUB1 YNR032C‐A Ubiquitin‐like protein modifier, may function in modification of Sph1p and Hbt1p, functionally complemented by the human or S. pombe ortholog; mechanism of Hub1p adduct formation not yet clear 1.3228 0.0002
SHS1 YDL225W One of five related septins (Cdc3p, Cdc10p, Cdc11p, Cdc12p, Shs1p) that form a cortical filamentous collar at the mother‐bud neck which is necessary for normal morphogenesis and cytokinesis 1.3215 0.0002
QRI1 YDL103C UDP‐N‐acetylglucosamine pyrophosphorylase, catalyzes the formation of UDP‐N‐acetylglucosamine (UDP‐GlcNAc), which is important in cell wall biosynthesis, protein N‐glycosylation, and GPI anchor biosynthesis 1.3194 0.0000
MCD1 YDL003W Essential subunit of the cohesin complex required for sister chromatid cohesion in mitosis and meiosis; apoptosis induces cleavage and translocation of a C‐terminal fragment to mitochondria; expression peaks in S phase 1.3111 0.0001
SSP1 YHR184W Protein involved in the control of meiotic nuclear division and coordination of meiosis with spore formation; transcription is induced midway through meiosis 1.3097 0.0000
PAR32 YDL173W Putative protein of unknown function; hyperphosphorylated upon rapamycin treatment in a Tap42p‐dependent manner; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; PAR32 is not an essential gene 1.3079 0.0000
HNT2 YDR305C Dinucleoside triphosphate hydrolase; has similarity to the tumor suppressor FHIT and belongs to the histidine triad (HIT) superfamily of nucleotide‐binding proteins 1.3061 0.0000
MTC3 YGL226W Protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the mitochondrion; mtc3 is synthetically sick with cdc13‐1 1.3041 0.0000
Symbols ORF Description LCD1 YDR499W MRP10 YDL045W‐A DBP10 YDL031W SLM3 YDL033C SLU7 218
log2(mtr1
0.Ts/WT.T
s) adj.p.val Core Sm protein Sm E; part of heteroheptameric complex (with Smb1p, Smd1p, Smd2p, Smd3p, Smx3p, and Smx2p) that is part of the spliceosomal U1, U2, U4, and U5 snRNPs; homolog of human Sm E 1.3010 0.0000
YJR022W Lsm (Like Sm) protein; forms heteroheptameric complex (with Lsm2p, Lsm3p, Lsm4p, Lsm5p, Lsm6p, and Lsm7p) that is part of spliceosomal U6 snRNP and is also implicated in processing of pre‐
tRNA, pre‐snoRNA, and pre‐rRNA 1.2949 0.0001
TRS23 YDR246W One of 10 subunits of the transport protein particle (TRAPP) complex of the cis‐Golgi which mediates vesicle docking and fusion; involved in endoplasmic reticulum (ER) to Golgi membrane traffic; human homolog is TRAPPC4 1.2870 0.0000
PLP1 YDR183W Protein that interacts with CCT (chaperonin containing TCP‐1) complex and has a role in actin and tubulin folding; has weak similarity to phosducins, which are G‐protein regulators 1.2869 0.0000
NPL3 YDR432W RNA‐binding protein that promotes elongation, regulates termination, and carries poly(A) mRNA from nucleus to cytoplasm; required for pre‐mRNA splicing; dissociation from mRNAs promoted by Mtr10p; phosphorylated by Sky1p in the cytoplasm 1.2866 0.0000
OMS1 YDR316W Protein integral to the mitochondrial membrane; has a conserved methyltransferase motif; multicopy suppressor of respiratory defects caused by OXA1 mutations 1.2856 0.0002
EAF7 YNL136W Subunit of the NuA4 histone acetyltransferase complex, which acetylates the N‐terminal tails of histones H4 and H2A 1.2851 0.0000
NA YNR064C 1.2835 0.0000
MKC7 YDR144C Epoxide hydrolase, member of the alpha/beta hydrolase fold family; may have a role in detoxification of epoxides GPI‐anchored aspartyl protease, member of the yapsin family of proteases involved in cell wall growth and maintenance; shares functions with Yap3p and Kex2p 1.2790 0.0001
CWC2 YDL209C Member of the NineTeen Complex (NTC) that contains Prp19p and stabilizes U6 snRNA in catalytic forms of the spliceosome containing U2, U5, and U6 snRNAs; binds directly to U6 snRNA; similar to S. pombe Cwf2 1.2785 0.0000
BDF2 YDL070W Protein involved in transcription initiation at TATA‐containing promoters; associates with the basal transcription factor TFIID; contains two bromodomains; corresponds to the C‐terminal region of mammalian TAF1; redundant with Bdf1p 1.2756 0.0002
ERV2 YPR037C Flavin‐linked sulfhydryl oxidase localized to the endoplasmic reticulum lumen, involved in disulfide bond formation within the ER 1.2755 0.0000
DPB4 YDR121W Shared subunit of DNA polymerase (II) epsilon and of ISW2/yCHRAC chromatin accessibility complex; involved in both chromosomal DNA replication and in inheritance of telomeric silencing 1.2686 0.0001
CDC37 YDR168W Essential Hsp90p co‐chaperone; necessary for passage through the START phase of the cell cycle; stabilizes protein kinase nascent chains and participates along with Hsp90p in their folding 1.2674 0.0001
NA YFL065C Putative protein of unknown function; induced by treatment with 8‐
methoxypsoralen and UVA irradiation 1.2670 0.0006
Symbols ORF Description SME1 YOR159C LSM8 219
log2(mtr1
0.Ts/WT.T
s) adj.p.val Homocitrate synthase isozyme, catalyzes the condensation of acetyl‐CoA and alpha‐ketoglutarate to form homocitrate, which is the first step in the lysine biosynthesis pathway; highly similar to the other isozyme, Lys20p 1.2639 0.0003
YDR123C Component of the heteromeric Ino2p/Ino4p basic helix‐loop‐helix transcription activator that binds inositol/choline‐responsive elements (ICREs), required for derepression of phospholipid biosynthetic genes in response to inositol depletion 1.2629 0.0002
NA GAL3 YDR506C YDR009W Possible membrane‐localized protein
Transcriptional regulator involved in activation of the GAL genes in response to galactose; forms a complex with Gal80p to relieve Gal80p inhibition of Gal4p; binds galactose and ATP but does not have galactokinase activity 1.2483 1.2480 0.0002
0.0000
UBC1 YDR177W Ubiquitin‐conjugating enzyme that mediates selective degradation of short‐lived and abnormal proteins; plays a role in vesicle biogenesis and ER‐associated protein degradation (ERAD); component of the cellular stress response 1.2349 0.0000
NA YDL218W Putative protein of unknown function; YDL218W transcription is regulated by Azf1p and induced by starvation and aerobic conditions; expression also induced in cells treated with the mycotoxin patulin 1.2347 0.0002
DAL4 YIR028W Allantoin permease; expression sensitive to nitrogen catabolite repression and induced by allophanate, an intermediate in allantoin degradation 1.2322 0.0001
NCB2 YDR397C Subunit of a heterodimeric NC2 transcription regulator complex with Bur6p; complex binds to TBP and can repress transcription by preventing preinitiation complex assembly or stimulate activated transcription; homologous to human NC2beta 1.2308 0.0002
DUN1 YDL101C Cell‐cycle checkpoint serine‐threonine kinase required for DNA damage‐induced transcription of certain target genes, phosphorylation of Rad55p and Sml1p, and transient G2/M arrest after DNA damage; also regulates postreplicative DNA repair 1.2291 0.0000
NA YHR213W‐A Putative protein of unknown function; identified by gene‐trapping, microarray‐based expression analysis, and genome‐wide homology searching 1.2277 0.0002
CPR6 YLR216C Peptidyl‐prolyl cis‐trans isomerase (cyclophilin), catalyzes the cis‐
trans isomerization of peptide bonds N‐terminal to proline residues; binds to Hsp82p and contributes to chaperone activity 1.2266 0.0000
CRP1 COX17 YHR146W YLL009C Protein that binds to cruciform DNA structures
Copper metallochaperone that transfers copper to Sco1p and Cox11p for eventual delivery to cytochrome c oxidase; contains twin cysteine‐x9‐cysteine motifs 1.2205 1.2191 0.0000
0.0001
KCC4 YCL024W Protein kinase of the bud neck involved in the septin checkpoint, associates with septin proteins, negatively regulates Swe1p by phosphorylation, shows structural homology to bud neck kinases Gin4p and Hsl1p 1.2177 0.0001
DOS2 YDR068W 1.2162 0.0000
NA YER137C Protein of unknown function, green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm Putative protein of unknown function
1.2108 0.0006
Symbols ORF Description LYS21 YDL131W INO2 220
log2(mtr1
0.Ts/WT.T
s) adj.p.val Catalytic core subunit of the Anaphase‐Promoting Complex/Cyclosome (APC/C), which is a ubiquitin‐protein ligase required for degradation of anaphase inhibitors, including mitotic cyclins, during the metaphase/anaphase transition 1.2096 0.0000
Protein of unknown function; null mutant is resistant to 2‐deoxy‐D‐
glucose and displays abnormally elongated buds D‐Tyr‐tRNA(Tyr) deacylase, functions in protein translation, may affect nonsense suppression via alteration of the protein synthesis machinery; ubiquitous among eukaryotes Mitochondrial intermembrane space protein, required for normal oxygen consumption; contains twin cysteine‐x9‐cysteine motifs 1.2082 0.0001
1.2068 0.0000
1.2065 0.0000
Nucleolar protein of unknown function, positive regulator of mitotic exit; involved in regulating release of Cdc14p from the nucleolus in early anaphase, may play similar role in meiosis Phospholipid‐binding protein that interacts with both Ypt7p and Vps33p, may partially counteract the action of Vps33p and vice versa, localizes to the rim of the vacuole as cells approach stationary phase Nucleosomal histone H3‐Lys79 methylase; methylation is required for telomeric silencing, meiotic checkpoint control, and DNA damage response 1.2051 0.0000
1.2039 0.0000
1.1991 0.0001
Galactose permease, required for utilization of galactose; also able to transport glucose Chitin deacetylase, together with Cda2p involved in the biosynthesis ascospore wall component, chitosan; required for proper rigidity of the ascospore wall 1.1990 0.0009
1.1976 0.0007
YDR325W Subunit of the condensin complex; required for establishment and maintenance of chromosome condensation, chromosome segregation and chromatin binding of the condensin complex; required for clustering of tRNA genes at the nucleolus 1.1965 0.0001
NA YDR239C 1.1939 0.0000
STF1 YDL130W‐A Protein of unknown function that may interact with ribosomes, based on co‐purification experiments Protein involved in regulation of the mitochondrial F1F0‐ATP synthase; Stf1p and Stf2p may act as stabilizing factors that enhance inhibitory action of the Inh1p protein 1.1886 0.0001
EKI1 YDR147W Ethanolamine kinase, primarily responsible for phosphatidylethanolamine synthesis via the CDP‐ethanolamine pathway; exhibits some choline kinase activity, thus contributing to phosphatidylcholine synthesis via the CDP‐choline pathway 1.1874 0.0000
RUB1 YDR139C Ubiquitin‐like protein with similarity to mammalian NEDD8; conjugation (neddylation) substrates include the cullins Cdc53p, Rtt101p, and Cul3p; activated by Ula1p and Uba3p (E1 enzyme pair); conjugation mediated by Ubc12p (E2 enzyme) 1.1848 0.0001
NA YDR042C 1.1844 0.0000
SPO22 YIL073C Putative protein of unknown function; expression is increased in ssu72‐ts69 mutant Meiosis‐specific protein essential for chromosome synapsis, involved in completion of nuclear divisions during meiosis; induced early in meiosis 1.1840 0.0001
YSY6 YBR162W‐A Protein whose expression suppresses a secretory pathway mutation in E. coli; has similarity to the mammalian RAMP4 protein involved in secretion 1.1787 0.0001
SNU23 YDL098C Component of U4/U6.U5 snRNP involved in mRNA splicing via spliceosome 1.1786 0.0001
Symbols ORF Description APC11 YDL008W DGR2 YKL121W DTD1 YDL219W MIC14 YDR031W SPO12 YHR152W IVY1 YDR229W DOT1 YDR440W GAL2 YLR081W CDA1 YLR307W YCG1 221
log2(mtr1
0.Ts/WT.T
s) adj.p.val Site‐specific endonuclease required for gene conversion at the MAT locus (homothallic switching) through the generation of a ds DNA break; expression restricted to mother cells in late G1 as controlled by Swi4p‐Swi6p, Swi5p and Ash1p 1.1763 0.0007
YLR412C‐A YMR263W Putative protein of unknown function
Subunit of a histone deacetylase complex, along with Rpd3p and Sin3p, that is involved in silencing at telomeres, rDNA, and silent mating‐type loci; involved in telomere maintenance 1.1741 1.1732 0.0002
0.0001
GLE1 YDL207W Cytoplasmic nucleoporin required for polyadenylated RNA export but not for protein import; component of Nup82p nuclear pore subcomplex; contains a nuclear export signal 1.1727 0.0000
ECO1 YFR027W Acetyltransferase required for sister chromatid cohesion; modifies Smc3p at DNA replication forks during S‐phase; modifies Mcd1p in response to double‐strand DNA breaks during G2/M; mutations in human homolog ESCO2 cause Roberts syndrome 1.1724 0.0000
STI1 YOR027W Hsp90 cochaperone, interacts with the Ssa group of the cytosolic Hsp70 chaperones and activates Ssa1p ATPase activity; interacts with Hsp90 chaperones and inhibits their ATPase activity; homolog of mammalian Hop 1.1722 0.0001
NA YDR246W‐A 1.1708 0.0001
PUF2 YPR042C Putative protein of unknown function; identified by fungal homology and RT‐PCR Member of the PUF protein family, which is defined by the presence of Pumilio homology domains that confer RNA binding activity; preferentially binds mRNAs encoding membrane‐associated proteins 1.1686 0.0000
CDC7 YDL017W DDK (Dbf4‐dependent kinase) catalytic subunit required for firing origins and replication fork progression in S phase through phosphorylation of Mcm2‐7p complexes and Cdc45p; kinase activity correlates with cyclical DBF4 expression 1.1602 0.0000
ACM1 YPL267W Pseudosubstrate inhibitor of the anaphase‐promoting complex/cyclosome (APC/C), that suppresses APC/C [Cdh1]‐
mediated proteolysis of mitotic cyclins; associates with Cdh1p, Bmh1p and Bmh2p; cell cycle regulated protein 1.1601 0.0001
MED2 YDL005C Subunit of the RNA polymerase II mediator complex; associates with core polymerase subunits to form the RNA polymerase II holoenzyme; essential for transcriptional regulation 1.1594 0.0001
JNM1 YMR294W Component of the yeast dynactin complex, consisting of Nip100p, Jnm1p, and Arp1p; required for proper nuclear migration and spindle partitioning during mitotic anaphase B 1.1592 0.0001
NA YDR056C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the endoplasmic reticulum; YDR056C is not an essential protein 1.1568 0.0000
DIA1 YMR316W Protein of unknown function, involved in invasive and pseudohyphal growth; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern 1.1550 0.0008
LSM7 YNL147W Lsm (Like Sm) protein; part of heteroheptameric complexes (Lsm2p‐
7p and either Lsm1p or 8p): cytoplasmic Lsm1p complex involved in mRNA decay; nuclear Lsm8p complex part of U6 snRNP and possibly involved in processing tRNA, snoRNA, and rRNA 1.1490 0.0002
MRPL28 YDR462W Mitochondrial ribosomal protein of the large subunit
1.1477 0.0000
Symbols ORF Description HO YDL227C NA SAP30 222
log2(mtr1
0.Ts/WT.T
s) adj.p.val Nucleolar protein that forms a complex with Csm1p, and then Mam1p at kinetochores during meiosis I to mediate accurate homolog segregation; required for condensin recruitment to the replication fork barrier site and rDNA repeat segregation 1.1447 0.0001
YMR186W Cytoplasmic chaperone of the Hsp90 family, redundant in function and nearly identical with Hsp82p, and together they are essential; expressed constitutively at 10‐fold higher basal levels than HSP82 and induced 2‐3 fold by heat shock 1.1445 0.0002
NGG1 YDR176W Transcriptional regulator involved in glucose repression of Gal4p‐
regulated genes; component of transcriptional adaptor and histone acetyltransferase complexes, the ADA complex, the SAGA complex, and the SLIK complex 1.1441 0.0002
PAU4 YLR461W Member of the seripauperin multigene family encoded mainly in subtelomeric regions; active during alcoholic fermentation, regulated by anaerobiosis, negatively regulated by oxygen, repressed by heme 1.1436 0.0000
PIB1 YDR313C RING‐type ubiquitin ligase of the endosomal and vacuolar membranes, binds phosphatidylinositol(3)‐phosphate; contains a FYVE finger domain 1.1433 0.0001
DIT1 YDR403W Sporulation‐specific enzyme required for spore wall maturation, involved in the production of a soluble LL‐dityrosine‐containing precursor of the spore wall; transcripts accumulate at the time of prospore enclosure 1.1419 0.0003
HPF1 YOL155C 1.1410 0.0001
GPR1 YDL035C Haze‐protective mannoprotein that reduces the particle size of aggregated proteins in white wines Plasma membrane G protein coupled receptor (GPCR) that interacts with the heterotrimeric G protein alpha subunit, Gpa2p, and with Plc1p; sensor that integrates nutritional signals with the modulation of cell fate via PKA and cAMP synthesis 1.1394 0.0000
MRPL7 SRB7 YDR237W YDR308C Mitochondrial ribosomal protein of the large subunit
Subunit of the RNA polymerase II mediator complex; associates with core polymerase subunits to form the RNA polymerase II holoenzyme; essential for transcriptional regulation; target of the global repressor Tup1p 1.1389 1.1340 0.0001
0.0000
NA YCR075W‐A 1.1325 0.0001
SPT3 YDR392W Putative protein of unknown function; identified by homology to Ashbya gossypii Subunit of the SAGA and SAGA‐like transcriptional regulatory complexes, interacts with Spt15p to activate transcription of some RNA polymerase II‐dependent genes, also functions to inhibit transcription at some promoters 1.1291 0.0001
NA YDR348C Protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cell periphery and bud neck; potential Cdc28p substrate 1.1278 0.0000
PLM2 YDR501W Forkhead Associated domain containing protein and putative transcription factor found associated with chromatin; target of SBF transcription factor; induced in response to DNA damaging agents and deletion of telomerase; similar to TOS4 1.1275 0.0001
RRP42 YDL111C Exosome non‐catalytic core component; involved in 3'‐5' RNA processing and degradation in both the nucleus and the cytoplasm; has similarity to E. coli RNase PH and to human hRrp42p (EXOSC7) 1.1274 0.0000
Symbols ORF Description LRS4 YDR439W HSC82 223
log2(mtr1
0.Ts/WT.T
s) adj.p.val Nucleolar protein that forms a complex with Lrs4p and then Mam1p at kinetochores during meiosis I to mediate accurate homolog segregation; required for condensin recruitment to the replication fork barrier site and rDNA repeat segregation 1.1273 0.0002
YLR298C Component of the U1 snRNP complex required for pre‐mRNA splicing; putative ortholog of human U1C protein, which is involved in formation of a complex between U1 snRNP and the pre‐mRNA 5' splice site 1.1248 0.0001
NA RNH203 YER188C‐A YLR154C Putative protein of unknown function
Ribonuclease H2 subunit, required for RNase H2 activity; related to human AGS3 that causes Aicardi‐Goutieres syndrome 1.1247 1.1238 0.0005
0.0000
LSM3 YLR438C‐A Lsm (Like Sm) protein; part of heteroheptameric complexes (Lsm2p‐
7p and either Lsm1p or 8p): cytoplasmic Lsm1p complex involved in mRNA decay; nuclear Lsm8p complex part of U6 snRNP and possibly involved in processing tRNA, snoRNA, and rRNA 1.1232 0.0001
RRP14 YKL082C Essential protein, constituent of 66S pre‐ribosomal particles; interacts with proteins involved in ribosomal biogenesis and cell polarity; member of the SURF‐6 family 1.1230 0.0005
TLG1 YDR468C Essential t‐SNARE that forms a complex with Tlg2p and Vti1p and mediates fusion of endosome‐derived vesicles with the late Golgi; binds the docking complex VFT (Vps fifty‐three) through interaction with Vps51p 1.1220 0.0001
AHA1 YDR214W Co‐chaperone that binds to Hsp82p and activates its ATPase activity; similar to Hch1p; expression is regulated by stresses such as heat shock 1.1212 0.0002
TOA1 YOR194C TFIIA large subunit; involved in transcriptional activation, acts as antirepressor or as coactivator; homologous to largest and second largest subunits of human and Drosophila TFIIA 1.1157 0.0004
SCM3 YDL139C Nonhistone component of centromeric chromatin that binds stoichiometrically to CenH3‐H4 histones, required for kinetochore assembly; required for G2/M progression and localization of Cse4p; may protect Cse4p from ubiquitylation 1.1153 0.0000
NA YNL146W Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the endoplasmic reticulum; YNL146W is not an essential gene 1.1144 0.0000
PUT1 YLR142W Proline oxidase, nuclear‐encoded mitochondrial protein involved in utilization of proline as sole nitrogen source; PUT1 transcription is induced by Put3p in the presence of proline and the absence of a preferred nitrogen source 1.1121 0.0002
ENT1 YDL161W Epsin‐like protein involved in endocytosis and actin patch assembly and functionally redundant with Ent2p; binds clathrin via a clathrin‐
binding domain motif at C‐terminus 1.1117 0.0000
OGG1 YML060W Mitochondrial glycosylase/lyase that specifically excises 7,8‐dihydro‐
8‐oxoguanine residues located opposite cytosine or thymine residues in DNA, repairs oxidative damage to mitochondrial DNA, contributes to UVA resistance 1.1106 0.0005
SPC29 YPL124W Inner plaque spindle pole body (SPB) component, links the central plaque component Spc42p to the inner plaque component Spc110p; required for SPB duplication 1.1105 0.0000
Symbols ORF Description CSM1 YCR086W YHC1 224
log2(mtr1
0.Ts/WT.T
s) adj.p.val Non‐essential kinetochore protein, subunit of the Ctf19 central kinetochore complex (Ctf19p‐Mcm21p‐Okp1p‐Mcm22p‐Mcm16p‐
Ctf3p‐Chl4p‐Mcm19p‐Nkp1p‐Nkp2p‐Ame1p‐Mtw1p) 1.1092 0.0000
YDR346C Protein with a potential role in cell survival pathways, required for the diauxic growth shift; expression in mammalian cells increases survival under conditions inducing apoptosis; mutant has increased aneuploidy tolerance 1.1080 0.0002
SLK19 YOR195W Kinetochore‐associated protein required for normal segregation of chromosomes in meiosis and mitosis; component of the FEAR regulatory network, which promotes Cdc14p release from the nucleolus during anaphase; potential Cdc28p substrate 1.1078 0.0005
SEN34 YAR008W Subunit of the tRNA splicing endonuclease, which is composed of Sen2p, Sen15p, Sen34p, and Sen54p; Sen34p contains the active site for tRNA 3' splice site cleavage and has similarity to Sen2p and to Archaeal tRNA splicing endonuclease 1.1054 0.0000
SWI5 YDR146C Transcription factor that activates transcription of genes expressed at the M/G1 phase boundary and in G1 phase; localization to the nucleus occurs during G1 and appears to be regulated by phosphorylation by Cdc28p kinase 1.1050 0.0005
GIN4 YDR507C Protein kinase involved in bud growth and assembly of the septin ring, proposed to have kinase‐dependent and kinase‐independent activities; undergoes autophosphorylation; similar to Kcc4p and Hsl1p 1.1048 0.0002
SNM1 YDR478W Subunit of RNase MRP, which cleaves pre‐rRNA and has a role in cell cycle‐regulated degradation of daughter cell‐specific mRNAs; binds to the NME1 RNA subunit of RNase MRP 1.0996 0.0000
NA NA MHR1 NA YIL014C‐A YDR296W NA Putative protein of unknown function
Protein involved in homologous recombination in mitochondria; required for recombination‐dependent mtDNA partitioning; involved in stimulation of mitochondrial DNA replication in response to oxidative stress 1.0981 1.0964 1.0960 0.0001
0.0002
0.0001
MPS1 YDL028C Dual‐specificity kinase required for spindle pole body (SPB) duplication and spindle checkpoint function; substrates include SPB proteins Spc42p, Spc110p, and Spc98p, mitotic exit network protein Mob1p, and checkpoint protein Mad1p 1.0936 0.0001
SWA2 YDR320C Auxilin‐like protein involved in vesicular transport; clathrin‐binding protein required for uncoating of clathrin‐coated vesicles 1.0901 0.0001
CDC31 YOR257W Calcium‐binding component of the spindle pole body (SPB) half‐
bridge, required for SPB duplication in mitosis and meiosis II; homolog of mammalian centrin; binds multiubiquitinated proteins and is involved in proteasomal protein degradation 1.0887 0.0001
ATG10 YLL042C Conserved E2‐like conjugating enzyme that mediates formation of the Atg12p‐Atg5p conjugate, which is a critical step in autophagy 1.0870 0.0001
UGX2 YDL169C 1.0848 0.0004
NA YDL012C Protein of unknown function, transcript accumulates in response to any combination of stress conditions Tail‐anchored plasma membrane protein containing a conserved CYSTM module, possibly involved in response to stress; may contribute to non‐homologous end‐joining (NHEJ) based on ydl012c htz1 double null phenotype 1.0845 0.0000
NA YFR012W Putative protein of unknown function
1.0824 0.0007
Symbols ORF Description NKP1 YDR383C SVF1 225
log2(mtr1
0.Ts/WT.T
s) adj.p.val Protein with similarity to P‐type ATPase sodium pumps, member of the Na+ efflux ATPase family Inner plaque spindle pole body (SPB) component, ortholog of human kendrin; involved in connecting nuclear microtubules to SPB; interacts with Tub4p‐complex and calmodulin; phosphorylated by Mps1p in cell cycle‐dependent manner 1.0798 0.0002
1.0789 0.0001
YDR386W Subunit of the structure‐specific Mms4p‐Mus81p endonuclease that cleaves branched DNA; involved in DNA repair, replication fork stability, and joint molecule formation/resolution during meiotic recombination; helix‐hairpin‐helix protein 1.0781 0.0001
HXT14 YNL318C Protein with similarity to hexose transporter family members, expression is induced in low glucose and repressed in high glucose; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies 1.0773 0.0005
FCF1 YDR339C Putative PINc domain nuclease required for early cleavages of 35S pre‐rRNA and maturation of 18S rRNA; component of the SSU (small subunit) processome involved in 40S ribosomal subunit biogenesis; copurifies with Faf1p 1.0764 0.0003
NHP2 YDL208W Nuclear protein related to mammalian high mobility group (HMG) proteins, essential for function of H/ACA‐type snoRNPs, which are involved in 18S rRNA processing 1.0750 0.0009
CDC9 YDL164C DNA ligase found in the nucleus and mitochondria, an essential enzyme that joins Okazaki fragments during DNA replication; also acts in nucleotide excision repair, base excision repair, and recombination 1.0744 0.0002
TFB3 YDR460W Subunit of TFIIH and nucleotide excision repair factor 3 complexes, involved in transcription initiation, required for nucleotide excision repair; ring finger protein similar to mammalian CAK and TFIIH subunit 1.0731 0.0001
NA YDR248C Putative protein of unknown function; sequence similarity to bacterial and human gluconokinase; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; upregulated by deletion of the RNAP‐II associated factor, PAF1 1.0724 0.0001
PGM3 YMR278W Phosphoglucomutase, catalyzes interconversion of glucose‐1‐
phosphate and glucose‐6‐phospate; transcription induced in response to stress; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; non‐essential 1.0717 0.0001
NA YBR196C‐A 1.0686 0.0002
SSF2 YDR312W Putative protein of unknown function; identified by fungal homology and RT‐PCR Protein required for ribosomal large subunit maturation, functionally redundant with Ssf1p; member of the Brix family 1.0678 0.0001
RKM2 YDR198C Ribosomal protein lysine methyltransferase, responsible for trimethylation of the lysine residue at position 3 of Rpl12Ap and Rpl12Bp 1.0671 0.0001
RMD1 UGA4 YDL001W YDL210W Cytoplasmic protein required for sporulation
Permease that serves as a gamma‐aminobutyrate (GABA) transport protein involved in the utilization of GABA as a nitrogen source; catalyzes the transport of putrescine and delta‐aminolevulinic acid (ALA); localized to the vacuolar membrane 1.0655 1.0625 0.0001
0.0002
TMA7 YLR262C‐A Protein of unknown that associates with ribosomes; null mutant exhibits translation defects, altered polyribosome profiles, and resistance to the translation inhibitor anisomcyin 1.0617 0.0002
Symbols ORF Description ENA5 YDR038C SPC110 YDR356W MUS81 226
log2(mtr1
0.Ts/WT.T
s) adj.p.val Sm‐like protein involved in docking and fusion of exocytic vesicles through binding to assembled SNARE complexes at the membrane; localization to sites of secretion (bud neck and bud tip) is dependent on SNARE function 1.0606 0.0000
YDL036C Mitochondrial tRNA:pseudouridine synthase, catalyzes the formation of pseudouridine at position 32 in mitochondrial tRNAs; contains an N‐terminal mitochondrial targeting sequence 1.0593 0.0000
NA YDR115W Putative mitochondrial ribosomal protein of the large subunit, has similarity to E. coli L34 ribosomal protein; required for respiratory growth, as are most mitochondrial ribosomal proteins 1.0590 0.0001
NA YHL048C‐A 1.0550 0.0001
LIF1 YGL090W Putative protein of unknown function; identified by expression profiling and mass spectrometry Component of the DNA ligase IV complex that mediates nonhomologous end joining in DNA double‐strand break repair; physically interacts with Dnl4p and Nej1p; homologous to mammalian XRCC4 protein 1.0515 0.0002
ARO80 YDR421W Zinc finger transcriptional activator of the Zn2Cys6 family; activates transcription of aromatic amino acid catabolic genes in the presence of aromatic amino acids 1.0499 0.0000
GYP7 YDL234C GTPase‐activating protein for yeast Rab family members including: Ypt7p (most effective), Ypt1p, Ypt31p, and Ypt32p (in vitro); involved in vesicle mediated protein trafficking 1.0489 0.0001
CIN4 YMR138W GTP‐binding protein involved in beta‐tubulin (Tub2p) folding; isolated as mutant with increased chromosome loss and sensitivity to benomyl; regulated by the GTPase‐activating protein, Cin2p, the human retinitis pigmentosa 2 (RP2) homolog 1.0480 0.0004
MZM1 YDR493W Mitochondrial matrix protein with a role in maintaining the labile mitochondrial zinc pool; null mutant has a respiratory growth defect and an elevated frequency of mitochondrial genome loss; overexpression causes cell cycle delay or arrest 1.0463 0.0000
GPI11 YDR302W ER membrane protein involved in a late step of glycosylphosphatidylinositol (GPI) anchor assembly; involved in the addition of phosphoethanolamine to the multiply mannosylated GPI intermediate; human PIG‐Fp is a functional homolog 1.0453 0.0002
CSE4 YKL049C Centromere protein that resembles histone H3, required for proper kinetochore function; homolog of human CENP‐A; levels are regulated by E3 ubiquitin ligase Psh1p 1.0420 0.0002
SEC20 YDR498C Membrane glycoprotein v‐SNARE involved in retrograde transport from the Golgi to the ER; required for N‐ and O‐glycosylation in the Golgi but not in the ER; interacts with the Dsl1p complex through Tip20p 1.0418 0.0001
RTT102 YGR275W Component of both the SWI/SNF and RSC chromatin remodeling complexes, suggested role in chromosome maintenance; possible weak regulator of Ty1 transposition 1.0416 0.0001
NA YMR244C‐A Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and nucleus and is induced in response to the DNA‐damaging agent MMS; YMR244C‐A is not an essential gene 1.0404 0.0001
SVS1 YPL163C Cell wall and vacuolar protein, required for wild‐type resistance to vanadate 1.0397 0.0001
Symbols ORF Description SEC1 YDR164C PUS9 227
log2(mtr1
0.Ts/WT.T
s) adj.p.val Nucleosome assembly factor, involved in chromatin assembly and disassembly, anti‐silencing protein that causes derepression of silent loci when overexpressed; plays a role in regulating Ty1 transposition 1.0389 0.0000
YMR256C Subunit VII of cytochrome c oxidase, which is the terminal member of the mitochondrial inner membrane electron transport chain 1.0300 0.0001
NA YBR071W Putative protein of unknown function; (GFP)‐fusion and epitope‐
tagged proteins localize to the cytoplasm; mRNA expression may be regulated by the cell cycle and/or cell wall stress 1.0222 0.0001
SGT2 YOR007C Glutamine‐rich cytoplasmic protein that serves as a scaffold for binding Get4/5p and other proteins required to mediate posttranslational insertion of tail‐anchored proteins into the ER membrane; has similarity to human cochaperone SGT 1.0178 0.0001
SMT3 YDR510W Ubiquitin‐like protein of the SUMO family, conjugated to lysine residues of target proteins; regulates chromatid cohesion, chromosome segregation, APC‐mediated proteolysis, DNA replication and septin ring dynamics; phosphorylated at Ser2 1.0156 0.0001
UBC9 YDL064W SUMO‐conjugating enzyme involved in the Smt3p conjugation pathway; nuclear protein required for S‐ and M‐phase cyclin degradation and mitotic control; involved in proteolysis mediated by the anaphase‐promoting complex cyclosome (APCC) 1.0136 0.0000
RPC11 YDR045C RNA polymerase III subunit C11; mediates pol III RNA cleavage activity and is important for termination of transcription; homologous to TFIIS 1.0118 0.0001
RGA2 YDR379W GTPase‐activating protein for the polarity‐establishment protein Cdc42p; implicated in control of septin organization, pheromone response, and haploid invasive growth; regulated by Pho85p and Cdc28p 1.0105 0.0002
PBI2 YNL015W Cytosolic inhibitor of vacuolar proteinase B (PRB1), required for efficient vacuole inheritance; with thioredoxin forms protein complex LMA1, which assists in priming SNARE molecules and promotes vacuole fusion 1.0099 0.0002
NUP42 YDR192C Subunit of the nuclear pore complex (NPC) that localizes exclusively to the cytoplasmic side; involved in RNA export, most likely at a terminal step; interacts with Gle1p 1.0084 0.0003
SLY1 YDR189W Hydrophilic protein involved in vesicle trafficking between the ER and Golgi; SM (Sec1/Munc‐18) family protein that binds the tSNARE Sed5p and stimulates its assembly into a trans‐SNARE membrane‐
protein complex 1.0084 0.0001
GCD6 YDR211W Catalytic epsilon subunit of the translation initiation factor eIF2B, the guanine‐nucleotide exchange factor for eIF2; activity subsequently regulated by phosphorylated eIF2; first identified as a negative regulator of GCN4 expression 1.0055 0.0001
PRP3 ENT5 YDR473C YDR153C Splicing factor, component of the U4/U6‐U5 snRNP complex
Protein containing an N‐terminal epsin‐like domain involved in clathrin recruitment and traffic between the Golgi and endosomes; associates with the clathrin adaptor Gga2p, clathrin adaptor complex AP‐1, and clathrin 1.0039 1.0031 0.0000
0.0001
CDC36 YDL165W Component of the CCR4‐NOT complex, which has multiple roles in regulating mRNA levels including regulation of transcription and destabilizing mRNAs by deadenylation; basal transcription factor 1.0030 0.0001
Symbols ORF Description ASF1 YJL115W COX7 228
log2(mtr1
0.Ts/WT.T
s) adj.p.val eIF3g subunit of the core complex of translation initiation factor 3 (eIF3), which is essential for translation; stimulates resumption of ribosomal scanning during translation reinitiation 1.0028 0.0008
YDR049W Zinc finger protein, forms a mitochondrially‐associated complex with Cdc48p and Npl4p under oxidative stress that is required for ubiquitin‐mediated mitochondria‐associated protein degradation (MAD); conserved in C. elegans and human 1.0025 0.0000
MOD5 YOR274W Delta 2‐isopentenyl pyrophosphate:tRNA isopentenyl transferase, required for biosynthesis of the modified base isopentenyladenosine in mitochondrial and cytoplasmic tRNAs; gene is nuclear and encodes two isozymic forms 0.9998 0.0005
TEN1 YLR010C 0.9983 0.0001
PTP1 YDL230W Protein that regulates telomeric length; protects telomeric ends in a complex with Cdc13p and Stn1p Phosphotyrosine‐specific protein phosphatase that dephosphorylates a broad range of substrates in vivo, including Fpr3p; localized to the cytoplasm and the mitochondria 0.9980 0.0000
MRPS16 ACN9 YPL013C YDR511W Mitochondrial ribosomal protein of the small subunit
Protein of the mitochondrial intermembrane space, required for acetate utilization and gluconeogenesis; has orthologs in higher eukaryotes 0.9975 0.9966 0.0003
0.0001
PDC2 YDR081C Transcription factor required for the synthesis of the glycolytic enzyme pyruvate decarboxylase, required for high level expression of both the THI and the PDC genes 0.9940 0.0000
MAD1 YGL086W Coiled‐coil protein involved in the spindle‐assembly checkpoint; phosphorylated by Mps1p upon checkpoint activation which leads to inhibition of the activity of the anaphase promoting complex; forms a complex with Mad2p 0.9920 0.0002
PEX3 YDR329C Peroxisomal membrane protein (PMP) required for proper localization and stability of PMPs; anchors peroxisome retention factor Inp1p at the peroxisomal membrane; interacts with Pex19p 0.9917 0.0000
HSP104 YLL026W Heat shock protein that cooperates with Ydj1p (Hsp40) and Ssa1p (Hsp70) to refold and reactivate previously denatured, aggregated proteins; responsive to stresses including: heat, ethanol, and sodium arsenite; involved in [PSI+] propagation 0.9916 0.0004
IZH1 YDR492W Membrane protein involved in zinc ion homeostasis, member of the four‐protein IZH family; transcription is regulated directly by Zap1p, expression induced by zinc deficiency and fatty acids; deletion increases sensitivity to elevated zinc 0.9907 0.0002
YFH1 YDL120W Mitochondrial matrix iron chaperone; oxidizes and stores iron; interacts with Isu1p to promote Fe‐S cluster assembly; mutation results in multiple Fe/S‐dependent enzyme deficiencies; human frataxin homolog is mutated in Friedrich's ataxia 0.9823 0.0002
SFA1 YDL168W Bifunctional enzyme containing both alcohol dehydrogenase and glutathione‐dependent formaldehyde dehydrogenase activities, functions in formaldehyde detoxification and formation of long chain and complex alcohols, regulated by Hog1p‐Sko1p 0.9756 0.0000
UBA2 YDR390C Subunit of a heterodimeric nuclear SUMO activating enzyme (E1) with Aos1p; activates Smt3p (SUMO) before its conjugation to proteins (sumoylation), which may play a role in protein targeting; essential for viability 0.9726 0.0000
Symbols ORF Description TIF35 YDR429C VMS1 229
log2(mtr1
0.Ts/WT.T
s) adj.p.val Putative protein of unknown function; may interact with ribosomes, based on co‐purification experiments; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm 0.9718 0.0001
YDL178W D‐lactate dehydrogenase, located in the mitochondrial matrix
0.9696 0.0002
GTR2 YGR163W Putative GTP binding protein that negatively regulates Ran/Tc4 GTPase cycle; activates transcription; subunit of EGO and GSE complexes; required for sorting of Gap1p; localizes to cytoplasm and to chromatin; homolog of human RagC and RagD 0.9679 0.0007
MTQ2 YDR140W S‐adenosylmethionine‐dependent methyltransferase of the seven beta‐strand family; subunit of complex with Trm112p that methylates translation release factor Sup45p (eRF1) in the ternary complex eRF1‐eRF3‐GTP; similar to E.coli PrmC 0.9671 0.0002
BLS1 YLR408C Putative protein of unknown function; likely member of BLOC complex involved in endosomal cargo sorting; green fluorescent protein (GFP)‐fusion protein localizes to the endosome; YLR408C is not an essential gene 0.9668 0.0000
NA YHR138C Putative protein of unknown function; has similarity to Pbi2p; double null mutant lacking Pbi2p and Yhr138p exhibits highly fragmented vacuoles 0.9634 0.0002
NA YJL144W Cytoplasmic hydrophilin of unknown function, possibly involved in the dessication response; expression induced by osmotic stress, starvation and during stationary phase; GFP‐fusion protein is induced by the DNA‐damaging agent MMS 0.9623 0.0001
HEM13 YDR044W Coproporphyrinogen III oxidase, an oxygen requiring enzyme that catalyzes the sixth step in the heme biosynthetic pathway; transcription is repressed by oxygen and heme (via Rox1p and Hap1p) 0.9613 0.0001
PRP9 YDL030W Subunit of the SF3a splicing factor complex, required for spliceosome assembly; acts after the formation of the U1 snRNP‐
pre‐mRNA complex 0.9609 0.0000
CRH1 YGR189C Chitin transglycosylase that functions in the transfer of chitin to beta(1‐6) and beta(1‐3) glucans in the cell wall; similar and functionally redundant to Utr2; localizes to sites of polarized growth; expression induced by cell wall stress 0.9581 0.0001
JEM1 YJL073W DnaJ‐like chaperone required for nuclear membrane fusion during mating, localizes to the ER membrane; exhibits genetic interactions with KAR2 0.9574 0.0001
NA YLL066W‐B 0.9551 0.0008
PRO1 YDR300C 0.9528 0.0005
NA YLL066W‐B 0.9523 0.0006
DFM1 YDR411C Putative protein of unknown function; overexpression causes a cell cycle delay or arrest Gamma‐glutamyl kinase, catalyzes the first step in proline biosynthesis Putative protein of unknown function; overexpression causes a cell cycle delay or arrest Endoplasmic reticulum (ER) localized protein involved in ER‐
associated protein degradation (ERAD), ER stress and homeostasis; interacts with components of ERAD‐L and ERAD‐C and Cdc48p; derlin‐like family member similar to Der1p 0.9511 0.0001
PAU18 YLL064C Protein of unknown function, member of the seripauperin multigene family encoded mainly in subtelomeric regions; identical to Pau6p 0.9495 0.0001
Symbols ORF Description NA YDR186C DLD2 230
log2(mtr1
0.Ts/WT.T
s) adj.p.val Subunit of the SAS complex (Sas2p, Sas4p, Sas5p), which acetylates free histones and nucleosomes and regulates transcriptional silencing; required for the HAT activity of Sas2p 0.9494 0.0001
YPL192C Pheromone‐regulated protein required for nuclear envelope fusion during karyogamy; localizes to the outer face of the nuclear membrane; interacts with Kar5p at the spindle pole body 0.9489 0.0001
TIM22 YDL217C Essential core component of the mitochondrial TIM22 complex involved in insertion of polytopic proteins into the inner membrane; forms the channel through which proteins are imported 0.9480 0.0001
RTR2 YDR066C 0.9477 0.0001
MRPL51 POL3 YPR100W YDL102W Protein of unknown function with high similarity to Rtr1p; exhibits genetic interactions with Rtr1p; green fluorescent protein (GFP)‐
fusion protein localizes to the cytoplasm; YDR066C is not an essential gene Mitochondrial ribosomal protein of the large subunit
Catalytic subunit of DNA polymerase delta; required for chromosomal DNA replication during mitosis and meiosis, intragenic recombination, repair of double strand DNA breaks, and DNA replication during nucleotide excision repair (NER) 0.9476 0.9453 0.0002
0.0000
NA YDL211C 0.9435 0.0003
ALG14 YBR070C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the vacuole Component of UDP‐GlcNAc transferase required for the second step of dolichyl‐linked oligosaccharide synthesis; anchors the catalytic subunit Alg13p to the ER membrane; similar to bacterial and human glycosyltransferases 0.9365 0.0001
GRX3 YDR098C Hydroperoxide and superoxide‐radical responsive glutathione‐
dependent oxidoreductase; monothiol glutaredoxin subfamily member along with Grx4p and Grx5p; protects cells from oxidative damage 0.9362 0.0000
NRM1 YNR009W Transcriptional co‐repressor of MBF (MCB binding factor)‐regulated gene expression; Nrm1p associates stably with promoters via MBF to repress transcription upon exit from G1 phase 0.9335 0.0005
OST5 YGL226C‐A Zeta subunit of the oligosaccharyltransferase complex of the ER lumen, which catalyzes asparagine‐linked glycosylation of newly synthesized proteins 0.9335 0.0001
NA RPB11 YDR282C YOL005C 0.9304 0.9296 0.0001
0.0001
SHE9 YDR393W Putative protein of unknown function
RNA polymerase II subunit B12.5; part of central core; similar to Rpc19p and bacterial alpha subunit Mitochondrial inner membrane protein required for normal mitochondrial morphology, may be involved in fission of the inner membrane; forms a homo‐oligomeric complex 0.9295 0.0002
PAM16 YJL104W Constituent of the import motor (PAM complex) component of the Translocase of the Inner Mitochondrial membrane (TIM23 complex); forms a 1:1 subcomplex with Pam18p and inhibits its cochaperone activity; contains a J‐like domain 0.9265 0.0001
MUD2 YKL074C Protein involved in early pre‐mRNA splicing; component of the pre‐
mRNA‐U1 snRNP complex, the commitment complex; interacts with Msl5p/BBP splicing factor and Sub2p; similar to metazoan splicing factor U2AF65 0.9256 0.0002
Symbols ORF Description SAS4 YDR181C PRM3 231
log2(mtr1
0.Ts/WT.T
s) adj.p.val Peripheral membrane protein that is required for vacuolar H+‐
ATPase (V‐ATPase) function, although not an actual component of the V‐ATPase complex; functions in the assembly of the V‐ATPase; localized to the yeast endoplasmic reticulum (ER) 0.9246 0.0001
YKR078W Cytoplasmic protein of unknown function, has similarity to Vps5p; potential Cdc28p substrate; contains a Phox homology (PX) domain and specifically binds phosphatidylinositol 3‐phosphate (PtdIns‐3‐P) 0.9242 0.0003
MSS2 YDL107W Peripherally bound inner membrane protein of the mitochondrial matrix involved in membrane insertion of C‐terminus of Cox2p, interacts genetically and physically with Cox18p 0.9220 0.0001
SPC72 YAL047C Component of the cytoplasmic Tub4p (gamma‐tubulin) complex, binds spindle pole bodies and links them to microtubules; has roles in astral microtubule formation and stabilization 0.9199 0.0001
GET3 YDL100C Guanine nucleotide exchange factor for Gpa1p; amplifies G protein signaling; subunit of the GET complex, which is involved in Golgi to ER trafficking and insertion of proteins into the ER membrane; has low‐level ATPase activity 0.9188 0.0000
NA YDR124W 0.9173 0.0002
NA ASF2 YDR366C YDL197C 0.9171 0.9165 0.0001
0.0001
NA YNR075C‐A 0.9165 0.0002
ATP16 YDL004W Putative protein of unknown function; non‐essential gene; expression is strongly induced by alpha factor Putative protein of unknown function
Anti‐silencing protein that causes derepression of silent loci when overexpressed Identified by gene‐trapping, microarray‐based expression analysis, and genome‐wide homology searching Delta subunit of the central stalk of mitochondrial F1F0 ATP synthase, which is a large, evolutionarily conserved enzyme complex required for ATP synthesis; phosphorylated 0.9148 0.0001
NA YPR108W‐A 0.9125 0.0006
RVB1 YDR190C Putative protein of unknown function; identified by fungal homology and RT‐PCR Essential protein involved in transcription regulation; component of chromatin remodeling complexes; required for assembly and function of the INO80 complex; also referred to as pontin; member of the RUVB‐like protein family 0.9094 0.0002
CDC1 YDR182W Putative lipid phosphatase of the endoplasmic reticulum; shows Mn2+ dependence and may affect Ca2+ signaling; mutants display actin and general growth defects and pleiotropic defects in cell cycle progression and organelle distribution 0.9069 0.0000
LSM6 YDR378C Lsm (Like Sm) protein; part of heteroheptameric complexes (Lsm2p‐
7p and either Lsm1p or 8p): cytoplasmic Lsm1p complex involved in mRNA decay; nuclear Lsm8p complex part of U6 snRNP and possibly involved in processing tRNA, snoRNA, and rRNA 0.9065 0.0001
RPT3 YDR394W One of six ATPases of the 19S regulatory particle of the 26S proteasome involved in the degradation of ubiquitinated substrates; substrate of N‐acetyltransferase B 0.9025 0.0000
TAH1 YCR060W 0.9018 0.0002
THI13 YDL244W HSP90 cofactor; interacts with Hsp82p, Pih1p, Rvb1 and Rvb2, contains a single TPR domain with at least two TPR motifs Protein involved in synthesis of the thiamine precursor hydroxymethylpyrimidine (HMP); member of a subtelomeric gene family including THI5, THI11, THI12, and THI13 0.9012 0.0002
Symbols ORF Description VMA22 YHR060W NA 232
log2(mtr1
0.Ts/WT.T
s) adj.p.val Subunit of the Sec61p translocation complex (Sec61p‐Sss1p‐Sbh1p) that forms a channel for passage of secretory proteins through the endoplasmic reticulum membrane, and of the Ssh1p complex (Ssh1p‐Sbh2p‐Sss1p); interacts with Ost4p and Wbp1p 0.9007 0.0005
YDR195W RNA‐binding protein involved in the cleavage step of mRNA 3'‐end formation prior to polyadenylation, and in snoRNA maturation; part of holo‐CPF subcomplex APT, which associates with 3'‐ends of snoRNA‐ and mRNA‐encoding genes 0.8998 0.0001
UBX3 YDL091C UBX (ubiquitin regulatory X) domain‐containing protein that interacts with Cdc48p, green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern 0.8993 0.0003
RSM19 YNR037C 0.8988 0.0004
COA2 YPL189C‐A Mitochondrial ribosomal protein of the small subunit, has similarity to E. coli S19 ribosomal protein Cytochrome oxidase assembly factor; null mutation results in respiratory deficiency with specific loss of cytochrome oxidase activity; functions downstream of assembly factors Mss51p and Coa1p and interacts with assembly factor Shy1p 0.8930 0.0007
MTW1 YAL034W‐A Essential component of the MIND kinetochore complex (Mtw1p Including Nnf1p‐Nsl1p‐Dsn1p) which joins kinetochore subunits contacting DNA to those contacting microtubules; critical to kinetochore assembly 0.8921 0.0004
NA YDL121C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the endoplasmic reticulum; YDL121C is not an essential protein 0.8914 0.0003
YPD1 YDL235C Phosphorelay intermediate protein, phosphorylated by the plasma membrane sensor Sln1p in response to osmotic stress and then in turn phosphorylates the response regulators Ssk1p in the cytosol and Skn7p in the nucleus 0.8907 0.0001
TAF1 YGR274C TFIID subunit (145 kDa), involved in RNA polymerase II transcription initiation; possesses in vitro histone acetyltransferase activity but its role in vivo appears to be minor; involved in promoter binding and G1/S progression 0.8886 0.0004
SRN2 YLR119W Component of the ESCRT‐I complex, which is involved in ubiquitin‐
dependent sorting of proteins into the endosome; suppressor of rna1‐1 mutation; may be involved in RNA export from nucleus 0.8881 0.0005
DET1 YDR051C Acid phosphatase involved in the non‐vesicular transport of sterols in both directions between the endoplasmic reticulum and plasma membrane; deletion confers sensitivity to nickel 0.8868 0.0001
NA YDL176W Protein of unknown function, predicted by computational methods to be involved in fructose‐1,6‐bisphosphatase (Fbp1p) degradation; interacts with components of the GID complex; YDL176W is not an essential gene 0.8862 0.0002
NA YDR131C 0.8859 0.0001
ARG82 YDR173C F‐box protein, substrate‐specific adaptor subunit that recruits substrates to a core ubiquitination complex Inositol polyphosphate multikinase (IPMK), sequentially phosphorylates Ins(1,4,5)P3 to form Ins(1,3,4,5,6)P5; also has diphosphoinositol polyphosphate synthase activity; regulates arginine‐, phosphate‐, and nitrogen‐responsive genes 0.8848 0.0002
NA YDL086W Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies; YDL086W is not an essential gene 0.8846 0.0001
Symbols ORF Description SSS1 YDR086C REF2 233
log2(mtr1
0.Ts/WT.T
s) adj.p.val Meiosis‐specific transcription factor required for exit from pachytene and for full meiotic recombination; activates middle sporulation genes; competes with Sum1p for binding to promoters containing middle sporulation elements (MSE) 0.8806 0.0003
YPL170W Heme‐binding protein involved in regulation of cytochrome P450 protein Erg11p; damage response protein, related to mammalian membrane progesterone receptors; mutations lead to defects in telomeres, mitochondria, and sterol synthesis 0.8762 0.0001
RLF2 YPR018W Largest subunit (p90) of the Chromatin Assembly Complex (CAF‐1) with Cac2p and Msi1p that assembles newly synthesized histones onto recently replicated DNA; involved in the maintenance of transcriptionally silent chromatin 0.8760 0.0002
CAB5 YDR196C Probable dephospho‐CoA kinase (DPCK) that catalyzes the last step in coenzyme A biosynthesis; null mutant lethality is complemented by E. coli coaE (encoding DPCK); detected in purified mitochondria in high‐throughput studies 0.8751 0.0002
COG8 YML071C Component of the conserved oligomeric Golgi complex (Cog1p through Cog8p), a cytosolic tethering complex that functions in protein trafficking to mediate fusion of transport vesicles to Golgi compartments 0.8701 0.0001
DAL2 YIR029W Allantoicase, converts allantoate to urea and ureidoglycolate in the second step of allantoin degradation; expression sensitive to nitrogen catabolite repression and induced by allophanate, an intermediate in allantoin degradation 0.8698 0.0001
DUR3 YHL016C Plasma membrane transporter for both urea and polyamines, expression is highly sensitive to nitrogen catabolite repression and induced by allophanate, the last intermediate of the allantoin degradative pathway 0.8693 0.0001
BCS1 YDR375C Mitochondrial protein of the AAA ATPase family; has ATP‐
dependent chaperone activity; required for assembly of Rip1p and Qcr10p into cytochrome bc(1) complex; mutations in human homolog BCS1L are linked to neonatal mitochondrial diseases 0.8677 0.0002
SNA4 YDL123W 0.8662 0.0002
MRPL33 YAE1 YMR286W YJR067C 0.8660 0.8654 0.0002
0.0002
SKP1 YDR328C Protein of unknown function, localized to the vacuolar outer membrane; predicted to be palmitoylated Mitochondrial ribosomal protein of the large subunit
Protein of unknown function, essential for growth under standard (aerobic) conditions but not under anaerobic conditions Evolutionarily conserved kinetochore protein that is part of multiple protein complexes, including the SCF ubiquitin ligase complex, the CBF3 complex that binds centromeric DNA, and the RAVE complex that regulates assembly of the V‐ATPase 0.8642 0.0001
NA YML083C Putative protein of unknown function; strong increase in transcript abundance during anaerobic growth compared to aerobic growth; cells deleted for YML083C do not exhibit growth defects in anerobic or anaerobic conditions 0.8642 0.0006
SIR4 YDR227W Silent information regulator that, together with SIR2 and SIR3, is involved in assembly of silent chromatin domains at telomeres and the silent mating‐type loci; potentially phosphorylated by Cdc28p; some alleles of SIR4 prolong lifespan 0.8635 0.0001
TIM8 YJR135W‐A Mitochondrial intermembrane space protein, forms a complex with Tim13p that delivers a subset of hydrophobic proteins to the TIM22 complex for inner membrane insertion; homolog of human TIMM8A, implicated in Mohr‐Tranebjaerg syndrome 0.8624 0.0004
Symbols ORF Description NDT80 YHR124W DAP1 234
log2(mtr1
0.Ts/WT.T
s) adj.p.val Conserved nuclear protein that interacts with GTP‐Gsp1p, which is a Ran homolog of the Ras GTPase family, and stimulates nucleotide release, involved in nuclear protein import, nucleotide release is inhibited by Yrb1p 0.8607 0.0002
YDR295C Subunit of a possibly tetrameric trichostatin A‐sensitive class II histone deacetylase complex containing an Hda1p homodimer and an Hda2p‐Hda3p heterodimer; involved in telomere maintenance 0.8599 0.0001
SMC3 YJL074C Subunit of the multiprotein cohesin complex required for sister chromatid cohesion in mitotic cells; also required, with Rec8p, for cohesion and recombination during meiosis; phylogenetically conserved SMC chromosomal ATPase family member 0.8591 0.0001
ZIM17 YNL310C Heat shock protein with a zinc finger motif; essential for protein import into mitochondria; may act with Pam18p to facilitate recognition and folding of imported proteins by Ssc1p (mtHSP70) in the mitochondrial matrix 0.8583 0.0001
PRP28 YDR243C 0.8575 0.0001
PEX29 YDR479C RNA helicase in the DEAD‐box family, involved in RNA isomerization at the 5' splice site Peroxisomal integral membrane peroxin, involved in the regulation of peroxisomal size, number and distribution; genetic interactions suggest that Pex28p and Pex29p act at steps upstream of those mediated by Pex30p, Pex31p, and Pex32p 0.8559 0.0004
GPI8 YDR331W ER membrane glycoprotein subunit of the glycosylphosphatidylinositol transamidase complex that adds glycosylphosphatidylinositol (GPI) anchors to newly synthesized proteins; human PIG‐K protein is a functional homolog 0.8556 0.0002
YRB1 YDR002W Ran GTPase binding protein; involved in nuclear protein import and RNA export, ubiquitin‐mediated protein degradation during the cell cycle; shuttles between the nucleus and cytoplasm; is essential; homolog of human RanBP1 0.8546 0.0001
TGL2 YDR058C Triacylglycerol lipase that is localized to the mitochondria; has lipolytic activity towards triacylglycerols and diacylglycerols when expressed in E. coli 0.8540 0.0003
RPN6 YDL097C Essential, non‐ATPase regulatory subunit of the 26S proteasome lid required for the assembly and activity of the 26S proteasome; the human homolog (S9 protein) partially rescues Rpn6p depletion 0.8524 0.0001
EAF6 YJR082C Subunit of the NuA4 acetyltransferase complex that acetylates histone H4 and NuA3 acetyltransferase complex that acetylates histone H3 0.8514 0.0007
FCF2 YLR051C Essential nucleolar protein involved in the early steps of 35S rRNA processing; interacts with Faf1p; member of a transcriptionally co‐
regulated set of genes called the RRB regulon 0.8499 0.0007
NA YDR003W‐A 0.8497 0.0006
FRQ1 YDR373W Putative protein of unknown function; identified by expression profiling and mass spectrometry N‐myristoylated calcium‐binding protein that may have a role in intracellular signaling through its regulation of the phosphatidylinositol 4‐kinase Pik1p; member of the recoverin/frequenin branch of the EF‐hand superfamily 0.8497 0.0001
XRS2 YDR369C Protein required for DNA repair; component of the Mre11 complex, which is involved in double strand breaks, meiotic recombination, telomere maintenance, and checkpoint signaling 0.8488 0.0002
Symbols ORF Description MOG1 YJR074W HDA2 235
log2(mtr1
0.Ts/WT.T
s) adj.p.val Component of U1 snRNP required for mRNA splicing via spliceosome; yeast specific, no metazoan counterpart; interacts with mRNA in commitment complex 0.8478 0.0001
NA YIL169C NA Putative protein of unknown function; serine/threonine rich and highly similar to YOL155C, a putative glucan alpha‐1,4‐glucosidase; transcript is induced in both high and low pH environments; YIL169C is a non‐essential gene 0.8457 0.8448 0.0003
0.0003
RBS1 YDL189W Protein of unknown function, identified as a high copy suppressor of psk1 psk2 mutations that confer temperature‐sensitivity for galactose utilization; proposed to bind single‐stranded nucleic acids via its R3H domain 0.8436 0.0001
SIS1 YNL007C Type II HSP40 co‐chaperone that interacts with the HSP70 protein Ssa1p; not functionally redundant with Ydj1p due to due to substrate specificity; shares similarity with bacterial DnaJ proteins 0.8408 0.0001
RTT107 YHR154W Protein implicated in Mms22‐dependent DNA repair during S phase, DNA damage induces phosphorylation by Mec1p at one or more SQ/TQ motifs; interacts with Mms22p and Slx4p; has four BRCT domains; has a role in regulation of Ty1 transposition 0.8398 0.0008
KIN28 YDL108W Serine/threonine protein kinase, subunit of the transcription factor TFIIH; involved in transcription initiation at RNA polymerase II promoters 0.8393 0.0001
NA YCR102C Putative protein of unknown function, involved in copper metabolism; similar to C. carbonum toxD gene; member of the quinone oxidoreductase family 0.8392 0.0003
NA Putative protein of unknown function
0.8378 0.0006
CDC21 YMR030W‐
A YOR074C Thymidylate synthase, required for de novo biosynthesis of pyrimidine deoxyribonucleotides; expression is induced at G1/S 0.8367 0.0004
MIM1 YOL026C Mitochondrial outer membrane protein, required for assembly of the translocase of the outer membrane (TOM) complex and thereby for mitochondrial protein import; N terminus is exposed to the cytosol: transmembrane segment is highly conserved 0.8354 0.0001
MRP1 YDR347W Mitochondrial ribosomal protein of the small subunit; MRP1 exhibits genetic interactions with PET122, encoding a COX3‐specific translational activator, and with PET123, encoding a small subunit mitochondrial ribosomal protein 0.8317 0.0002
TAF7 YMR227C 0.8290 0.0003
IWR1 YDL115C TFIID subunit (67 kDa), involved in RNA polymerase II transcription initiation Protein involved in both basal and regulated transcription from RNA polymerase II (RNAP II) promoters; interacts with most of the RNAP II subunits; nucleo‐cytoplasmic shuttling protein; deletion causes hypersensitivity to K1 killer toxin 0.8280 0.0001
YCF1 YDR135C Vacuolar glutathione S‐conjugate transporter of the ATP‐binding cassette family, has a role in detoxifying metals such as cadmium, mercury, and arsenite; also transports unconjugated bilirubin; similar to human cystic fibrosis protein CFTR 0.8248 0.0002
VAM6 YDL077C Vacuolar protein that plays a critical role in the tethering steps of vacuolar membrane fusion by facilitating guanine nucleotide exchange on small guanosine triphosphatase Ypt7p 0.8236 0.0003
Symbols ORF Description SNU56 YDR240C NA NA 236
log2(mtr1
0.Ts/WT.T
s) adj.p.val Protein involved in bud‐site selection and required for axial budding pattern; localizes with septins to bud neck in mitosis and may constitute an axial landmark for next round of budding 0.8235 0.0002
YNL166C Protein involved in organization of septins at the mother‐bud neck, may interact directly with the Cdc11p septin, localizes to bud neck in a septin‐dependent manner 0.8230 0.0001
CBS2 YDR197W Mitochondrial translational activator of the COB mRNA; interacts with translating ribosomes, acts on the COB mRNA 5'‐untranslated leader 0.8212 0.0001
FPR2 YDR519W Membrane‐bound peptidyl‐prolyl cis‐trans isomerase (PPIase), binds to the drugs FK506 and rapamycin; expression pattern suggests possible involvement in ER protein trafficking 0.8184 0.0002
NA YDL073W 0.8161 0.0002
PAU8 YAL068C 0.8158 0.0002
DIF1 YLR437C Putative protein of unknown function; YDL073W is not an essential gene Protein of unknown function, member of the seripauperin multigene family encoded mainly in subtelomeric regions Protein that regulates the nuclear localization of ribonucleotide reductase Rnr2p and Rnr4p subunits; phosphorylated by Dun1p in response to DNA damage and degraded; N‐terminal half has similarity to S. pombe Spd1 protein 0.8156 0.0002
RPN9 YDR427W Non‐ATPase regulatory subunit of the 26S proteasome, has similarity to putative proteasomal subunits in other species; null mutant is temperature sensitive and exhibits cell cycle and proteasome assembly defects 0.8151 0.0002
SDH4 YDR178W Membrane anchor subunit of succinate dehydrogenase (Sdh1p, Sdh2p, Sdh3p, Sdh4p), which couples the oxidation of succinate to the transfer of electrons to ubiquinone as part of the TCA cycle and the mitochondrial respiratory chain 0.8145 0.0003
CHA1 YCL064C Catabolic L‐serine (L‐threonine) deaminase, catalyzes the degradation of both L‐serine and L‐threonine; required to use serine or threonine as the sole nitrogen source, transcriptionally induced by serine and threonine 0.8137 0.0003
PST1 YDR055W Cell wall protein that contains a putative GPI‐attachment site; secreted by regenerating protoplasts; up‐regulated by activation of the cell integrity pathway, as mediated by Rlm1p; upregulated by cell wall damage via disruption of FKS1 0.8131 0.0008
SAN1 YDR143C 0.8129 0.0004
NA YDR319C Ubiquitin‐protein ligase, involved in the proteasome‐dependent degradation of aberrant nuclear proteins; contains intrinsically disordered regions that contribute to substrate recognition Putative protein of unknown function, identified as an ortholog of the highly conserved FIT family of proteins involved in triglyceride droplet biosynthesis; interacts with Sst2p and Hsp82p in high‐
throughput two‐hybrid screens 0.8108 0.0001
TBS1 YBR150C Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies 0.8096 0.0009
PSF1 YDR013W Subunit of the GINS complex (Sld5p, Psf1p, Psf2p, Psf3p), which is localized to DNA replication origins and implicated in assembly of the DNA replication machinery 0.8095 0.0001
MPP6 YNR024W Nuclear exosome‐associated RNA binding protein; involved in surveillance of pre‐rRNAs and pre‐mRNAs, and the degradation of cryptic non‐coding RNAs (ncRNA); copurifies with ribosomes 0.8084 0.0003
Symbols ORF Description BUD3 YCL014W BNI5 237
log2(mtr1
0.Ts/WT.T
s) adj.p.val Peptidyl‐prolyl cis‐trans isomerase (cyclophilin), catalyzes the cis‐
trans isomerization of peptide bonds N‐terminal to proline residues; binds to Hsp82p and contributes to chaperone activity 0.8053 0.0003
YMR273C Protein with a role in regulating Swe1p‐dependent polarized growth; interacts with silencing proteins at the telomere; has a role in Bcy1p localization; implicated in mRNA nuclear export; involved in mitotic exit through Cdc14p regulation 0.8035 0.0004
GIC2 YDR309C Redundant rho‐like GTPase Cdc42p effector; homolog of Gic1p; involved in initiation of budding and cellular polarization; interacts with Cdc42p via the Cdc42/Rac‐interactive binding (CRIB) domain and with PI(4,5)P2 via a polybasic region 0.8020 0.0001
FYV6 YNL133C Protein of unknown function, required for survival upon exposure to K1 killer toxin; proposed to regulate double‐strand break repair via non‐homologous end‐joining 0.8011 0.0002
YKE2 YLR200W Subunit of the heterohexameric Gim/prefoldin protein complex involved in the folding of alpha‐tubulin, beta‐tubulin, and actin 0.8010 0.0004
SYF1 YDR416W Member of the NineTeen Complex (NTC) that contains Prp19p and stabilizes U6 snRNA in catalytic forms of the spliceosome containing U2, U5, and U6 snRNAs; null mutant has splicing defect and arrests in G2/M; homologs in human and C. elegans 0.7998 0.0002
IES2 YNL215W Protein that associates with the INO80 chromatin remodeling complex under low‐salt conditions; essential for growth under anaerobic conditions 0.7976 0.0002
GCS1 YDL226C ADP‐ribosylation factor GTPase activating protein (ARF GAP), involved in ER‐Golgi transport; shares functional similarity with Glo3p 0.7975 0.0004
MRPL37 ASP1 YBR268W YDR321W Mitochondrial ribosomal protein of the large subunit
Cytosolic L‐asparaginase, involved in asparagine catabolism
0.7958 0.7957 0.0003
0.0006
PHO2 YDL106C Homeobox transcription factor; regulatory targets include genes involved in phosphate metabolism; binds cooperatively with Pho4p to the PHO5 promoter; phosphorylation of Pho2p facilitates interaction with Pho4p 0.7956 0.0006
NA YOR389W 0.7938 0.0005
NA KCS1 YDR415C YDR017C Putative protein of unknown function; expression regulated by copper levels Putative protein of unknown function
Inositol hexakisphosphate (IP6) and inositol heptakisphosphate (IP7) kinase; generation of high energy inositol pyrophosphates by Kcs1p is required for many processes such as vacuolar biogenesis, stress response and telomere maintenance 0.7904 0.7900 0.0004
0.0006
PFD1 YJL179W Subunit of heterohexameric prefoldin, which binds cytosolic chaperonin and transfers target proteins to it; involved in the biogenesis of actin and of alpha‐ and gamma‐tubulin 0.7899 0.0002
RNH70 YGR276C 0.7897 0.0004
PMS1 YNL082W 3'‐5' exoribonuclease; required for maturation of 3' ends of 5S rRNA and tRNA‐Arg3 from dicistronic transcripts ATP‐binding protein required for mismatch repair in mitosis and meiosis; functions as a heterodimer with Mlh1p, binds double‐ and single‐stranded DNA via its N‐terminal domain, similar to E. coli MutL 0.7893 0.0003
Symbols ORF Description CPR7 YJR032W ZDS1 238
log2(mtr1
0.Ts/WT.T
s) adj.p.val Protein involved in minichromosome maintenance; component of the COMA complex (Ctf19p, Okp1p, Mcm21p, Ame1p) that bridges kinetochore subunits that are in contact with centromeric DNA and the subunits bound to microtubules 0.7881 0.0004
YHR129C Actin‐related protein of the dynactin complex; required for spindle orientation and nuclear migration; putative ortholog of mammalian centractin 0.7879 0.0006
RFA3 YJL173C Subunit of heterotrimeric Replication Protein A (RPA), which is a highly conserved single‐stranded DNA binding protein involved in DNA replication, repair, and recombination 0.7878 0.0002
CPR5 YDR304C Peptidyl‐prolyl cis‐trans isomerase (cyclophilin) of the endoplasmic reticulum, catalyzes the cis‐trans isomerization of peptide bonds N‐
terminal to proline residues; transcriptionally induced in response to unfolded proteins in the ER 0.7860 0.0001
RAM1 YDL090C Beta subunit of the CAAX farnesyltransferase (FTase) that prenylates the a‐factor mating pheromone and Ras proteins; required for the membrane localization of Ras proteins and a‐factor; homolog of the mammalian FTase beta subunit 0.7854 0.0002
NA OST4 NA YDL232W NA Subunit of the oligosaccharyltransferase complex of the ER lumen, which catalyzes protein asparagine‐linked glycosylation; type I membrane protein required for incorporation of Ost3p or Ost6p into the OST complex 0.7854 0.7845 0.0004
0.0001
GRX1 YCL035C Hydroperoxide and superoxide‐radical responsive heat‐stable glutathione‐dependent disulfide oxidoreductase with active site cysteine pair; protects cells from oxidative damage 0.7839 0.0009
HST4 YDR191W Member of the Sir2 family of NAD(+)‐dependent protein deacetylases; involved along with Hst3p in silencing at telomeres, cell cycle progression, radiation resistance, genomic stability and short‐chain fatty acid metabolism 0.7830 0.0003
SNA2 YDR525W‐A Protein of unknown function, has similarity to Pmp3p, which is involved in cation transport; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern 0.7827 0.0002
NUM1 YDR150W Protein required for nuclear migration, localizes to the mother cell cortex and the bud tip; may mediate interactions of dynein and cytoplasmic microtubules with the cell cortex 0.7800 0.0002
SLX5 YDL013W Subunit of the Slx5‐Slx8 SUMO‐targeted ubiquitin ligase (STUbL) complex, stimulated by SUMO‐modified substrates; contains a RING domain and two SIMs (SUMO‐interacting motifs); forms SUMO‐
dependent nuclear foci, including DNA repair centers 0.7800 0.0002
SHU2 YDR078C Protein involved in a Rad51p‐, Rad54p‐dependent pathway for homologous recombination repair, important for error‐free repair of spontaneous and induced DNA lesions to protect the genome from mutation; associates with Shu1p, Psy3p, and Csm2p 0.7789 0.0002
UBC13 YDR092W Ubiquitin‐conjugating enzyme involved in the error‐free DNA postreplication repair pathway; interacts with Mms2p to assemble ubiquitin chains at the Ub Lys‐63 residue; DNA damage triggers redistribution from the cytoplasm to the nucleus 0.7785 0.0001
CUS2 YNL286W Protein that binds to U2 snRNA and Prp11p, may be involved in U2 snRNA folding; contains two RNA recognition motifs (RRMs) 0.7766 0.0003
Symbols ORF Description MCM21 YDR318W ARP1 239
log2(mtr1
0.Ts/WT.T
s) adj.p.val Protein with similarity to ATP‐binding cassette (ABC) transporter family members; lacks predicted membrane‐spanning regions; transcriptionally activated by Yrm1p along with genes involved in multidrug resistance 0.7763 0.0002
YDR128W Protein of unknown function; mtc5 is synthetically sick with cdc13‐1 0.7763 0.0001
GPI17 YDR434W Transmembrane protein subunit of the glycosylphosphatidylinositol transamidase complex that adds GPIs to newly synthesized proteins; human PIG‐Sp homolog 0.7762 0.0008
GIM5 YML094W Subunit of the heterohexameric cochaperone prefoldin complex which binds specifically to cytosolic chaperonin and transfers target proteins to it 0.7755 0.0002
SPS1 YDR523C Putative protein serine/threonine kinase expressed at the end of meiosis and localized to the prospore membrane, required for correct localization of enzymes involved in spore wall synthesis 0.7754 0.0008
FMP10 YER182W Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies 0.7751 0.0007
NA YDR026C Protein of unknown function that may interact with ribosomes, based on co‐purification experiments; Myb‐like DNA‐binding protein that may bind to the Ter region of rDNA; interacts physically with Fob1p 0.7749 0.0002
NA HIF1 YDR444W YLL022C Putative protein of unknown function
Non‐essential component of the HAT‐B histone acetyltransferase complex (Hat1p‐Hat2p‐Hif1p), localized to the nucleus; has a role in telomeric silencing 0.7732 0.7725 0.0007
0.0003
UMP1 YBR173C Short‐lived chaperone required for correct maturation of the 20S proteasome; may inhibit premature dimerization of proteasome half‐mers; degraded by proteasome upon completion of its assembly 0.7723 0.0002
SWR1 YDR334W Swi2/Snf2‐related ATPase that is the structural component of the SWR1 complex, which exchanges histone variant H2AZ (Htz1p) for chromatin‐bound histone H2A 0.7709 0.0004
TRM9 YML014W tRNA methyltransferase, catalyzes esterification of modified uridine nucleotides in tRNA(Arg3) and tRNA(Glu), likely as part of a complex with Trm112p; deletion confers resistance to zymocin 0.7693 0.0006
VTA1 YLR181C Multivesicular body (MVB) protein involved in endosomal protein sorting; regulates Vps4p activity by promoting its oligomerization; has an N‐terminal Vps60‐ and Did2‐ binding domain, a linker region, and a C‐terminal Vps4p binding domain 0.7691 0.0003
SRP14 YDL092W Signal recognition particle (SRP) subunit, interacts with the RNA component of SRP to form the Alu domain, which is the region of SRP responsible for arrest of nascent chain elongation during membrane targeting; homolog of mammalian SRP14 0.7685 0.0003
MRPL44 NA PSH1 YMR225C YDR109C YOL054W Mitochondrial ribosomal protein of the large subunit
Putative kinase
E3 ubiquitin ligase that mediates poyubiquitination and degradation of centromere‐binding protein Cse4p and prevents Cse4p from mislocalizing to euchromatin; ubiquitylation of Cse4p may be antagonized by Scm3p 0.7677 0.7675 0.7665 0.0004
0.0001
0.0003
NA YLR099W‐A Putative protein of unknown function
0.7665 0.0003
Symbols ORF Description NA YDR061W MTC5 240
log2(mtr1
0.Ts/WT.T
s) adj.p.val Component of the SF3b subcomplex of the U2 snRNP, essential protein required for for splicing and for assembly of SF3b 0.7634 0.0003
YDR226W Adenylate kinase, required for purine metabolism; localized to the cytoplasm and the mitochondria; lacks cleavable signal sequence 0.7628 0.0001
PCF11 YDR228C mRNA 3' end processing factor, essential component of cleavage and polyadenylation factor IA (CF IA), involved in pre‐mRNA 3' end processing and in transcription termination; binds C‐terminal domain of largest subunit of RNA pol II (Rpo21p) 0.7620 0.0001
PKH3 YDR466W Protein kinase with similarity to mammalian phosphoinositide‐
dependent kinase 1 (PDK1) and yeast Pkh1p and Pkh2p, two redundant upstream activators of Pkc1p; identified as a multicopy suppressor of a pkh1 pkh2 double mutant 0.7617 0.0003
VPS3 YDR495C Component of CORVET tethering complex; cytoplasmic protein required for the sorting and processing of soluble vacuolar proteins, acidification of the vacuolar lumen, and assembly of the vacuolar H+‐ATPase 0.7615 0.0006
PPH22 YDL188C Catalytic subunit of protein phosphatase 2A (PP2A), functionally redundant with Pph21p; methylated at C terminus; forms alternate complexes with several regulatory subunits; involved in signal transduction and regulation of mitosis 0.7611 0.0006
CTF8 YHR191C Subunit of a complex with Ctf18p that shares some subunits with Replication Factor C and is required for sister chromatid cohesion 0.7600 0.0002
DPM1 YPR183W Dolichol phosphate mannose (Dol‐P‐Man) synthase of the ER membrane, catalyzes the formation of Dol‐P‐Man from Dol‐P and GDP‐Man; required for glycosyl phosphatidylinositol membrane anchoring, O mannosylation, and protein glycosylation 0.7600 0.0002
TIM11 YDR322C‐A Subunit e of mitochondrial F1F0‐ATPase, which is a large, evolutionarily conserved enzyme complex required for ATP synthesis; essential for the dimeric and oligomeric state of ATP synthase 0.7569 0.0001
MSA2 YKR077W Putative transcriptional activator, that interacts with G1‐specific transcription factor, MBF and G1‐specific promoters; ortholog of Msa2p, an MBF and SBF activator that regulates G1‐specific transcription and cell cycle initiation 0.7569 0.0005
YOS1 YER074W‐A Integral membrane protein required for ER to Golgi transport; localized to the Golgi, the ER, and COPII vesicles; interacts with Yip1p and Yif1p 0.7552 0.0002
RSM28 YDR494W Mitochondrial ribosomal protein of the small subunit; genetic interactions suggest a possible role in promoting translation initiation 0.7534 0.0002
NA YPL071C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus 0.7522 0.0004
IPK1 YDR315C Inositol 1,3,4,5,6‐pentakisphosphate 2‐kinase, nuclear protein required for synthesis of 1,2,3,4,5,6‐hexakisphosphate (phytate), which is integral to cell function; has 2 motifs conserved in other fungi; ipk1 gle1 double mutant is inviable 0.7518 0.0007
MFB1 YDR219C Mitochondria‐associated F‐box protein involved in maintenance of normal mitochondrial morphology; interacts with Skp1p through the F‐box motif; preferentially localizes to the mother cell during budding 0.7492 0.0004
Symbols ORF Description YSF3 YNL138W‐A ADK1 241
log2(mtr1
0.Ts/WT.T
s) adj.p.val Sulfiredoxin, contributes to oxidative stress resistance by reducing cysteine‐sulfinic acid groups in the peroxiredoxin Tsa1p, which is formed upon exposure to oxidants; conserved in higher eukaryotes 0.7469 0.0004
YLL021W Component of the polarisome, which functions in actin cytoskeletal organization during polarized growth; acts as a scaffold for Mkk1p and Mpk1p cell wall integrity signaling components; potential Cdc28p substrate 0.7452 0.0003
RPN5 YDL147W Essential, non‐ATPase regulatory subunit of the 26S proteasome lid, similar to mammalian p55 subunit and to another S. cerevisiae regulatory subunit, Rpn7p 0.7425 0.0005
RPC10 YHR143W‐A 0.7423 0.0006
NBP2 YDR162C RNA polymerase subunit ABC10‐alpha, found in RNA polymerase complexes I, II, and III Protein involved in the HOG (high osmolarity glycerol) pathway, negatively regulates Hog1p by recruitment of phosphatase Ptc1p the Pbs2p‐Hog1p complex, found in the nucleus and cytoplasm, contains an SH3 domain that binds Pbs2p 0.7419 0.0002
ELF1 YKL160W Transcription elongation factor that contains a conserved zinc finger domain; implicated in the maintenance of proper chromatin structure in actively transcribed regions; deletion inhibits Brome mosaic virus (BMV) gene expression 0.7394 0.0002
GNA1 YFL017C Evolutionarily conserved glucosamine‐6‐phosphate acetyltransferase required for multiple cell cycle events including passage through START, DNA synthesis, and mitosis; involved in UDP‐N‐acetylglucosamine synthesis, forms GlcNAc6P from AcCoA 0.7393 0.0001
RAD30 YDR419W DNA polymerase eta, involved in translesion synthesis during post‐
replication repair; catalyzes the synthesis of DNA opposite cyclobutane pyrimidine dimers and other lesions; mutations in human pol eta are responsible for XPV 0.7390 0.0002
NA YDL144C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; YDL144C is not an essential gene. 0.7381 0.0002
NA YOR385W Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; YOR385W is not an essential gene 0.7376 0.0002
NA YDR338C Putative protein of unknown function, member of the multi‐drug and toxin extrusion (MATE) family of the multidrug/oligosaccharidyl‐
lipid/polysaccharide (MOP) exporter superfamily 0.7371 0.0006
AIR2 YDL175C Zinc knuckle protein, involved in nuclear RNA processing and degredation as a component of the TRAMP complex; stimulates the poly(A) polymerase activity of Pap2p in vitro; functionally redundant with Air1p 0.7362 0.0003
CYK3 YDL117W SH3‐domain protein located in the mother‐bud neck and the cytokinetic actin ring; mutant phenotype and genetic interactions suggest a role in cytokinesis 0.7350 0.0001
SPO71 YDR104C Meiosis‐specific protein of unknown function, required for spore wall formation during sporulation; dispensable for both nuclear divisions during meiosis 0.7347 0.0001
NA NA NA YDR381C‐A NA Protein of unknown function, localized to the mitochondrial outer membrane 0.7347 0.7286 0.0007
0.0003
Symbols ORF Description SRX1 YKL086W SPA2 242
log2(mtr1
0.Ts/WT.T
s) adj.p.val ADP‐ribosylation factor, GTPase of the Ras superfamily involved in regulation of coated formation vesicles in intracellular trafficking within the Golgi; functionally interchangeable with Arf1p 0.7280 0.0003
YDR179W‐A NA YMR305C Putative protein of unknown function
NA Cell wall protein with similarity to glucanases; may play a role in conjugation during mating based on mutant phenotype and its regulation by Ste12p 0.7263 0.7245 0.7244 0.0005
0.0004
0.0001
LEO1 YOR123C Component of the Paf1 complex, which associates with RNA polymerase II and is involved in histone methylation; plays a role in regulating Ty1 transposition 0.7208 0.0003
NA YBL059W Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies 0.7196 0.0005
NA NA NA YIL161W NA Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; mRNA is enriched in Scp160p‐associated mRNPs; YIL161W is a non‐essential gene 0.7188 0.7183 0.0007
0.0002
VPS72 YDR485C Htz1p‐binding component of the SWR1 complex, which exchanges histone variant H2AZ (Htz1p) for chromatin‐bound histone H2A; required for vacuolar protein sorting 0.7163 0.0003
DIG2 YDR480W MAP kinase‐responsive inhibitor of the Ste12p transcription factor, involved in the regulation of mating‐specific genes and the invasive growth pathway; related regulators Dig1p and Dig2p bind to Ste12p 0.7151 0.0004
MRPL11 SRM1 YDL202W YGL097W Mitochondrial ribosomal protein of the large subunit
Nucleotide exchange factor for Gsp1p, localizes to the nucleus, required for nucleocytoplasmic trafficking of macromolecules; suppressor of the pheromone response pathway; potentially phosphorylated by Cdc28p 0.7145 0.7129 0.0002
0.0008
FMC1 YIL098C Mitochondrial matrix protein, required for assembly or stability at high temperature of the F1 sector of mitochondrial F1F0 ATP synthase; null mutant temperature sensitive growth on glycerol is suppressed by multicopy expression of Odc1p 0.7106 0.0001
AAD4 YDL243C Putative aryl‐alcohol dehydrogenase with similarity to P. chrysosporium aryl‐alcohol dehydrogenase, involved in the oxidative stress response; expression induced in cells treated with the mycotoxin patulin 0.7101 0.0004
NA YEL073C Putative protein of unknown function; located adjacent to ARS503 and the telomere on the left arm of chromosome V; regulated by inositol/choline 0.7079 0.0004
GTB1 YDR221W Glucosidase II beta subunit, forms a complex with alpha subunit Rot2p, involved in removal of two glucose residues from N‐linked glycans during glycoprotein biogenesis in the ER 0.7077 0.0004
RDH54 YBR073W DNA‐dependent ATPase, stimulates strand exchange by modifying the topology of double‐stranded DNA; involved in recombinational repair of DNA double‐strand breaks during mitosis and meiosis; proposed to be involved in crossover interference 0.7068 0.0010
SMB1 YER029C Core Sm protein Sm B; part of heteroheptameric complex (with Smd1p, Smd2p, Smd3p, Sme1p, Smx3p, and Smx2p) that is part of the spliceosomal U1, U2, U4, and U5 snRNPs; homolog of human Sm B and Sm B' 0.7043 0.0003
Symbols ORF Description ARF2 YDL137W NA NA SCW10 243
log2(mtr1
0.Ts/WT.T
s) adj.p.val Putative protein of unknown function, deletion confers reduced fitness in saline Plasma membrane low glucose sensor that regulates glucose transport; contains 12 predicted transmembrane segments and a long C‐terminal tail required for induction of hexose transporters; also senses fructose and mannose; similar to Rgt2p 0.7042 0.0006
0.7036 0.0003
YDR006C Protein whose overexpression suppresses the growth defect of mutants lacking protein kinase A activity; involved in cAMP‐
mediated signaling; localized to the nucleus; similar to the mouse testis‐specific protein PBS13 0.7025 0.0002
SAC3 YDR159W Nuclear pore‐associated protein, required for biogenesis of the small ribosomal subunit; forms a complex with Thp1p that is involved in transcription and in mRNA export from the nucleus 0.7015 0.0002
YPS7 YDR349C Putative GPI‐anchored aspartic protease, member of the yapsin family of proteases involved in cell wall growth and maintenance; located in the cytoplasm and endoplasmic reticulum 0.6982 0.0001
STP1 YDR463W Transcription factor, undergoes proteolytic processing by SPS (Ssy1p‐Ptr3p‐Ssy5p)‐sensor component Ssy5p in response to extracellular amino acids; activates transcription of amino acid permease genes and may have a role in tRNA processing 0.6970 0.0003
NA YKL018C‐A Putative protein of unknown function; identified by homology; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm 0.6955 0.0005
NA YMR114C Protein of unknown function; may interact with ribosomes, based on co‐purification experiments; green fluorescent protein (GFP)‐
fusion protein localizes to the nucleus and cytoplasm; YMR114C is not an essential gene 0.6948 0.0009
NA YOL114C Putative protein of unknown function with similarity to human ICT1 and prokaryotic factors that may function in translation termination; YOL114C is not an essential gene 0.6945 0.0004
CLB3 YDL155W B‐type cyclin involved in cell cycle progression; activates Cdc28p to promote the G2/M transition; may be involved in DNA replication and spindle assembly; accumulates during S phase and G2, then targeted for ubiquitin‐mediated degradation 0.6924 0.0002
TIF11 YMR260C Translation initiation factor eIF1A, essential protein that forms a complex with Sui1p (eIF1) and the 40S ribosomal subunit and scans for the start codon; C‐terminus associates with Fun12p (eIF5B); N terminus interacts with eIF2 and eIF3 0.6888 0.0006
SRP101 YDR292C Signal recognition particle (SRP) receptor alpha subunit; contain GTPase domains; involved in SRP‐dependent protein targeting; interacts with the beta subunit, Srp102p 0.6882 0.0003
NA CLN2 YDR307W YPL256C Putative protein of unknown function
G1 cyclin involved in regulation of the cell cycle; activates Cdc28p kinase to promote the G1 to S phase transition; late G1 specific expression depends on transcription factor complexes, MBF (Swi6p‐
Mbp1p) and SBF (Swi6p‐Swi4p) 0.6867 0.6842 0.0005
0.0003
MED11 YMR112C Subunit of the RNA polymerase II mediator complex; associates with core polymerase subunits to form the RNA polymerase II holoenzyme; essential protein 0.6826 0.0005
Symbols ORF Description NA YNR029C SNF3 YDL194W SOK1 244
log2(mtr1
0.Ts/WT.T
s) adj.p.val Essential protein required for maturation of Gas1p and Pho8p; involved in protein trafficking; GFP‐fusion protein localizes to the ER and YFP‐fusion protein to the nuclear envelope‐ER network; null mutants have a cell separation defect 0.6819 0.0005
YDR326C Protein involved in programmed cell death; mutant shows resistance to cell death induced by amiodarone or intracellular acidification 0.6813 0.0006
SNT2 YGL131C DNA binding protein with similarity to the S. pombe Snt2 protein; computational analysis suggests a role in regulation of expression of genes encoding amine transporters 0.6811 0.0003
OCA6 YDR067C Cytoplasmic protein required for replication of Brome mosaic virus in S. cerevisiae, which is a model system for studying positive‐strand RNA virus replication; null mutation confers sensitivity to tunicamycin and DTT 0.6811 0.0002
FPR3 YML074C Nucleolar peptidyl‐prolyl cis‐trans isomerase (PPIase); FK506 binding protein; phosphorylated by casein kinase II (Cka1p‐Cka2p‐Ckb1p‐
Ckb2p) and dephosphorylated by Ptp1p 0.6804 0.0002
DBF4 YDR052C Regulatory subunit of Cdc7p‐Dbf4p kinase complex, required for Cdc7p kinase activity and initiation of DNA replication; phosphorylates the Mcm2‐7 family of proteins; cell cycle regulated 0.6798 0.0006
DSK2 YMR276W Nuclear‐enriched ubiquitin‐like polyubiquitin‐binding protein, required for spindle pole body (SPB) duplication and for transit through the G2/M phase of the cell cycle, involved in proteolysis, interacts with the proteasome 0.6792 0.0009
TAF12 YDR145W Subunit (61/68 kDa) of TFIID and SAGA complexes, involved in RNA polymerase II transcription initiation and in chromatin modification, similar to histone H2A 0.6775 0.0005
ACK1 YDL203C Protein that functions upstream of Pkc1p in the cell wall integrity pathway; GFP‐fusion protein expression is induced in response to the DNA‐damaging agent MMS; non‐tagged Ack1p is detected in purified mitochondria 0.6768 0.0003
NA TRX3 YGR121W‐A YCR083W Putative protein of unknown function
Mitochondrial thioredoxin, highly conserved oxidoreductase required to maintain the redox homeostasis of the cell, forms the mitochondrial thioredoxin system with Trr2p, redox state is maintained by both Trr2p and Glr1p 0.6766 0.6736 0.0010
0.0003
MNN10 YDR245W Subunit of a Golgi mannosyltransferase complex also containing Anp1p, Mnn9p, Mnn11p, and Hoc1p that mediates elongation of the polysaccharide mannan backbone; membrane protein of the mannosyltransferase family 0.6725 0.0002
PCL7 YIL050W Pho85p cyclin of the Pho80p subfamily, forms a functional kinase complex with Pho85p which phosphorylates Mmr1p and is regulated by Pho81p; involved in glycogen metabolism, expression is cell‐cycle regulated 0.6708 0.0005
TPM1 YNL079C Major isoform of tropomyosin; binds to and stabilizes actin cables and filaments, which direct polarized cell growth and the distribution of several organelles; acetylated by the NatB complex and acetylated form binds actin most efficiently 0.6704 0.0005
TRM3 YDL112W 2'‐O‐ribose methyltransferase, catalyzes the ribose methylation of the guanosine nucleotide at position 18 of tRNAs 0.6703 0.0005
Symbols ORF Description PGA2 YNL149C YSP2 245
log2(mtr1
0.Ts/WT.T
s) adj.p.val Essential subunit of the Dam1 complex (aka DASH complex), couples kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; is transferred to the kinetochore prior to mitosis 0.6701 0.0003
YCR071C YLR246W Mitochondrial ribosomal protein of the large subunit
Subunit of a palmitoyltransferase, composed of Erf2p and Shr5p, that adds a palmitoyl lipid moiety to heterolipidated substrates such as Ras1p and Ras2p through a thioester linkage; mutants partially mislocalize Ras2p to the vacuole 0.6699 0.6696 0.0006
0.0002
NTG2 YOL043C DNA N‐glycosylase and apurinic/apyrimidinic (AP) lyase involved in base excision repair, localizes to the nucleus; sumoylated 0.6687 0.0002
NA YLR460C 0.6678 0.0008
PEX5 YDR244W Member of the quinone oxidoreductase family, up‐regulated in response to the fungicide mancozeb; possibly up‐regulated by iodine Peroxisomal membrane signal receptor for the C‐terminal tripeptide signal sequence (PTS1) of peroxisomal matrix proteins, required for peroxisomal matrix protein import; also proposed to have PTS1‐
receptor independent functions 0.6657 0.0005
PKR1 YMR123W V‐ATPase assembly factor, functions with other V‐ATPase assembly factors in the ER to efficiently assemble the V‐ATPase membrane sector (V0) 0.6642 0.0006
RAV2 YDR202C 0.6642 0.0003
NA TMA64 NA YDR117C Subunit of RAVE (Rav1p, Rav2p, Skp1p), a complex that associates with the V1 domain of the vacuolar membrane (H+)‐ATPase (V‐
ATPase) and promotes assembly and reassembly of the holoenzyme NA Protein of unknown function that associates with ribosomes; has a putative RNA binding domain; in mammals the corresponding protein, eIF2D, has been shown to possess translation initiation factor activity 0.6639 0.6615 0.0007
0.0003
MRPL35 SPO13 YDR322W YHR014W Mitochondrial ribosomal protein of the large subunit
Meiosis‐specific protein, involved in maintaining sister chromatid cohesion during meiosis I as well as promoting proper attachment of kinetochores to the spindle during meiosis I and meiosis II 0.6590 0.6582 0.0006
0.0009
NUP2 YLR335W Nucleoporin involved in nucleocytoplasmic transport, binds to either the nucleoplasmic or cytoplasmic faces of the nuclear pore complex depending on Ran‐GTP levels; also has a role in chromatin organization 0.6577 0.0006
PTR3 YFR029W Component of the SPS plasma membrane amino acid sensor system (Ssy1p‐Ptr3p‐Ssy5p), which senses external amino acid concentration and transmits intracellular signals that result in regulation of expression of amino acid permease genes 0.6571 0.0002
PRP11 YDL043C 0.6559 0.0005
NOP10 YHR072W‐A Subunit of the SF3a splicing factor complex, required for spliceosome assembly Constituent of small nucleolar ribonucleoprotein particles containing H/ACA‐type snoRNAs, which are required for pseudouridylation and processing of pre‐18S rRNA 0.6540 0.0007
SSY1 YDR160W Component of the SPS plasma membrane amino acid sensor system (Ssy1p‐Ptr3p‐Ssy5p), which senses external amino acid concentration and transmits intracellular signals that result in regulation of expression of amino acid permease genes 0.6535 0.0006
Symbols ORF Description DAD3 YBR233W‐A IMG2 ERF2 246
log2(mtr1
0.Ts/WT.T
s) adj.p.val Rab family GTPase, involved in the ER‐to‐Golgi step of the secretory pathway; complex formation with the Rab escort protein Mrs6p is required for prenylation of Ypt1p by protein geranylgeranyltransferase type II (Bet2p‐Bet4p) 0.6532 0.0002
YGL061C Essential subunit of the Dam1 complex (aka DASH complex), couples kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; is transferred to the kinetochore prior to mitosis 0.6529 0.0003
SNA3 YJL151C Integral membrane protein localized to vacuolar intralumenal vesicles, computational analysis of large‐scale protein‐protein interaction data suggests a possible role in either cell wall synthesis or protein‐vacuolar targeting 0.6519 0.0002
FUN19 YAL034C 0.6513 0.0002
ECM18 BRE2 YDR125C YLR015W Non‐essential protein of unknown function; expression induced in response to heat stress Protein of unknown function, similar to Rlp24p
Subunit of COMPASS (Set1C) complex, which methylates Lys4 of histone H3 and functions in silencing at telomeres; has a C‐terminal Sdc1 Dpy‐30 Interaction (SDI) domain that mediates binding to Sdc1p; similar to trithorax‐group protein ASH2L 0.6510 0.6506 0.0003
0.0007
UBC5 YDR059C Ubiquitin‐conjugating enzyme that mediates selective degradation of short‐lived, abnormal, or excess proteins, including histone H3; central component of the cellular stress response; expression is heat inducible 0.6492 0.0008
SLD2 YKL108W Protein required for DNA replication, phosphorylated in S phase by S‐phase cyclin‐dependent kinases (Cdks), phosphorylation is essential for DNA replication and for complex formation with Dpb11p; potential Cdc28p substrate 0.6456 0.0005
CDC48 YDL126C ATPase involved in ubiquitin‐mediated protein degradation; Cdc48p‐Npl4p‐Ufd1p complex participates in ER‐associated degradation (ERAD) while Cdc48p‐Npl4p‐Vms1p complex participates in mitochondria‐associated degradation (MAD) 0.6447 0.0004
NA YCR076C 0.6415 0.0006
CHO1 YER026C Putative protein of unknown function; YCR076C is not an essential gene Phosphatidylserine synthase, functions in phospholipid biosynthesis; catalyzes the reaction CDP‐diaclyglycerol + L‐serine = CMP + L‐1‐
phosphatidylserine, transcriptionally repressed by myo‐inositol and choline 0.6403 0.0002
CSR1 YLR380W Phosphatidylinositol transfer protein with a potential role in regulating lipid and fatty acid metabolism under heme‐depleted conditions; interacts specifically with thioredoxin peroxidase; may have a role in oxidative stress resistance 0.6401 0.0004
SLC1 YDL052C 1‐acyl‐sn‐glycerol‐3‐phosphate acyltransferase, catalyzes the acylation of lysophosphatidic acid to form phosphatidic acid, a key intermediate in lipid metabolism; enzymatic activity detected in lipid particles and microsomes 0.6386 0.0004
CKS1 YBR135W Cyclin‐dependent protein kinase regulatory subunit and adaptor; modulates proteolysis of M‐phase targets through interactions with the proteasome; role in transcriptional regulation, recruiting proteasomal subunits to target gene promoters 0.6365 0.0005
SIZ1 YDR409W SUMO/Smt3 ligase that promotes the attachment of sumo (Smt3p; small ubiquitin‐related modifier) to proteins; binds Ubc9p and may bind septins; specifically required for sumoylation of septins in vivo; localized to the septin ring 0.6361 0.0002
Symbols ORF Description YPT1 YFL038C DUO1 247
log2(mtr1
0.Ts/WT.T
s) adj.p.val E3 ubiquitin ligase of the hect‐domain class; has a role in mRNA export from the nucleus and may regulate transcriptional coactivators; involved in degradation of excess histones 0.6355 0.0004
Phospholipid hydroperoxide glutathione peroxidase induced by glucose starvation that protects cells from phospholipid hydroperoxides and nonphospholipid peroxides during oxidative stress Dethiobiotin synthetase, catalyzes the third step in the biotin biosynthesis pathway; BIO4 is in a cluster of 3 genes (BIO3, BIO4, and BIO5) that mediate biotin synthesis; expression appears to be repressed at low iron levels 0.6329 0.0004
0.6329 0.0006
Mevalonate pyrophosphate decarboxylase, essential enzyme involved in the biosynthesis of isoprenoids and sterols, including ergosterol; acts as a homodimer 0.6312 0.0003
YDR391C Putative protein of unknown function, possibly involved in zinc homeostasis; Bdf1p‐dependent transcription induced by salt stress; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus 0.6311 0.0003
TRR1 YDR353W Cytoplasmic thioredoxin reductase, key regulatory enzyme that determines the redox state of the thioredoxin system, which acts as a disulfide reductase system and protects cells against both oxidative and reductive stress 0.6296 0.0003
HHO1 YPL127C Histone H1, a linker histone required for nucleosome packaging at restricted sites; suppresses DNA repair involving homologous recombination; not required for telomeric silencing, basal transcriptional repression, or efficient sporulation 0.6288 0.0005
IGO1 YNL157W Protein required for initiation of G0 program; prevents degradation of nutrient‐regulated mRNAs via the 5'‐3' mRNA decay pathway; phosphorylated by Rim15p; GFP protein localizes to the cytoplasm and nucleus; similar to Igo2p 0.6280 0.0004
MSS4 YDR208W Phosphatidylinositol‐4‐phosphate 5‐kinase, involved in actin cytoskeleton organization and cell morphogenesis; multicopy suppressor of stt4 mutation 0.6275 0.0006
NTR2 YKR022C Essential protein that forms a dimer with Ntr1p; also forms a trimer, with Ntr2p and the DExD/H‐box RNA helicase Prp43p, that is involved in spliceosome disassembly 0.6274 0.0003
GUK1 YDR454C Guanylate kinase, converts GMP to GDP; required for growth and mannose outer chain elongation of cell wall N‐linked glycoproteins 0.6263 0.0006
NA YDL119C Putative mitochondrial transport protein; GFP‐fusion protein is induced in response to the DNA‐damaging agent MMS; the authentic, non‐tagged protein is detected in purified mitochondria 0.6262 0.0003
RMP1 YLR145W Subunit of RNase MRP, which processes pre‐rRNA and has a role in cell cycle‐regulated degradation of daughter cell‐specific mRNAs; unlike most subunits, not shared between RNase MRP and nuclear RNase P 0.6259 0.0010
RPC17 YJL011C RNA polymerase III subunit C17; physically interacts with C31, C11, and TFIIIB70; may be involved in the recruitment of pol III by the preinitiation complex 0.6258 0.0010
Symbols ORF Description TOM1 YDR457W GPX2 YBR244W BIO4 YNR057C MVD1 YNR043W NA 248
log2(mtr1
0.Ts/WT.T
s) adj.p.val Spindle pole body (SPB) component, required for the insertion of the duplication plaque into the nuclear membrane during SPB duplication; essential for bipolar spindle formation; component of the Mps2p‐Bbp1p complex 0.6249 0.0003
YLR165C Pseudouridine synthase, catalyzes only the formation of pseudouridine (Psi)‐2819 in mitochondrial 21S rRNA; not essential for viability 0.6229 0.0006
TOS6 YNL300W Glycosylphosphatidylinositol‐dependent cell wall protein, expression is periodic and decreases in respone to ergosterol perturbation or upon entry into stationary phase; depletion increases resistance to lactic acid 0.6224 0.0003
ITR1 YDR497C Myo‐inositol transporter with strong similarity to the minor myo‐
inositol transporter Itr2p, member of the sugar transporter superfamily; expression is repressed by inositol and choline via Opi1p and derepressed via Ino2p and Ino4p 0.6222 0.0002
PAN5 YHR063C 0.6221 0.0008
SPP2 YOR148C 2‐dehydropantoate 2‐reductase, part of the pantothenic acid pathway, structurally homologous to E. coli panE Essential protein that promotes the first step of splicing and is required for the final stages of spliceosome maturation; interacts with Prp2p, which may release Spp2p from the spliceosome following the first cleavage reaction 0.6206 0.0008
DAL3 YIR032C Ureidoglycolate hydrolase, converts ureidoglycolate to glyoxylate and urea in the third step of allantoin degradation; expression sensitive to nitrogen catabolite repression 0.6199 0.0009
ERG25 YGR060W C‐4 methyl sterol oxidase, catalyzes the first of three steps required to remove two C‐4 methyl groups from an intermediate in ergosterol biosynthesis; mutants accumulate the sterol intermediate 4,4‐dimethylzymosterol 0.6199 0.0007
RDS3 YPR094W Component of the SF3b subcomplex of the U2 snRNP, zinc cluster protein involved in pre‐mRNA splicing and cycloheximide resistance 0.6197 0.0010
MLC2 YPR188C Regulatory light chain for the type II myosin, Myo1p; binds to an IQ motif of Myo1p, localization to the bud neck depends on Myo1p; involved in the disassembly of the Myo1p ring 0.6186 0.0005
CCS1 YMR038C Copper chaperone for superoxide dismutase Sod1p, involved in oxidative stress protection; Met‐X‐Cys‐X2‐Cys motif within the N‐
terminal portion is involved in insertion of copper into Sod1p under conditions of copper deprivation 0.6173 0.0003
PEX22 YAL055W Putative peroxisomal membrane protein required for import of peroxisomal proteins, functionally complements a Pichia pastoris pex22 mutation 0.6138 0.0009
NA YGL041C‐B 0.6133 0.0009
NA YAL044W‐A 0.6123 0.0003
CCT6 YDR188W Putative protein of unknown function; identified by fungal homology and RT‐PCR Putative protein of unknown function; similar to S. pombe uvi31 which is a putative DNA repair protein Subunit of the cytosolic chaperonin Cct ring complex, related to Tcp1p, essential protein that is required for the assembly of actin and tubulins in vivo; contains an ATP‐binding motif 0.6099 0.0002
MDJ1 YFL016C Co‐chaperone that stimulates the ATPase activity of the HSP70 protein Ssc1p; involved in protein folding/refolding in the mitochodrial matrix; required for proteolysis of misfolded proteins; member of the HSP40 (DnaJ) family of chaperones 0.6067 0.0003
Symbols ORF Description NBP1 YLR457C PUS5 249
log2(mtr1
0.Ts/WT.T
s) adj.p.val Protein that interacts physically and genetically with Tap42p, which regulates protein phosphatase 2A; component of the TOR (target of rapamycin) signaling pathway 0.6055 0.0004
YOR281C Essential protein that interacts with the CCT (chaperonin containing TCP‐1) complex to stimulate actin folding; has similarity to phosducins; null mutant lethality is complemented by mouse phosducin‐like protein MgcPhLP 0.6055 0.0005
RGT2 YDL138W Plasma membrane high glucose sensor that regulates glucose transport; contains 12 predicted transmembrane segments and a long C‐terminal tail required for induction of hexose transporters; highly similar to Snf3p 0.6055 0.0004
ATP5 YDR298C Subunit 5 of the stator stalk of mitochondrial F1F0 ATP synthase, which is an evolutionarily conserved enzyme complex required for ATP synthesis; homologous to bovine subunit OSCP (oligomycin sensitivity‐conferring protein); phosphorylated 0.6031 0.0007
NUP53 YMR153W Subunit of the nuclear pore complex (NPC), interacts with karyopherin Kap121p or with Nup170p via overlapping regions of Nup53p, involved in activation of the spindle checkpoint mediated by the Mad1p‐Mad2p complex 0.6016 0.0010
REG1 YDR028C Regulatory subunit of type 1 protein phosphatase Glc7p, involved in negative regulation of glucose‐repressible genes 0.6004 0.0007
RSM10 YDR041W Mitochondrial ribosomal protein of the small subunit, has similarity to E. coli S10 ribosomal protein; essential for viability, unlike most other mitoribosomal proteins 0.6004 0.0006
Symbols ORF Description TIP41 YPR040W PLP2 250
APPENDIX K: Summary tables of functional
catalogue analysis for affected transcripts in
msn5Δ cells in fed or amino acid starvation
conditions
This section includes four summary results of functional catalogue (FunCat) analysis of
transcriptionally differentially expressed genes (cutoff conditions: log2 FC
FC
0.6 or log2
0.6 and adjusted p-value < 0.05) in msn5Δ cells in fed or amino acid starvation
conditions. The FunCat analysis was executed in the website: http://mips.helmholtzmuenchen.de/proj/funcatDB/ (Ruepp et al., 2004)
Table K. 1. FunCat analysis of down-regulated transcripts in msn5Δ cells in fed
condition.
FUNCTIONAL CATALOGUE phospholipid metabolism mitotic cell cycle RNA synthesis mRNA synthesis transcriptional control transcription activation
transcription repression
REGULATION OF METABOLISM AND PROTEIN FUNCTION
regulation of protein activity enzymatic activity regulation / enzyme regulator
CELLULAR COMMUNICATION/SIGNAL TRANSDUCTION MECHANISM
G‐protein mediated signal transduction
small GTPase mediated signal transduction
251
numbers
of gene
matches
4 7 20 20 20 3 3 10 9 8 9 5 4 p-value
0.04032
0.037809
0.016061
0.005821
0.000976
0.045394
0.015685
0.022164
0.040119
0.021278
0.034185
0.009891
0.024253
continued
Table. K. 1. continued
FUNCTIONAL CATALOGUE transmembrane signal transduction
non‐enzymatic receptor mediated signalling
G‐protein coupled receptor signalling pathway
catalase reaction INTERACTION WITH THE ENVIRONMENT
cellular sensing and response to external stimulus
chemoperception and response
pheromone response, mating‐type determination, sex‐specific proteins CELL FATE cell growth / morphogenesis growth regulators / regulation of cell size
DEVELOPMENT (Systemic) fungal/microorganismic development
mating (fertilization) cytoskeleton/structural proteins
centrosome CELL TYPE DIFFERENTIATION fungal/microorganismic cell type differentiation
fungal and other eukaryotic cell type differentiation
budding, cell polarity and filament formation
hyphae formation UNCLASSIFIED PROTEINS numbers
of gene
matches
5 2 2 1 25 22 20 0.001254
0.007125
0.007125
0.037812
1.39E‐06
1.27E‐08
1.86E‐08
16 11 11 3 11 11 11 9 1 19 19 19 14 1 18 4.63E‐07 0.014673
0.005503
0.001315
5.48E‐08
5.48E‐08
5.48E‐08
0.050802
0.037812
0.000824
0.000824
0.000824
0.002384
0.037812
0.982084
p-value
Table K. 2. Up-regulated transcripts in msn5Δ cells in fed condition.
FUNCTIONAL CATALOGUE METABOLISM assimilation of ammonia, metabolism of the glutamate group
metabolism of proline metabolism of arginine degradation of arginine
metabolism of urea cycle, creatine and polyamines
metabolism of urea (urea cycle)
nitrogen, sulfur and selenium metabolism
nitrogen metabolism catabolism of nitrogenous compounds
urea catabolism (not urea cycle)
phosphate metabolism C‐compound and carbohydrate metabolism
252
numbers
of gene
matches
64 4 2 3 3 4 3 9 3 3 1 20 34 p-value
0.000215
0.043414
0.015316
0.020528
2.25E‐05
0.00067
0.000422
0.001626
0.000723
0.000723
0.028385
0.014327
1.33E‐06
continued.
Table K. 2. continued.
FUNCTIONAL CATALOGUE sugar, glucoside, polyol and carboxylate metabolism
sugar, glucoside, polyol and carboxylate anabolism
sugar, glucoside, polyol and carboxylate catabolism
glycogen metabolism glycogen anabolism
regulation of C‐compound and carbohydrate metabolism
ENERGY glycolysis and gluconeogenesis
regulation of glycolysis and gluconeogenesis
electron transport and membrane‐associated energy conservation
respiration aerobic respiration metabolism of energy reserves (e.g. glycogen, trehalose)
lysosomal and vacuolar protein degradation
vacuolar protein degradation biotin binding transported compounds (substrates)
anion transport phosphate transport C‐compound and carbohydrate transport
20.01.03.01 sugar transport 20.01.07 amino acid/amino acid derivatives transport
20.01.15 electron transport 20.03.02 carrier (electrochemical potential‐driven transport)
20.03.02.02 symporter 20.03.02.02.01 proton driven symporter
20.03.02.02.02 sodium driven symporter
20.03.02.03 antiporter 32.01.01 oxidative stress response
32.07.07 oxygen and radical detoxification
32.07.07.05 peroxidase reaction 34.01.03.03 homeostasis of phosphate
42.25 vacuole or lysosome 99 UNCLASSIFIED PROTEINS 253
numbers
of gene
matches
9 5 8 2 2 8 31 6 3 8 11 6 10 3 2 1 28 3 3 10 5 4 8 6 3 2 1 3 5 3 2 2 5 55 p-value
0.000438
0.00283
0.00168
0.007572
0.007572
0.027488
2.74E‐08
0.006218
0.015587
0.000292
0.001774
0.021576
3.02E‐06
0.036207
0.037236
0.028385
0.003816
0.036207
0.003135
9.11E‐06
0.001188
0.037865
0.002307
6.71E‐06
8.81E‐05
0.002359
0.028385
0.006496
0.019263
0.036207
0.015316
0.025294
0.007713
0.003908
Table K. 3. FunCat analysis of down-regulated transcripts in msn5Δ cells in amino acid
starvation condition.
FUNCTIONAL CATALOGUE 10.03 cell cycle 10.03.01 mitotic cell cycle and cell cycle control 10.03.02 meiosis 10.03.02.01 meiosis I 10.03.05 cell cycle dependent cytoskeleton reorganization 10.03.05.01 spindle pole body/centrosome and microtubule cycle 18 REGULATION OF METABOLISM AND PROTEIN FUNCTION 18.02 regulation of protein activity 18.02.01 enzymatic activity regulation / enzyme regulator 18.02.05 regulator of G‐protein signalling 20.01.17 nucleotide/nucleoside/nucleobase transport 20.01.23 allantoin and allantoate transport 20.01.27 drug/toxin transport 20.03 transport facilities 20.03.25 ABC transporters 30 CELLULAR COMMUNICATION/SIGNAL TRANSDUCTION MECHANISM 30.01.05 enzyme mediated signal transduction 30.01.05.05 G‐protein mediated signal transduction 30.01.05.05.01 small GTPase mediated signal transduction 30.05 transmembrane signal transduction 30.05.02 non‐enzymatic receptor mediated signalling 30.05.02.24 G‐protein coupled receptor signalling pathway 34 INTERACTION WITH THE ENVIRONMENT 34.11 cellular sensing and response to external stimulus 34.11.03 chemoperception and response 34.11.03.07 pheromone response, mating‐type determination, sex‐specific proteins 41 DEVELOPMENT (Systemic) 41.01 fungal/microorganismic development 41.01.01 mating (fertilization) 42.04.05 microtubule cytoskeleton 43 CELL TYPE DIFFERENTIATION 43.01 fungal/microorganismic cell type differentiation 43.01.03 fungal and other eukaryotic cell type differentiation 43.01.03.05 budding, cell polarity and filament formation 43.01.03.09 development of asco‐ basidio‐ or zygospore 99 UNCLASSIFIED PROTEINS 254
numbers
of gene
matches
43 28 13 3 6 6 19 16 13 3 4 3 6 17 7 19 11 7 6 10 3 3 40 35 33 0.001358 0.018237 0.016221 0.014924 0.015233 0.007273 0.008736 0.042612 0.036475 0.022331 0.008366 0.00341 0.005018 0.003107 0.000111 0.003804 0.022151 0.023786 0.032409 7.40E‐06 0.002199 0.002199 5.59E‐06 4.22E‐09 7.20E‐10 30 18 18 18 7 43 43 43 26 17 50 1.30E‐10 1.97E‐10 1.97E‐10 1.97E‐10 0.002998 1.64E‐07 1.64E‐07 1.64E‐07 0.00052 0.00053 0.902999 p-value
Table K. 4. FunCat analysis of up-regulated transcripts in msn5Δ cells in amino acid
starvation condition.
FUNCTIONAL CATALOGUE degradation of arginine degradation of serine nitrogen metabolism catabolism of nitrogenous compounds
ENERGY electron transport and membrane‐associated energy conservation
respiration aerobic respiration protein folding and stabilization enzyme inhibitor protease inhibitor anion transport phosphate transport C‐compound and carbohydrate transport
electron transport carrier (electrochemical potential‐driven transport)
symporter CELL RESCUE, DEFENSE AND VIRULENCE
stress response oxidative stress response oxygen and radical detoxification
peroxidase reaction homeostasis of anions homeostasis of phosphate vacuole or lysosome UNCLASSIFIED PROTEINS 255
numbers
of gene
matches
2 1 2 2 23 6 12 6 8 5 2 3 3 5 6 4 2 25 23 8 4 2 3 3 7 61 p-value
0.002838
0.031158
0.018292
0.018292
0.000962
0.011323
0.001161
0.032216
0.008134
0.004229
0.009077
0.04575
0.004084
0.045681
0.044096
0.001983
0.00556
0.036729
0.012182
0.000266
0.007976
0.018292
0.010274
0.002177
0.000368
0.001865
APPENDIX L: Down-regulated genes in msn5Δ
cells in fed condition
This section includes the list of transcriptionally differentially expressed genes (cutoff
conditions: log2 FC
0.6 and adjusted p-value < 0.05) in msn5Δ cells in fed condition.
Down-regulated genes in msn5Δ cells in fed condition
log2(msn5
.Tf/WT.Tf) adj.p.
val Karyopherin involved in nuclear import and export of proteins, including import of replication protein A and export of Swi6p, Far1p, and Pho4p; required for re‐export of mature tRNAs after their retrograde import from the cytoplasm ‐7.1037 0.0000
YML058W‐A Protein involved in the Mec1p‐mediated checkpoint pathway that responds to DNA damage or replication arrest, transcription is induced by DNA damage ‐2.4244 0.0013
PRM1 YNL279W Pheromone‐regulated multispanning membrane protein involved in membrane fusion during mating; predicted to have 5 transmembrane segments and a coiled coil domain; localizes to the shmoo tip; regulated by Ste12p ‐2.2513 0.0000
FIG1 YBR040W Integral membrane protein required for efficient mating; may participate in or regulate the low affinity Ca2+ influx system, which affects intracellular signaling and cell‐cell fusion during mating ‐2.2108 0.0085
DAN1 YJR150C Cell wall mannoprotein with similarity to Tir1p, Tir2p, Tir3p, and Tir4p; expressed under anaerobic conditions, completely repressed during aerobic growth ‐2.1252 0.0041
PRM6 YML047C Pheromone‐regulated protein, predicted to have 2 transmembrane segments; regulated by Ste12p during mating ‐2.0349 0.0150
FUS1 YCL027W Membrane protein localized to the shmoo tip, required for cell fusion; expression regulated by mating pheromone; proposed to coordinate signaling, fusion, and polarization events required for fusion; potential Cdc28p substrate ‐1.7866 0.0014
WSC4 YHL028W ER membrane protein involved in the translocation of soluble secretory proteins and insertion of membrane proteins into the ER membrane; may also have a role in the stress response but has only partial functional overlap with WSC1‐3 ‐1.6054 0.0162
Symbols ORF Description MSN5 YDR335W HUG1 256
log2(msn5
.Tf/WT.Tf) adj.p.
val Nonfunctional protein with homology to IMP dehydrogenase; probable pseudogene, located close to the telomere; is not expressed at detectable levels; YAR073W and YAR075W comprise a continuous reading frame in some strains of S. cerevisiae ‐1.5849 0.0096
YDL227C Site‐specific endonuclease required for gene conversion at the MAT locus (homothallic switching) through the generation of a ds DNA break; expression restricted to mother cells in late G1 as controlled by Swi4p‐Swi6p, Swi5p and Ash1p ‐1.5549 0.0032
AGA1 YNR044W ‐1.5162 0.0013
MF(ALPHA
)2 YGL089C Anchorage subunit of a‐agglutinin of a‐cells, highly O‐glycosylated protein with N‐terminal secretion signal and C‐terminal signal for addition of GPI anchor to cell wall, linked to adhesion subunit Aga2p via two disulfide bonds Mating pheromone alpha‐factor, made by alpha cells; interacts with mating type a cells to induce cell cycle arrest and other responses leading to mating; also encoded by MF(ALPHA)1, which is more highly expressed than MF(ALPHA)2 ‐1.4937 0.0045
NA TIR1 YAR066W YER011W Putative GPI protein
Cell wall mannoprotein of the Srp1p/Tip1p family of serine‐alanine‐
rich proteins; expression is downregulated at acidic pH and induced by cold shock and anaerobiosis; abundance is increased in cells cultured without shaking ‐1.4805 ‐1.4492 0.0017
0.0015
NA YIL082W‐A Retrotransposon TYA Gag and TYB Pol genes; transcribed/translated as one unit; polyprotein is processed to make a nucleocapsid‐like protein (Gag), reverse transcriptase (RT), protease (PR), and integrase (IN); similar to retroviral genes ‐1.3888 0.0005
NA YDR222W ‐1.3702 0.0276
PLB2 YMR006C Protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern Phospholipase B (lysophospholipase) involved in phospholipid metabolism; displays transacylase activity in vitro; overproduction confers resistance to lysophosphatidylcholine ‐1.3209 0.0026
NA YLR042C ‐1.3205 0.0015
STR3 YGL184C ‐1.3066 0.0341
SRO77 YBL106C ‐1.2967 0.0219
PPM2 YOL141W AdoMet‐dependent tRNA methyltransferase also involved in methoxycarbonylation; required for the synthesis of wybutosine (yW), a modified guanosine found at the 3'‐position adjacent to the anticodon of phe‐tRNA; similarity to Ppm1p ‐1.2951 0.0029
PRM2 YIL037C Pheromone‐regulated protein, predicted to have 4 transmembrane segments and a coiled coil domain; regulated by Ste12p; required for efficient nuclear fusion ‐1.2774 0.0231
SST2 YLR452C GTPase‐activating protein for Gpa1p, regulates desensitization to alpha factor pheromone; also required to prevent receptor‐
independent signaling of the mating pathway; member of the RGS (regulator of G‐protein signaling) family ‐1.1922 0.0015
SFG1 YOR315W Nuclear protein, putative transcription factor required for growth of superficial pseudohyphae (which do not invade the agar substrate) but not for invasive pseudohyphal growth; may act together with Phd1p; potential Cdc28p substrate ‐1.1781 0.0159
Symbols ORF Description IMD1 YAR073W HO Protein of unknown function; localizes to the cytoplasm; YLL042C is not an essential gene Peroxisomal cystathionine beta‐lyase, converts cystathionine into homocysteine; may be redox regulated by Gto1p Protein with roles in exocytosis and cation homeostasis; functions in docking and fusion of post‐Golgi vesicles with plasma membrane; homolog of Sro7p and Drosophila lethal giant larvae tumor suppressor; interacts with SNARE protein Sec9p 257
log2(msn5
.Tf/WT.Tf) adj.p.
val Inosine monophosphate dehydrogenase, catalyzes the rate‐limiting step in GTP biosynthesis, expression is induced by mycophenolic acid resulting in resistance to the drug, expression is repressed by nutrient limitatio ‐1.1711 0.0031
YJR004C Alpha‐agglutinin of alpha‐cells, binds to Aga1p during agglutination, N‐
terminal half is homologous to the immunoglobulin superfamily and contains binding site for a‐agglutinin, C‐terminal half is highly glycosylated and contains GPI anchor ‐1.1666 0.0009
CRR1 YLR213C Putative glycoside hydrolase of the spore wall envelope; required for normal spore wall assembly, possibly for cross‐linking between the glucan and chitosan layers; expressed during sporulation ‐1.1315 0.0171
RIM9 YMR063W Protein of unknown function, involved in the proteolytic activation of Rim101p in response to alkaline pH; has similarity to A. nidulans PalI; putative membrane protein ‐1.1261 0.0253
NA YCR101C ‐1.1227 0.0171
PCL1 YNL289W Putative protein of unknown function; localizes to the membrane fraction; YCR101C is not an essential gene Cyclin, interacts with cyclin‐dependent kinase Pho85p; member of the Pcl1,2‐like subfamily, involved in the regulation of polarized growth and morphogenesis and progression through the cell cycle; localizes to sites of polarized cell growth ‐1.1030 0.0109
NA YHL018W Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to mitochondria and is induced in response to the DNA‐damaging agent MMS ‐1.0830 0.0191
SVS1 YPL163C ‐1.0814 0.0113
SPS1 YDR523C Cell wall and vacuolar protein, required for wild‐type resistance to vanadate Putative protein serine/threonine kinase expressed at the end of meiosis and localized to the prospore membrane, required for correct localization of enzymes involved in spore wall synthesis ‐1.0764 0.0392
CLN1 YMR199W G1 cyclin involved in regulation of the cell cycle; activates Cdc28p kinase to promote the G1 to S phase transition; late G1 specific expression depends on transcription factor complexes, MBF (Swi6p‐
Mbp1p) and SBF (Swi6p‐Swi4p) ‐1.0744 0.0017
CLB2 YPR119W B‐type cyclin involved in cell cycle progression; activates Cdc28p to promote the transition from G2 to M phase; accumulates during G2 and M, then targeted via a destruction box motif for ubiquitin‐
mediated degradation by the proteasome ‐1.0713 0.0109
RPI1 YIL119C Putative transcriptional regulator; overexpression suppresses the heat shock sensitivity of wild‐type RAS2 overexpression and also suppresses the cell lysis defect of an mpk1 mutation ‐1.0693 0.0489
SPC24 YMR117C Component of the evolutionarily conserved kinetochore‐associated Ndc80 complex (Ndc80p‐Nuf2p‐Spc24p‐Spc25p); involved in chromosome segregation, spindle checkpoint activity and kinetochore clustering ‐1.0451 0.0139
YHP1 YDR451C One of two homeobox transcriptional repressors (see also Yox1p), that bind to Mcm1p and to early cell cycle box (ECB) elements of cell cycle regulated genes, thereby restricting ECB‐mediated transcription to the M/G1 interval ‐1.0427 0.0077
FAR1 YJL157C Cyclin‐dependent kinase inhibitor that mediates cell cycle arrest in response to pheromone; also forms a complex with Cdc24p, Ste4p, and Ste18p that may specify the direction of polarized growth during mating; potential Cdc28p substrate ‐1.0374 0.0013
Symbols ORF Description IMD2 YHR216W SAG1 258
log2(msn5
.Tf/WT.Tf) adj.p.
val Protein of unknown function; green fluorescent protein (GFP)‐ fusion protein localizes to the mother side of the bud neck and the vacuole; YOL007C is not an essential gene ‐1.0200 0.0026
YOR237W Protein implicated in the regulation of ergosterol biosynthesis; one of a seven member gene family with a common essential function and non‐essential unique functions; similar to human oxysterol binding protein (OSBP) ‐1.0063 0.0054
GPI19 YDR437W Subunit of GPI‐GlcNAc transferase involved in synthesis of N‐
acetylglucosaminyl phosphatidylinositol (GlcNAc‐PI), which is the first intermediate in glycosylphosphatidylinositol (GPI) anchor synthesis, shares similarity with mammalian PIG‐P ‐0.9955 0.0034
PDR15 YDR406W Plasma membrane ATP binding cassette (ABC) transporter, multidrug transporter and general stress response factor implicated in cellular detoxification; regulated by Pdr1p, Pdr3p and Pdr8p; promoter contains a PDR responsive element ‐0.9730 0.0026
NRM1 YNR009W Transcriptional co‐repressor of MBF (MCB binding factor)‐regulated gene expression; Nrm1p associates stably with promoters via MBF to repress transcription upon exit from G1 phase ‐0.9644 0.0032
RTC4 YNL254C Protein of unknown function; null mutation suppresses cdc13‐1 temperature sensitivity; (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus ‐0.9440 0.0029
STE3 YKL178C Receptor for a factor pheromone, couples to MAP kinase cascade to mediate pheromone response; transcribed in alpha cells and required for mating by alpha cells, ligand bound receptors endocytosed and recycled to the plasma membrane; GPCR ‐0.9394 0.0013
AQY1 YPR192W Spore‐specific water channel that mediates the transport of water across cell membranes, developmentally controlled; may play a role in spore maturation, probably by allowing water outflow, may be involved in freeze tolerance ‐0.9382 0.0116
NA YGR035C ‐0.9278 0.0130
FRE8 YLR047C Putative protein of unknown function, potential Cdc28p substrate; transcription is activated by paralogous transcription factors Yrm1p and Yrr1p along with genes involved in multidrug resistance Protein with sequence similarity to iron/copper reductases, involved in iron homeostasis; deletion mutant has iron deficiency/accumulation growth defects; expression increased in the absence of copper‐
responsive transcription factor Mac1p ‐0.9271 0.0091
NA YGR109W‐B Retrotransposon TYA Gag and TYB Pol genes; transcribed/translated as one unit; polyprotein is processed to make a nucleocapsid‐like protein (Gag), reverse transcriptase (RT), protease (PR), and integrase (IN); similar to retroviral genes ‐0.9258 0.0034
PET122 YER153C Mitochondrial translational activator specific for the COX3 mRNA, acts together with Pet54p and Pet494p; located in the mitochondrial inner membrane ‐0.9248 0.0159
NA YAR068W ‐0.9239 0.0221
LRG1 YDL240W ‐0.9226 0.0023
FMP45 YDL222C Fungal‐specific protein of unknown function; induced in respiratory‐
deficient cells Putative GTPase‐activating protein (GAP) involved in the Pkc1p‐
mediated signaling pathway that controls cell wall integrity; appears to specifically regulate 1,3‐beta‐glucan synthesis Integral membrane protein localized to mitochondria (untagged protein); required for sporulation and maintaining sphingolipid content; has sequence similarity to SUR7 and YNL194C ‐0.9193 0.0109
Symbols ORF Description CSI2 YOL007C HES1 259
log2(msn5
.Tf/WT.Tf) adj.p.
val v‐SNARE binding protein that facilitates specific protein retrieval from a late endosome to the Golgi; modulates arginine uptake, possible role in mediating pH homeostasis between the vacuole and plasma membrane H(+)‐ATPase ‐0.9012 0.0050
YGL175C Endonuclease that processes hairpin DNA structures with the MRX complex; involved in meiotic and mitotic double‐strand break repair; phosphorylated in response to DNA damage and required for normal resistance to DNA‐damaging agents ‐0.8847 0.0096
YOX1 YML027W Homeodomain‐containing transcriptional repressor, binds to Mcm1p and to early cell cycle boxes (ECBs) in the promoters of cell cycle‐
regulated genes expressed in M/G1 phase; expression is cell cycle‐
regulated; potential Cdc28p substrate ‐0.8839 0.0355
CLN2 YPL256C G1 cyclin involved in regulation of the cell cycle; activates Cdc28p kinase to promote the G1 to S phase transition; late G1 specific expression depends on transcription factor complexes, MBF (Swi6p‐
Mbp1p) and SBF (Swi6p‐Swi4p) ‐0.8757 0.0068
NA NA PTH1 NA NA YHR189W NA NA One of two (see also PTH2) mitochondrially‐localized peptidyl‐tRNA hydrolases; dispensable for respiratory growth on rich medium, but required for respiratory growth on minimal medium ‐0.8703 ‐0.8682 ‐0.8578 0.0148
0.0170
0.0495
CLB6 YGR109C B‐type cyclin involved in DNA replication during S phase; activates Cdc28p to promote initiation of DNA synthesis; functions in formation of mitotic spindles along with Clb3p and Clb4p; most abundant during late G1 ‐0.8495 0.0144
NA YDR124W ‐0.8480 0.0187
GIC1 YHR061C Putative protein of unknown function; non‐essential gene; expression is strongly induced by alpha factor Protein of unknown function involved in initiation of budding and cellular polarization, interacts with Cdc42p via the Cdc42/Rac‐
interactive binding (CRIB) domain ‐0.8437 0.0183
OPT1 YJL212C Proton‐coupled oligopeptide transporter of the plasma membrane; also transports glutathione and phytochelatin; member of the OPT family ‐0.8396 0.0456
SFK1 YKL051W Plasma membrane protein that may act together with or upstream of Stt4p to generate normal levels of the essential phospholipid PI4P, at least partially mediates proper localization of Stt4p to the plasma membrane ‐0.8301 0.0308
PLM2 YDR501W Forkhead Associated domain containing protein and putative transcription factor found associated with chromatin; target of SBF transcription factor; induced in response to DNA damaging agents and deletion of telomerase; similar to TOS4 ‐0.8251 0.0057
DCI1 YOR180C ‐0.8201 0.0242
CIN8 YEL061C ‐0.8094 0.0143
YJU2 YKL095W ‐0.7977 0.0162
PMA2 YPL036W Peroxisomal protein; identification as a delta(3,5)‐delta(2,4)‐dienoyl‐
CoA isomerase involved in fatty acid metabolism is disputed Kinesin motor protein involved in mitotic spindle assembly and chromosome segregation Essential protein required for pre‐mRNA splicing; associates transiently with the spliceosomal NTC ("nineteen complex") and acts after Prp2p to promote the first catalytic reaction of splicing Plasma membrane H+‐ATPase, isoform of Pma1p, involved in pumping protons out of the cell; regulator of cytoplasmic pH and plasma membrane potential ‐0.7944 0.0221
DED1 YOR204W ‐0.7753 0.0126
Symbols ORF Description BTN2 YGR142W SAE2 ATP‐dependent DEAD (Asp‐Glu‐Ala‐Asp)‐box RNA helicase, required for translation initiation of all yeast mRNAs; mutations in human DEAD‐box DBY are a frequent cause of male infertility 260
log2(msn5
.Tf/WT.Tf) adj.p.
val Putative lipase; involved in lipid metabolism; YDL109C is not an essential gene Putative protein of unknown function
Subunit of the conserved chromosomal passenger complex (CPC; Ipl1p‐Sli15p‐Bir1p‐Nbl1p), which regulates mitotic chromosome segregation; not required for the kinase activity of the complex; mediates the interaction of Sli15p and Bir1p ‐0.7744 0.0057
‐0.7739 ‐0.7731 0.0141
0.0206
YHR084W Transcription factor that is activated by a MAP kinase signaling cascade, activates genes involved in mating or pseudohyphal/invasive growth pathways; cooperates with Tec1p transcription factor to regulate genes specific for invasive growth ‐0.7682 0.0054
SFL1 YOR140W Transcriptional repressor and activator; involved in repression of flocculation‐related genes, and activation of stress responsive genes; negatively regulated by cAMP‐dependent protein kinase A subunit Tpk2p ‐0.7648 0.0144
NRT1 YOR071C ‐0.7616 0.0191
RTG1 YOL067C ‐0.7588 0.0122
GEM1 YAL048C High‐affinity nicotinamide riboside transporter; also transports thiamine with low affinity; shares sequence similarity with Thi7p and Thi72p; proposed to be involved in 5‐fluorocytosine sensitivity Transcription factor (bHLH) involved in interorganelle communication between mitochondria, peroxisomes, and nucleus Evolutionarily‐conserved tail‐anchored outer mitochondrial membrane GTPase which regulates mitochondrial morphology; cells lacking Gem1p contain collapsed, globular, or grape‐like mitochondria; not required for pheromone‐induced cell death ‐0.7553 0.0175
CTA1 YDR256C ‐0.7546 0.0186
FHL1 YPR104C Catalase A, breaks down hydrogen peroxide in the peroxisomal matrix formed by acyl‐CoA oxidase (Pox1p) during fatty acid beta‐oxidation Regulator of ribosomal protein transcription; has forkhead associated domain that binds phosphorylated proteins; also has forkhead DNA‐
binding domain but does not bind DNA in vitro; suppresses RNA pol III and splicing factor prp4 mutants ‐0.7505 0.0054
WHI5 YOR083W Repressor of G1 transcription that binds to SCB binding factor (SBF) at SCB target promoters in early G1; phosphorylation of Whi5p by the CDK, Cln3p/Cdc28p relieves repression and promoter binding by Whi5; periodically expressed in G1 ‐0.7453 0.0276
NA TOS2 YCR100C YGR221C Putative protein of unknown function
Protein involved in localization of Cdc24p to the site of bud growth; may act as a membrane anchor; localizes to the bud neck and bud tip; potentially phosphorylated by Cdc28p ‐0.7411 ‐0.7389 0.0269
0.0033
PRM3 YPL192C ‐0.7386 0.0116
YHK8 YHR048W ‐0.7354 0.0168
DFG10 NA INO2 YIL049W YNR063W YDR123C Pheromone‐regulated protein required for nuclear envelope fusion during karyogamy; localizes to the outer face of the nuclear membrane; interacts with Kar5p at the spindle pole body Presumed antiporter of the DHA1 family of multidrug resistance transporters; contains 12 predicted transmembrane spans; expression of gene is up‐regulated in cells exhibiting reduced susceptibility to azoles Protein of unknown function, involved in filamentous growth
Putative zinc‐cluster protein of unknown function
Component of the heteromeric Ino2p/Ino4p basic helix‐loop‐helix transcription activator that binds inositol/choline‐responsive elements (ICREs), required for derepression of phospholipid biosynthetic genes in response to inositol depletion ‐0.7329 ‐0.7263 ‐0.7210 0.0029
0.0316
0.0308
NA YOL014W ‐0.7177 0.0328
Symbols ORF Description NA YDL109C NA NBL1 YCL021W‐A YHR199C‐A STE12 Putative protein of unknown function
261
log2(msn5
.Tf/WT.Tf) adj.p.
val ATP‐binding cassette (ABC) transporter, multidrug transporter involved in multiple drug resistance; mediates sterol uptake when sterol biosynthesis is compromisedregulated by Pdr1p; required for anaerobic growth ‐0.7172 0.0105
YOL028C YGR055W Putative basic leucine zipper (bZIP) transcription factor
High affinity methionine permease, integral membrane protein with 13 putative membrane‐spanning regions; also involved in cysteine uptake ‐0.7075 ‐0.7045 0.0483
0.0339
FIG2 YCR089W ‐0.6983 0.0041
PHO4 YFR034C Cell wall adhesin, expressed specifically during mating; may be involved in maintenance of cell wall integrity during mating Basic helix‐loop‐helix (bHLH) transcription factor of the myc‐family; binds cooperatively with Pho2p to the PHO5 promoter; function is regulated by phosphorylation at multiple sites and by phosphate availability ‐0.6959 0.0171
RIM4 YHL024W ‐0.6924 0.0452
TKL2 YBR117C Putative RNA‐binding protein required for the expression of early and middle sporulation genes Transketolase, similar to Tkl1p; catalyzes conversion of xylulose‐5‐
phosphate and ribose‐5‐phosphate to sedoheptulose‐7‐phosphate and glyceraldehyde‐3‐phosphate in the pentose phosphate pathway; needed for synthesis of aromatic amino acids ‐0.6871 0.0044
SRB8 YCR081W Subunit of the RNA polymerase II mediator complex; associates with core polymerase subunits to form the RNA polymerase II holoenzyme; essential for transcriptional regulation; involved in glucose repression ‐0.6858 0.0072
IZH1 YDR492W Membrane protein involved in zinc ion homeostasis, member of the four‐protein IZH family; transcription is regulated directly by Zap1p, expression induced by zinc deficiency and fatty acids; deletion increases sensitivity to elevated zinc ‐0.6721 0.0241
SCW11 YGL028C ‐0.6677 0.0241
AIM20 YIL158W Cell wall protein with similarity to glucanases; may play a role in conjugation during mating based on its regulation by Ste12p Putative protein of unknown function; overexpression causes a cell cycle delay or arrest; green fluorescent protein (GFP)‐fusion protein localizes to the vacuole; null mutant displays elevated frequency of mitochondrial genome loss ‐0.6643 0.0066
WHI3 YNL197C RNA binding protein that sequesters CLN3 mRNA in cytoplasmic foci; cytoplasmic retention factor for Cdc28p and associated cyclins; regulates cell fate and dose‐dependently regulates the critical cell size required for passage through Start ‐0.6550 0.0356
TOS6 YNL300W ‐0.6550 0.0223
TEC1 YBR083W Glycosylphosphatidylinositol‐dependent cell wall protein, expression is periodic and decreases in respone to ergosterol perturbation or upon entry into stationary phase; depletion increases resistance to lactic acid Transcription factor required for full Ty1 expression, Ty1‐mediated gene activation, and haploid invasive and diploid pseudohyphal growth; TEA/ATTS DNA‐binding domain family member ‐0.6480 0.0051
JJJ2 YJL162C ‐0.6452 0.0200
MSB2 YGR014W ‐0.6385 0.0123
ATF2 YGR177C ‐0.6337 0.0266
Symbols ORF Description PDR11 YIL013C YAP7 MUP1 Protein of unknown function, contains a J‐domain, which is a region with homology to the E. coli DnaJ protein Mucin family member involved in the Cdc42p‐ and MAP kinase‐
dependent filamentous growth signaling pathway; also functions as an osmosensor in parallel to the Sho1p‐mediated pathway; potential Cdc28p substrate Alcohol acetyltransferase, may play a role in steroid detoxification; forms volatile esters during fermentation, which is important for brewing and winemaking 262
log2(msn5
.Tf/WT.Tf) adj.p.
val Transcriptional activator essential for nuclear division; localized to the nucleus; essential component of the mechanism that activates the expression of a set of late‐S‐phase‐specific genes ‐0.6298 0.0242
YDR138W Subunit of THO/TREX complexes that couple transcription elongation with mitotic recombination and with mRNA metabolism and export, subunit of an RNA Pol II complex; regulates lifespan; involved in telomere maintenance; similar to Top1p ‐0.6239 0.0036
FRK1 YPL141C Putative protein kinase; similar to Kin4p; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; interacts with rRNA transcription and ribosome biogenesis factors and the long chain fatty acyl‐CoA synthetase Faa3 ‐0.6223 0.0209
NA YLL066W‐B ‐0.6210 0.0065
SFP1 YLR403W Putative protein of unknown function; overexpression causes a cell cycle delay or arrest Transcription factor that controls expression of ribosome biogenesis genes in response to nutrients and stress, regulates G2/M transitions during mitotic cell cycle and DNA‐damage response, modulates cell size; regulated by TORC1 and Mrs6p ‐0.6205 0.0483
ADH4 YGL256W Alcohol dehydrogenase isoenzyme type IV, dimeric enzyme demonstrated to be zinc‐dependent despite sequence similarity to iron‐activated alcohol dehydrogenases; transcription is induced in response to zinc deficiency ‐0.6147 0.0108
RAX2 YLR084C N‐glycosylated protein involved in the maintenance of bud site selection during bipolar budding; localization requires Rax1p; RAX2 mRNA stability is regulated by Mpt5p ‐0.6133 0.0188
STB5 YHR178W Transcription factor, involved in regulating multidrug resistance and oxidative stress response; forms a heterodimer with Pdr1p; contains a Zn(II)2Cys6 zinc finger domain that interacts with a pleiotropic drug resistance element in vitro ‐0.6112 0.0089
KAR5 YMR065W Protein required for nuclear membrane fusion during karyogamy, localizes to the membrane with a soluble portion in the endoplasmic reticulum lumen, may form a complex with Jem1p and Kar2p; expression of the gene is regulated by pheromone ‐0.6068 0.0060
VBA2 NA YBR293W YJL107C Permease of basic amino acids in the vacuolar membrane
Putative protein of unknown function; expression is induced by activation of the HOG1 mitogen‐activated signaling pathway and this induction is Hog1p/Pbs2p dependent; YJL107C and adjacent ORF, YJL108C are merged in related fungi ‐0.6052 ‐0.6049 0.0231
0.0171
Symbols ORF Description NDD1 YOR372C HPR1 263
APPENDIX M: Up-regulated genes in msn5Δ
cells in fed condition
This section includes the list of transcriptionally differentially expressed genes (cutoff
conditions: log2 FC
0.6 and adjusted p-value < 0.05) in msn5Δ cells in fed condition.
Up-regulated genes in msn5Δ cells in fed condition
log2(msn5
.Tf/WT.Tf) adj.p.v
al High‐affinity inorganic phosphate (Pi) transporter and low‐affinity manganese transporter; regulated by Pho4p and Spt7p; mutation confers resistance to arsenate; exit from the ER during maturation requires Pho86p 6.5678 0.0000
YHR136C Protein with similarity to cyclin‐dependent kinase inhibitors; downregulates low‐affinity phosphate transport during phosphate limitation; overproduction suppresses a plc1 null mutation; GFP‐
fusion protein localizes to the cytoplasm 5.1812 0.0000
PHO89 YBR296C 2.7683 0.0065
PHO11 YAR071W Na+/Pi cotransporter, active in early growth phase; similar to phosphate transporters of Neurospora crassa; transcription regulated by inorganic phosphate concentrations and Pho4p One of three repressible acid phosphatases, a glycoprotein that is transported to the cell surface by the secretory pathway; induced by phosphate starvation and coordinately regulated by PHO4 and PHO2 2.5966 0.0026
PHM6 YDR281C 2.3875 0.0109
PHO5 YBR093C Protein of unknown function, expression is regulated by phosphate levels Repressible acid phosphatase (1 of 3) that also mediates extracellular nucleotide‐derived phosphate hydrolysis; secretory pathway derived cell surface glycoprotein; induced by phosphate starvation and coordinately regulated by PHO4 and PHO2 2.3445 0.0014
VTC3 YPL019C Subunit of the vacuolar transporter chaperone (VTC) complex involved in membrane trafficking, vacuolar polyphosphate accumulation, microautophagy and non‐autophagic vacuolar fusion 2.3172 0.0005
CYC7 YEL039C Cytochrome c isoform 2, expressed under hypoxic conditions; electron carrier of the mitochondrial intermembrane space that transfers electrons from ubiquinone‐cytochrome c oxidoreductase to cytochrome c oxidase during cellular respiration 1.8015 0.0071
NA MTH1 YLR312C YDR277C Putative protein of unknown function
Negative regulator of the glucose‐sensing signal transduction pathway, required for repression of transcription by Rgt1p; interacts with Rgt1p and the Snf3p and Rgt2p glucose sensors; phosphorylated by Yck1p, triggering Mth1p degradation 1.7179 1.6946 0.0028
0.0015
Symbols ORF Description PHO84 YML123C SPL2 264
log2(msn5
.Tf/WT.Tf) adj.p.v
al Cytochrome b2 (L‐lactate cytochrome‐c oxidoreductase), component of the mitochondrial intermembrane space, required for lactate utilization; expression is repressed by glucose and anaerobic conditions 1.5974 0.0004
YFR017C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and is induced in response to the DNA‐damaging agent MMS; YFR017C is not an essential gene 1.5519 0.0005
NA YGL262W Putative protein of unknown function; null mutant displays elevated sensitivity to expression of a mutant huntingtin fragment or of alpha‐
synuclein; YGL262W is not an essential gene 1.5464 0.0219
SOL4 NA YGR248W YHR214C‐E 6‐phosphogluconolactonase with similarity to Sol3p
Putative protein of unknown function; identified by gene‐trapping, microarray‐based expression analysis, and genome‐wide homology searching 1.5294 1.4988 0.0170
0.0110
CRC1 YOR100C Mitochondrial inner membrane carnitine transporter, required for carnitine‐dependent transport of acetyl‐CoA from peroxisomes to mitochondria during fatty acid beta‐oxidation 1.4600 0.0016
DCS2 YOR173W Non‐essential, stress induced regulatory protein; modulates m7G‐
oligoribonucleotide metabolism; inhibits Dcs1p; regulated by Msn2p, Msn4p, and the Ras‐cAMP‐cAPK signaling pathway; mutant has increased aneuploidy tolerance 1.4014 0.0026
GPM2 YDL021W Homolog of Gpm1p phosphoglycerate mutase, which converts 3‐
phosphoglycerate to 2‐phosphoglycerate in glycolysis; may be non‐
functional derivative of a gene duplication event 1.4000 0.0002
NA YMR090W Putative protein of unknown function with similarity to DTDP‐glucose 4,6‐dehydratases; GFP‐fusion protein localizes to the cytoplasm; up‐
regulated in response to the fungicide mancozeb; not essential for viability 1.3741 0.0022
NA YDR018C Probable membrane protein with three predicted transmembrane domains; homologous to Ybr042cp, similar to C. elegans F55A11.5 and maize 1‐acyl‐glycerol‐3‐phosphate acyltransferase 1.3658 0.0013
AIM17 YHL021C Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies; null mutant displays reduced frequency of mitochondrial genome loss 1.3625 0.0073
GDH3 YAL062W NADP(+)‐dependent glutamate dehydrogenase, synthesizes glutamate from ammonia and alpha‐ketoglutarate; rate of alpha‐
ketoglutarate utilization differs from Gdh1p; expression regulated by nitrogen and carbon sources 1.3458 0.0091
STF2 YGR008C Protein involved in regulation of the mitochondrial F1F0‐ATP synthase; Stf1p and Stf2p may act as stabilizing factors that enhance inhibitory action of the Inh1p protein 1.3182 0.0109
YPT53 YNL093W 1.3130 0.0042
HXT4 YHR092C Rab family GTPase, similar to Ypt51p and Ypt52p and to mammalian rab5; required for vacuolar protein sorting and endocytosis High‐affinity glucose transporter of the major facilitator superfamily, expression is induced by low levels of glucose and repressed by high levels of glucose 1.2365 0.0308
COS12 YGL263W 1.2307 0.0269
Symbols ORF Description CYB2 YML054C NA Protein of unknown function, member of the DUP380 subfamily of conserved, often subtelomerically‐encoded proteins 265
log2(msn5
.Tf/WT.Tf) adj.p.v
al Alkaline ceramidase that also has reverse (CoA‐independent) ceramide synthase activity, catalyzes both breakdown and synthesis of phytoceramide; overexpression confers fumonisin B1 resistance Putative NADP(+) coupled glycerol dehydrogenase, proposed to be involved in an alternative pathway for glycerol catabolism; also has mRNA binding activity; member of the aldo‐keto reductase (AKR) family 1.1755 0.0109
1.1738 0.0015
YCL026C‐B Putative protein of unknown function; similar to bacterial nitroreductases; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; protein becomes insoluble upon intracellular iron depletion 1.1731 0.0065
PHO8 YDR481C Repressible alkaline phosphatase, a glycoprotein localized to the vacuole; regulated by levels of inorganic phosphate and by a system consisting of Pho4p, Pho9p, Pho80p, Pho81p and Pho85p; dephosphorylates phosphotyrosyl peptides 1.1708 0.0005
ARO9 YHR137W 1.1616 0.0464
BOP2 DUR1,2 YLR267W YBR208C Aromatic aminotransferase II, catalyzes the first step of tryptophan, phenylalanine, and tyrosine catabolism Protein of unknown function
Urea amidolyase, contains both urea carboxylase and allophanate hydrolase activities, degrades urea to CO2 and NH3; expression sensitive to nitrogen catabolite repression and induced by allophanate, an intermediate in allantoin degradation 1.1607 1.1596 0.0398
0.0070
PRX1 YBL064C Mitochondrial peroxiredoxin (1‐Cys Prx) with thioredoxin peroxidase activity, has a role in reduction of hydroperoxides; reactivation requires Trr2p and glutathione; induced during respiratory growth and oxidative stress; phosphorylated 1.1478 0.0014
NA YKL107W 1.1472 0.0096
MAL31 YBR298C Putative protein of unknown function; proposed to be a palmitoylated membrane protein Maltose permease, high‐affinity maltose transporter (alpha‐glucoside transporter); encoded in the MAL3 complex locus; member of the 12 transmembrane domain superfamily of sugar transporters; functional in genomic reference strain S288C 1.1389 0.0016
USV1 YPL230W Putative transcription factor containing a C2H2 zinc finger; mutation affects transcriptional regulation of genes involved in growth on non‐
fermentable carbon sources, response to salt stress and cell wall biosynthesis 1.1211 0.0088
MAL32 YBR299W Maltase (alpha‐D‐glucosidase), inducible protein involved in maltose catabolism; encoded in the MAL3 complex locus; functional in genomic reference strain S288C; hydrolyzes the disaccharides maltose, turanose, maltotriose, and sucrose 1.1189 0.0147
DAL1 YIR027C Allantoinase, converts allantoin to allantoate in the first step of allantoin degradation; expression sensitive to nitrogen catabolite repression 1.1186 0.0032
REG2 YBR050C Regulatory subunit of the Glc7p type‐1 protein phosphatase; involved with Reg1p, Glc7p, and Snf1p in regulation of glucose‐
repressible genes, also involved in glucose‐induced proteolysis of maltose permease 1.0843 0.0047
NA YHL048C‐A 1.0822 0.0022
MOH1 YBL049W Putative protein of unknown function; identified by expression profiling and mass spectrometry Protein of unknown function, has homology to kinase Snf7p; not required for growth on nonfermentable carbon sources; essential for survival in stationary phase 1.0763 0.0080
Symbols ORF Description YPC1 YBR183W GCY1 YOR120W HBN1 266
log2(msn5
.Tf/WT.Tf) adj.p.v
al Putative transmembrane protein involved in export of ammonia, a starvation signal that promotes cell death in aging colonies; phosphorylated in mitochondria; member of the TC 9.B.33 YaaH family; homolog of Ady2p and Y. lipolytica Gpr1p 1.0748 0.0186
Putative channel‐like protein; similar to Fps1p; mediates passive diffusion of glycerol in the presence of ethanol Vacuolar membrane polyphosphate polymerase; subunit of the vacuolar transporter chaperone (VTC) complex involved in synthesis and transfer of polyP to the vacuole; regulates membrane trafficking; role in non‐autophagic vacuolar fusion 1.0654 0.0014
1.0636 0.0023
Pyruvate kinase that appears to be modulated by phosphorylation; PYK2 transcription is repressed by glucose, and Pyk2p may be active under low glycolytic flux 1.0456 0.0060
YKL221W Protein with similarity to mammalian monocarboxylate permeases, which are involved in transport of monocarboxylic acids across the plasma membrane; mutant is not deficient in monocarboxylate transport 1.0449 0.0066
NA YOR289W Putative protein of unknown function; transcription induced by the unfolded protein response; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus 1.0422 0.0036
NA YDR391C Putative protein of unknown function, possibly involved in zinc homeostasis; Bdf1p‐dependent transcription induced by salt stress; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus 1.0397 0.0026
YPS6 YIR039C 1.0321 0.0029
PHO81 YGR233C Putative GPI‐anchored aspartic protease, member of the yapsin family of proteases involved in cell wall growth and maintenance Cyclin‐dependent kinase (CDK) inhibitor, regulates Pho80p‐Pho85p and Pcl7p‐Pho85p cyclin‐CDK complexes in response to phosphate levels; inhibitory activity for Pho80p‐Pho85p requires myo‐D‐inositol heptakisphosphate (IP7) generated by Vip1p 1.0245 0.0045
FMP33 YJL161W Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies 1.0212 0.0047
PET10 YKR046C Protein of unknown function that co‐purifies with lipid particles; expression pattern suggests a role in respiratory growth; computational analysis of large‐scale protein‐protein interaction data suggests a role in ATP/ADP exchange 1.0203 0.0052
NA YBL086C 1.0196 0.0026
CLD1 YGR110W Protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cell periphery Mitochondrial cardiolipin‐specific phospholipase; functions upstream of Taz1p to generate monolyso‐cardiolipin; transcription increases upon genotoxic stress; involved in restricting Ty1 transposition; has homology to mammalian CGI‐58 1.0169 0.0186
GAP1 YKR039W 1.0123 0.0109
NA YEL073C 1.0117 0.0070
KIN82 YCR091W 1.0036 0.0148
Symbols ORF Description ATO2 YNR002C NA YFL054C VTC4 YJL012C PYK2 YOR347C MCH2 General amino acid permease; localization to the plasma membrane is regulated by nitrogen source Putative protein of unknown function; located adjacent to ARS503 and the telomere on the left arm of chromosome V; regulated by inositol/choline Putative serine/threonine protein kinase implicated in the regulation of phospholipid asymmetry through the activation of phospholipid translocases (flippases) Lem3p‐Dnf1p/Dnf2p; similar to Fpk1p 267
log2(msn5
.Tf/WT.Tf) adj.p.v
al Glycogen branching enzyme, involved in glycogen accumulation; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern 0.9895 0.0047
Mitochondrial phosphate carrier, imports inorganic phosphate into mitochondria; functionally redundant with Mir1p but less abundant than Mir1p under normal conditions; expression is induced at high temperature Putative protein of unknown function; YKL151C promoter contains STREs (stress response elements) and expression is induced by heat shock or methyl methanesulfonate; green fluorescent protein (GFP)‐
fusion protein localizes to the cytoplasm 0.9859 0.0142
0.9750 0.0028
0.9655 0.0089
0.9614 0.9590 0.0411
0.0036
0.9533 0.0204
Neutral trehalase, degrades trehalose; required for thermotolerance and may mediate resistance to other cellular stresses; may be phosphorylated by Cdc28p 0.9406 0.0022
YLR270W Non‐essential hydrolase involved in mRNA decapping, may function in a feedback mechanism to regulate deadenylation, contains pyrophosphatase activity and a HIT (histidine triad) motif; interacts with neutral trehalase Nth1p 0.9212 0.0077
STF1 YDL130W‐A Protein involved in regulation of the mitochondrial F1F0‐ATP synthase; Stf1p and Stf2p may act as stabilizing factors that enhance inhibitory action of the Inh1p protein 0.9205 0.0109
DAL3 YIR032C Ureidoglycolate hydrolase, converts ureidoglycolate to glyoxylate and urea in the third step of allantoin degradation; expression sensitive to nitrogen catabolite repression 0.9195 0.0266
NA YMR206W 0.9149 0.0098
BNA2 YJR078W Putative protein of unknown function; YMR206W is not an essential gene Putative tryptophan 2,3‐dioxygenase or indoleamine 2,3‐
dioxygenase, required for de novo biosynthesis of NAD from tryptophan via kynurenine; interacts genetically with telomere capping gene CDC13; regulated by Hst1p and Aftp 0.9143 0.0091
GSY1 YFR015C 0.9140 0.0091
NA NA NA NA YER079W YMR262W 0.9093 0.9050 0.9024 0.0102
0.0132
0.0046
NA YHL044W 0.8932 0.0014
HXT9 YJL219W 0.8838 0.0153
Symbols ORF Description GLC3 YEL011W PIC2 YER053C NA YKL151C SUE1 YPR151C NA LAP4 NA YKL103C TSL1 YML100W NTH1 YDR001C DCS1 Mitochondrial protein required for degradation of unstable forms of cytochrome c NA Vacuolar aminopeptidase yscI; zinc metalloproteinase that belongs to the peptidase family M18; often used as a marker protein in studies of autophagy and cytosol to vacuole targeting (CVT) pathway Large subunit of trehalose 6‐phosphate synthase (Tps1p)/phosphatase (Tps2p) complex, which converts uridine‐5'‐
diphosphoglucose and glucose 6‐phosphate to trehalose, similar to Tps3p and may share function; mutant has aneuploidy tolerance Glycogen synthase with similarity to Gsy2p, the more highly expressed yeast homolog; expression induced by glucose limitation, nitrogen starvation, environmental stress, and entry into stationary phase NA Putative protein of unknown function
Protein of unknown function; interacts weakly with Knr4p; YMR262W is not an essential gene Putative integral membrane protein, member of DUP240 gene family; green fluorescent protein (GFP)‐fusion protein localizes to the plasma membrane in a punctate pattern Putative hexose transporter that is nearly identical to Hxt11p, has similarity to major facilitator superfamily (MFS) transporters, expression of HXT9 is regulated by transcription factors Pdr1p and Pdr3p 268
log2(msn5
.Tf/WT.Tf) adj.p.v
al Meiosis‐specific component of sister chromatid cohesion complex; maintains cohesion between sister chromatids during meiosis I; maintains cohesion between centromeres of sister chromatids until meiosis II; homolog of S. pombe Rec8p 0.8821 0.0135
YLR281C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to mitochondria; YLR281C is not an essential gene 0.8820 0.0021
UBP11 YKR098C 0.8811 0.0092
NA YNR034W‐A 0.8799 0.0185
HXK1 YFR053C Ubiquitin‐specific protease that cleaves ubiquitin from ubiquitinated proteins Putative protein of unknown function; expression is regulated by Msn2p/Msn4p Hexokinase isoenzyme 1, a cytosolic protein that catalyzes phosphorylation of glucose during glucose metabolism; expression is highest during growth on non‐glucose carbon sources; glucose‐
induced repression involves the hexokinase Hxk2p 0.8792 0.0206
EMI2 YDR516C Non‐essential protein of unknown function required for transcriptional induction of the early meiotic‐specific transcription factor IME1; required for sporulation; expression is regulated by glucose‐repression transcription factors Mig1/2p 0.8772 0.0114
ROM1 YGR070W GDP/GTP exchange protein (GEP) for Rho1p; mutations are synthetically lethal with mutations in rom2, which also encodes a GEP 0.8720 0.0141
NA YNL200C Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies 0.8719 0.0025
FMP46 YKR049C Putative redox protein containing a thioredoxin fold; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies 0.8706 0.0031
NA YHR138C Putative protein of unknown function; has similarity to Pbi2p; double null mutant lacking Pbi2p and Yhr138p exhibits highly fragmented vacuoles 0.8657 0.0047
CAR1 YPL111W 0.8615 0.0081
AMS1 YGL156W Arginase, responsible for arginine degradation, expression responds to both induction by arginine and nitrogen catabolite repression; disruption enhances freeze tolerance Vacuolar alpha mannosidase, involved in free oligosaccharide (fOS) degradation; delivered to the vacuole in a novel pathway separate from the secretory pathway 0.8532 0.0206
JID1 YPR061C Probable Hsp40p co‐chaperone, has a DnaJ‐like domain and appears to be involved in ER‐associated degradation of misfolded proteins containing a tightly folded cytoplasmic domain; inhibits replication of Brome mosaic virus in S. cerevisiae 0.8513 0.0015
THI13 YDL244W Protein involved in synthesis of the thiamine precursor hydroxymethylpyrimidine (HMP); member of a subtelomeric gene family including THI5, THI11, THI12, and THI13 0.8493 0.0041
GDB1 YPR184W 0.8449 0.0189
DGR2 YKL121W 0.8397 0.0091
ISF1 YMR081C 0.8299 0.0487
COX20 YDR231C Glycogen debranching enzyme containing glucanotranferase and alpha‐1,6‐amyloglucosidase activities, required for glycogen degradation; phosphorylated in mitochondria Protein of unknown function; null mutant is resistant to 2‐deoxy‐D‐
glucose and displays abnormally elongated buds Serine‐rich, hydrophilic protein with similarity to Mbr1p; overexpression suppresses growth defects of hap2, hap3, and hap4 mutants; expression is under glucose control; cotranscribed with NAM7 in a cyp1 mutant Mitochondrial inner membrane protein, required for proteolytic processing of Cox2p and its assembly into cytochrome c oxidase 0.8294 0.0024
Symbols ORF Description REC8 YPR007C NA 269
log2(msn5
.Tf/WT.Tf) adj.p.v
al Non‐essential protein of unknown function
Glyoxylate reductase; null mutation results in increased biomass after diauxic shift; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies Xylulokinase, converts D‐xylulose and ATP to xylulose 5‐phosphate and ADP; rate limiting step in fermentation of xylulose; required for xylose fermentation by recombinant S. cerevisiae strains cAMP‐dependent protein kinase catalytic subunit; promotes vegetative growth in response to nutrients via the Ras‐cAMP signaling pathway; inhibited by regulatory subunit Bcy1p in the absence of cAMP; partially redundant with Tpk2p and Tpk3p 0.8267 0.8265 0.0071
0.0171
0.8165 0.0131
0.8118 0.0142
YCL040W Glucokinase, catalyzes the phosphorylation of glucose at C6 in the first irreversible step of glucose metabolism; one of three glucose phosphorylating enzymes; expression regulated by non‐fermentable carbon sources 0.8064 0.0054
PIG2 YIL045W 0.7987 0.0210
YAK1 YJL141C Putative type‐1 protein phosphatase targeting subunit that tethers Glc7p type‐1 protein phosphatase to Gsy2p glycogen synthase Serine‐threonine protein kinase that is part of a glucose‐sensing system involved in growth control in response to glucose availability; translocates from the cytoplasm to the nucleus and phosphorylates Pop2p in response to a glucose signal 0.7940 0.0070
GSP2 YOR185C GTP binding protein (mammalian Ranp homolog) involved in the maintenance of nuclear organization, RNA processing and transport; interacts with Kap121p, Kap123p and Pdr6p (karyophilin betas); Gsp1p homolog that is not required for viability 0.7909 0.0144
RTC2 YBR147W Protein of unknown function; identified in a screen for mutants with decreased levels of rDNA transcription; detected in highly purified mitochondria; null mutant suppresses cdc13‐1; similar to a G‐protein coupled receptor from S. pombe 0.7881 0.0105
NA YLR345W Similar to 6‐phosphofructo‐2‐kinase/fructose‐2,6‐bisphosphatase enzymes responsible for the metabolism of fructoso‐2,6‐
bisphosphate; mRNA expression is repressed by the Rfx1p‐Tup1p‐
Ssn6p repressor complex; YLR345W is not an essential gene 0.7815 0.0065
GSY2 YLR258W Glycogen synthase, similar to Gsy1p; expression induced by glucose limitation, nitrogen starvation, heat shock, and stationary phase; activity regulated by cAMP‐dependent, Snf1p and Pho85p kinases as well as by the Gac1p‐Glc7p phosphatase 0.7814 0.0337
NA NA YBR056W YGR174W‐A 0.7795 0.7790 0.0091
0.0419
CMC4 YMR194C‐B Putative cytoplasmic protein of unknown function
Putative protein of unknown function; predicted to have a role in cell budding based on computational "guilt by association" analysis Protein that localizes to the mitochondrial intermembrane space via the Mia40p‐Erv1p system; contains twin cysteine‐x(9)‐cysteine motifs 0.7790 0.0090
NA YJR008W 0.7728 0.0227
NA YAL016C‐B 0.7654 0.0224
VID24 YBR105C Putative protein of unknown function; expression repressed by inosine and choline in an Opi1p‐dependent manner; expression induced by mild heat‐stress on a non‐fermentable carbon source. Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data Peripheral membrane protein located at Vid (vacuole import and degradation) vesicles; regulates fructose‐1,6‐bisphosphatase (FBPase) targeting to the vacuole; promotes proteasome‐dependent catabolite degradation of FBPase 0.7647 0.0065
PTK2 YJR059W 0.7631 0.0096
Symbols ORF Description ECM8 GOR1 YBR076W YNL274C XKS1 YGR194C TPK1 YJL164C GLK1 Putative serine/threonine protein kinase involved in regulation of ion transport across plasma membrane; enhances spermine uptake 270
log2(msn5
.Tf/WT.Tf) adj.p.v
al 0.7585 0.0467
0.7576 0.0115
0.7569 0.0416
0.7496 0.0110
Subunit of the mitochondrial inner membrane peptidase, which is required for maturation of mitochondrial proteins of the intermembrane space; Som1p facilitates cleavage of a subset of substrates; contains twin cysteine‐x9‐cysteine motifs 0.7431 0.0097
Ubiquitin‐like protein modifier, may function in modification of Sph1p and Hbt1p, functionally complemented by the human or S. pombe ortholog; mechanism of Hub1p adduct formation not yet clear Putative protein of unknown function; proposed to be involved in responding to environmental stresses; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies Putative protein of unknown function; identified by homology
0.7430 0.0068
0.7410 0.0051
0.7370 0.0054
YCR083W Mitochondrial thioredoxin, highly conserved oxidoreductase required to maintain the redox homeostasis of the cell, forms the mitochondrial thioredoxin system with Trr2p, redox state is maintained by both Trr2p and Glr1p 0.7367 0.0034
ALD3 YMR169C 0.7357 0.0400
BNA1 YJR025C Cytoplasmic aldehyde dehydrogenase, involved in beta‐alanine synthesis; uses NAD+ as the preferred coenzyme; very similar to Ald2p; expression is induced by stress and repressed by glucose 3‐hydroxyanthranilic acid dioxygenase, required for the de novo biosynthesis of NAD from tryptophan via kynurenine; expression regulated by Hst1p 0.7334 0.0034
NA YNL217W Putative protein of unknown function; weak sequence similarity to bis (5'‐nucleotidyl)‐tetraphosphatases; (GFP)‐fusion protein localizes to the vacuole; null mutant is highly sensitive to azaserine and resistant to sodium‐O‐vandate 0.7263 0.0091
TPS3 YMR261C 0.7217 0.0060
EMP46 YLR080W 0.7217 0.0292
NA YGL185C Regulatory subunit of trehalose‐6‐phosphate synthase/phosphatase complex, which synthesizes the storage carbohydrate trehalose; expression is induced by stress conditions and repressed by the Ras‐
cAMP pathway Integral membrane component of endoplasmic reticulum‐derived COPII‐coated vesicles, which function in ER to Golgi transport Putative protein with sequence similarity to hydroxyacid dehydrogenases; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm 0.7171 0.0093
DOG2 YHR043C 2‐deoxyglucose‐6‐phosphate phosphatase, member of a family of low molecular weight phosphatases, similar to Dog1p, induced by oxidative and osmotic stress, confers 2‐deoxyglucose resistance when overexpressed 0.7164 0.0134
AGP1 YCL025C Low‐affinity amino acid permease with broad substrate range, involved in uptake of asparagine, glutamine, and other amino acids; expression is regulated by the SPS plasma membrane amino acid sensor system (Ssy1p‐Ptr3p‐Ssy5p) 0.7129 0.0085
Symbols ORF Description NA YDR379C‐A MAL11 YGR289C YTP1 YNL237W ECM4 YKR076W Protein involved in the assembly of the mitochondrial succinate dehydrogenase complex; mutations in human ortholog SDHAF1 are associated with infantile leukoencephalopathy Inducible high‐affinity maltose transporter (alpha‐glucoside transporter); encoded in the MAL1 complex locus; broad substrate specificity that includes maltotriose; required for isomaltose utilization Probable type‐III integral membrane protein of unknown function, has regions of similarity to mitochondrial electron transport proteins Omega class glutathione transferase; not essential; similar to Ygr154cp; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm SOM1 YEL059C‐A HUB1 YNR032C‐A FMP40 YPL222W NA YFR012W‐A TRX3 271
log2(msn5
.Tf/WT.Tf) adj.p.v
al L‐ornithine transaminase (OTAse), catalyzes the second step of arginine degradation, expression is dually‐regulated by allophanate induction and a specific arginine induction process; not nitrogen catabolite repression sensitive 0.7105 0.0246
YDR185C Mitochondrial protein of unknown function; similar to Ups1p and Ups2p which are involved in regulation of mitochondrial cardiolipin and phosphatidylethanolamine levels; null is viable but interacts synthetically with ups1 and ups2 mutations 0.7060 0.0111
CMK2 YOL016C Calmodulin‐dependent protein kinase; may play a role in stress response, many CA++/calmodulan dependent phosphorylation substrates demonstrated in vitro, amino acid sequence similar to Cmk1p and mammalian Cam Kinase II 0.7045 0.0138
OYE3 YPL171C Conserved NADPH oxidoreductase containing flavin mononucleotide (FMN), homologous to Oye2p with different ligand binding and catalytic properties; has potential roles in oxidative stress response and programmed cell death 0.7035 0.0308
VTC1 YER072W Subunit of the vacuolar transporter chaperone (VTC) complex involved in membrane trafficking, vacuolar polyphosphate accumulation, microautophagy and non‐autophagic vacuolar fusion; also has mRNA binding activity 0.7030 0.0060
UGX2 YDL169C 0.6974 0.0285
PNC1 YGL037C Protein of unknown function, transcript accumulates in response to any combination of stress conditions Nicotinamidase that converts nicotinamide to nicotinic acid as part of the NAD(+) salvage pathway, required for life span extension by calorie restriction; PNC1 expression responds to all known stimuli that extend replicative life span 0.6966 0.0181
NGL3 YML118W Putative endonuclease, has a domain similar to a magnesium‐
dependent endonuclease motif in mRNA deadenylase Ccr4p; similar to Ngl1p and Ngl2p 0.6952 0.0328
NA NA YBR230W‐A YPL247C 0.6950 0.6893 0.0242
0.0170
GAL3 YDR009W Putative protein of unknown function
Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; similar to the petunia WD repeat protein an11; overexpression causes a cell cycle delay or arrest Transcriptional regulator involved in activation of the GAL genes in response to galactose; forms a complex with Gal80p to relieve Gal80p inhibition of Gal4p; binds galactose and ATP but does not have galactokinase activity 0.6848 0.0225
MIC14 YDR031W 0.6802 0.0104
UBP9 YER098W 0.6722 0.0109
TMA17 YDL110C Mitochondrial intermembrane space protein, required for normal oxygen consumption; contains twin cysteine‐x9‐cysteine motifs Ubiquitin carboxyl‐terminal hydrolase, ubiquitin‐specific protease that cleaves ubiquitin‐protein fusions Protein of unknown function that associates with ribosomes; heterozygous deletion demonstrated increases in chromosome instability in a rad9 deletion background; protein abundance is decreased upon intracellular iron depletion 0.6718 0.0292
VPS73 YGL104C 0.6713 0.0190
VTC2 YFL004W Mitochondrial protein; mutation affects vacuolar protein sorting; putative transporter; member of the sugar porter family Subunit of the vacuolar transporter chaperone (VTC) complex involved in membrane trafficking, vacuolar polyphosphate accumulation, microautophagy and non‐autophagic vacuolar fusion 0.6706 0.0292
NA YMR105W‐
A Putative protein of unknown function
0.6697 0.0476
Symbols ORF Description CAR2 YLR438W UPS3 272
log2(msn5
.Tf/WT.Tf) adj.p.v
al Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies 0.6671 0.0091
YER062C One of two redundant DL‐glycerol‐3‐phosphatases (RHR2/GPP1 encodes the other) involved in glycerol biosynthesis; induced in response to hyperosmotic stress and oxidative stress, and during the diauxic transition 0.6665 0.0041
GPX1 YKL026C 0.6663 0.0079
NTH2 YBR001C 0.6662 0.0054
NA YGR226C Phospholipid hydroperoxide glutathione peroxidase induced by glucose starvation that protects cells from phospholipid hydroperoxides and nonphospholipid peroxides during oxidative stress Putative neutral trehalase, required for thermotolerance and may mediate resistance to other cellular stresses Dubious open reading frame, unlikely to encode a protein; not conserved in closely related Saccharomyces species; overlaps significantly with a verified ORF, AMA1/YGR225W 0.6654 0.0104
UBC12 YLR306W Enzyme that mediates the conjugation of Rub1p, a ubiquitin‐like protein, to other proteins; related to E2 ubiquitin‐conjugating enzymes 0.6566 0.0086
SDH4 YDR178W Membrane anchor subunit of succinate dehydrogenase (Sdh1p, Sdh2p, Sdh3p, Sdh4p), which couples the oxidation of succinate to the transfer of electrons to ubiquinone as part of the TCA cycle and the mitochondrial respiratory chain 0.6563 0.0090
GRX1 YCL035C Hydroperoxide and superoxide‐radical responsive heat‐stable glutathione‐dependent disulfide oxidoreductase with active site cysteine pair; protects cells from oxidative damage 0.6534 0.0171
DAN4 YJR151C Cell wall mannoprotein with similarity to Tir1p, Tir2p, Tir3p, and Tir4p; expressed under anaerobic conditions, completely repressed during aerobic growth 0.6460 0.0091
YSC84 YHR016C 0.6443 0.0109
NA YBR085C‐A 0.6425 0.0165
PUT1 YLR142W Actin‐binding protein involved in bundling of actin filaments and endocytosis of actin cortical patches; activity stimulated by Las17p; contains SH3 domain similar to Rvs167p Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and to the nucleus Proline oxidase, nuclear‐encoded mitochondrial protein involved in utilization of proline as sole nitrogen source; PUT1 transcription is induced by Put3p in the presence of proline and the absence of a preferred nitrogen source 0.6412 0.0090
ATG34 YOL083W Receptor protein involved in selective autophagy during starvation; specifically involved in the transport of cargo protein alpha‐
mannosidase (Ams1p); Atg19p paralog 0.6396 0.0253
NA YNR014W 0.6388 0.0292
PMC1 YGL006W Putative protein of unknown function; expression is cell‐cycle regulated, Azf1p‐dependent, and heat‐inducible Vacuolar Ca2+ ATPase involved in depleting cytosol of Ca2+ ions; prevents growth inhibition by activation of calcineurin in the presence of elevated concentrations of calcium; similar to mammalian PMCA1a 0.6367 0.0170
ICY1 YMR195W 0.6366 0.0073
SFC1 YJR095W Protein of unknown function, required for viability in rich media of cells lacking mitochondrial DNA; mutants have an invasive growth defect with elongated morphology; induced by amino acid starvation Mitochondrial succinate‐fumarate transporter, transports succinate into and fumarate out of the mitochondrion; required for ethanol and acetate utilization 0.6324 0.0403
Symbols ORF Description NA YJL133C‐A HOR2 273
log2(msn5
.Tf/WT.Tf) adj.p.v
al Protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the ER; YBR287W is not an essential gene Subunit 8 of ubiquinol cytochrome‐c reductase complex, which is a component of the mitochondrial inner membrane electron transport chain; oriented facing the intermembrane space; expression is regulated by Abf1p and Cpf1p 0.6307 0.0091
0.6294 0.0081
YMR291W Putative kinase of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; YMR291W is not an essential gene 0.6287 0.0045
VID30 YGL227W Protein involved in proteasome‐dependent catabolite degradation of fructose‐1,6‐bisphosphatase (FBPase); binds FBPase; shifts the balance of nitrogen metabolism toward glutamate production; localizes to the nucleus and the cytoplasm 0.6285 0.0150
ZTA1 YBR046C NADPH‐dependent quinone reductase, GFP‐tagged protein localizes to the cytoplasm and nucleus; has similarity to E. coli quinone oxidoreductase and to human zeta‐crystallin 0.6240 0.0104
REE1 YJL217W Cytoplasmic protein involved in the regulation of enolase (ENO1); mRNA expression is induced by calcium shortage, copper deficiency (via Mac1p) and the presence of galactose (via Gal4p); mRNA expression is also regulated by the cell cycle 0.6214 0.0400
OSH2 YDL019C Member of an oxysterol‐binding protein family with seven members in S. cerevisiae; family members have overlapping, redundant functions in sterol metabolism and collectively perform a function essential for viability 0.6211 0.0113
COX5B YIL111W Subunit Vb of cytochrome c oxidase, which is the terminal member of the mitochondrial inner membrane electron transport chain; predominantly expressed during anaerobic growth while its isoform Va (Cox5Ap) is expressed during aerobic growth 0.6204 0.0337
DCG1 YIR030C Protein of unknown function, expression is sensitive to nitrogen catabolite repression and regulated by Dal80p; contains transmembrane domain 0.6182 0.0166
NA YLR177W Putative protein of unknown function; phosphorylated by Dbf2p‐
Mob1p in vitro; some strains contain microsatellite polymophisms at this locus; YLR177W is not an essential gene 0.6074 0.0127
ODC1 YPL134C 0.6048 0.0144
NA YJL213W Mitochondrial inner membrane transporter, exports 2‐oxoadipate and 2‐oxoglutarate from the mitochondrial matrix to the cytosol for lysine and glutamate biosynthesis and lysine catabolism; suppresses, in multicopy, an fmc1 null mutation Protein of unknown function that may interact with ribosomes; periodically expressed during the yeast metabolic cycle; phosphorylated in vitro by the mitotic exit network (MEN) kinase complex, Dbf2p/Mob1p 0.6020 0.0253
ALG14 YBR070C Component of UDP‐GlcNAc transferase required for the second step of dolichyl‐linked oligosaccharide synthesis; anchors the catalytic subunit Alg13p to the ER membrane; similar to bacterial and human glycosyltransferases 0.6006 0.0080
Symbols ORF Description NA YBR287W QCR8 YJL166W NA 274
APPENDIX N: Down-regulated genes in msn5Δ
cells in amino acid starvation condition
This section includes the list of transcriptionally differentially expressed genes (cutoff
conditions: log2 FC
0.6 and adjusted p-value < 0.05) in msn5Δ cells in amino acid
starvation condition.
Down-regulated genes in msn5Δ cells in amino acid starvation condition
Symbols ORF Description MSN5 YDR335W MF(ALPHA)
2 YGL089C PCL1 YNL289W PRM1 YNL279W YOX1 YML027W BAR1 YIL015W FUS1 YCL027W IMD1 YAR073W Karyopherin involved in nuclear import and export of proteins, including import of replication protein A and export of Swi6p, Far1p, and Pho4p; required for re‐export of mature tRNAs after their retrograde import from the cytoplasm Mating pheromone alpha‐factor, made by alpha cells; interacts with mating type a cells to induce cell cycle arrest and other responses leading to mating; also encoded by MF(ALPHA)1, which is more highly expressed than MF(ALPHA)2 Cyclin, interacts with cyclin‐dependent kinase Pho85p; member of the Pcl1,2‐like subfamily, involved in the regulation of polarized growth and morphogenesis and progression through the cell cycle; localizes to sites of polarized cell growth Pheromone‐regulated multispanning membrane protein involved in membrane fusion during mating; predicted to have 5 transmembrane segments and a coiled coil domain; localizes to the shmoo tip; regulated by Ste12p Homeodomain‐containing transcriptional repressor, binds to Mcm1p and to early cell cycle boxes (ECBs) in the promoters of cell cycle‐
regulated genes expressed in M/G1 phase; expression is cell cycle‐
regulated; potential Cdc28p substrate Aspartyl protease secreted into the periplasmic space of mating type a cells, helps cells find mating partners, cleaves and inactivates alpha factor allowing cells to recover from alpha‐factor‐induced cell cycle arrest Membrane protein localized to the shmoo tip, required for cell fusion; expression regulated by mating pheromone; proposed to coordinate signaling, fusion, and polarization events required for fusion; potential Cdc28p substrate Nonfunctional protein with homology to IMP dehydrogenase; probable pseudogene, located close to the telomere; is not 275
log2(msn5
.Ts/WT.Ts) adj.p.v
al ‐7.9130 0.0000
‐4.6487 0.0000
‐3.2756 0.0002
‐2.9190 0.0000
‐2.7175 0.0007
‐2.3923 0.0004
‐2.1300 0.0004
‐2.1086 0.0025
Symbols ORF FIG1 YBR040W YHP1 YDR451C SAG1 YJR004C ANS1 YHR126C AGA1 YNR044W WSC4 YHL028W AGA2 YGL032C ASG7 YJL170C NA YER085C IMD2 YHR216W CSI2 YOL007C TOS6 YNL300W PRM6 YML047C PHM7 YOL084W HO YDL227C DAN1 YJR150C NA YAR066W RIM9 YMR063W SFG1 YOR315W Description expressed at detectable levels; YAR073W and YAR075W comprise a continuous reading frame in some strains of S. cerevisiae Integral membrane protein required for efficient mating; may participate in or regulate the low affinity Ca2+ influx system, which affects intracellular signaling and cell‐cell fusion during mating One of two homeobox transcriptional repressors (see also Yox1p), that bind to Mcm1p and to early cell cycle box (ECB) elements of cell cycle regulated genes, thereby restricting ECB‐mediated transcription to the M/G1 interval Alpha‐agglutinin of alpha‐cells, binds to Aga1p during agglutination, N‐terminal half is homologous to the immunoglobulin superfamily and contains binding site for a‐agglutinin, C‐terminal half is highly glycosylated and contains GPI anchor Putative protein of unknown function; transcription dependent upon Azf1p Anchorage subunit of a‐agglutinin of a‐cells, highly O‐glycosylated protein with N‐terminal secretion signal and C‐terminal signal for addition of GPI anchor to cell wall, linked to adhesion subunit Aga2p via two disulfide bonds ER membrane protein involved in the translocation of soluble secretory proteins and insertion of membrane proteins into the ER membrane; may also have a role in the stress response but has only partial functional overlap with WSC1‐3 Adhesion subunit of a‐agglutinin of a‐cells, C‐terminal sequence acts as a ligand for alpha‐agglutinin (Sag1p) during agglutination, modified with O‐linked oligomannosyl chains, linked to anchorage subunit Aga1p via two disulfide bonds Protein that regulates signaling from a G protein beta subunit Ste4p and its relocalization within the cell; specific to a‐cells and induced by alpha‐factor Putative protein of unknown function
Inosine monophosphate dehydrogenase, catalyzes the rate‐limiting step in GTP biosynthesis, expression is induced by mycophenolic acid resulting in resistance to the drug, expression is repressed by nutrient limitatio Protein of unknown function; green fluorescent protein (GFP)‐ fusion protein localizes to the mother side of the bud neck and the vacuole; YOL007C is not an essential gene Glycosylphosphatidylinositol‐dependent cell wall protein, expression is periodic and decreases in respone to ergosterol perturbation or upon entry into stationary phase; depletion increases resistance to lactic acid Pheromone‐regulated protein, predicted to have 2 transmembrane segments; regulated by Ste12p during mating Protein of unknown function, expression is regulated by phosphate levels; green fluorescent protein (GFP)‐fusion protein localizes to the cell periphery and vacuole Site‐specific endonuclease required for gene conversion at the MAT locus (homothallic switching) through the generation of a ds DNA break; expression restricted to mother cells in late G1 as controlled by Swi4p‐Swi6p, Swi5p and Ash1p Cell wall mannoprotein with similarity to Tir1p, Tir2p, Tir3p, and Tir4p; expressed under anaerobic conditions, completely repressed during aerobic growth Putative GPI protein
Protein of unknown function, involved in the proteolytic activation of Rim101p in response to alkaline pH; has similarity to A. nidulans PalI; putative membrane protein Nuclear protein, putative transcription factor required for growth of 276
log2(msn5
.Ts/WT.Ts) adj.p.v
al ‐1.9293 0.0075
‐1.9256 0.0007
‐1.9071 0.0001
‐1.8395 0.0039
‐1.8349 0.0004
‐1.7878 0.0072
‐1.7575 0.0034
‐1.7416 0.0021
‐1.7129 0.0013
‐1.7000 0.0007
‐1.6657 0.0003
‐1.6583 0.0009
‐1.6562 0.0183
‐1.6327 0.0200
‐1.6270 0.0019
‐1.6217 0.0061
‐1.6055 0.0009
‐1.5709 0.0062
‐1.5696 0.0042
Symbols ORF SCW10 YMR305C PLM2 YDR501W HUG1 YML058W‐A RPI1 YIL119C MFA1 YDR461W STE3 YKL178C CWP1 YKL096W ADH2 YMR303C SST2 YLR452C FAR1 YJL157C NA YIL082W‐A DTR1 YBR180W NA YAL018C NA YOR214C SPC24 YMR117C CRR1 YLR213C ALP1 YNL270C CLB2 YPR119W Description superficial pseudohyphae (which do not invade the agar substrate) but not for invasive pseudohyphal growth; may act together with Phd1p; potential Cdc28p substrate Cell wall protein with similarity to glucanases; may play a role in conjugation during mating based on mutant phenotype and its regulation by Ste12p Forkhead Associated domain containing protein and putative transcription factor found associated with chromatin; target of SBF transcription factor; induced in response to DNA damaging agents and deletion of telomerase; similar to TOS4 Protein involved in the Mec1p‐mediated checkpoint pathway that responds to DNA damage or replication arrest, transcription is induced by DNA damage Putative transcriptional regulator; overexpression suppresses the heat shock sensitivity of wild‐type RAS2 overexpression and also suppresses the cell lysis defect of an mpk1 mutation Mating pheromone a‐factor, made by a cells; interacts with alpha cells to induce cell cycle arrest and other responses leading to mating; biogenesis involves C‐terminal modification, N‐terminal proteolysis, and export; also encoded by MFA2 Receptor for a factor pheromone, couples to MAP kinase cascade to mediate pheromone response; transcribed in alpha cells and required for mating by alpha cells, ligand bound receptors endocytosed and recycled to the plasma membrane; GPCR Cell wall mannoprotein that localizes specifically to birth scars of daughter cells, linked to a beta‐1,3‐ and beta‐1,6‐glucan heteropolymer through a phosphodiester bond; required for propionic acid resistance Glucose‐repressible alcohol dehydrogenase II, catalyzes the conversion of ethanol to acetaldehyde; involved in the production of certain carboxylate esters; regulated by ADR1 GTPase‐activating protein for Gpa1p, regulates desensitization to alpha factor pheromone; also required to prevent receptor‐
independent signaling of the mating pathway; member of the RGS (regulator of G‐protein signaling) family Cyclin‐dependent kinase inhibitor that mediates cell cycle arrest in response to pheromone; also forms a complex with Cdc24p, Ste4p, and Ste18p that may specify the direction of polarized growth during mating; potential Cdc28p substrate Retrotransposon TYA Gag and TYB Pol genes; transcribed/translated as one unit; polyprotein is processed to make a nucleocapsid‐like protein (Gag), reverse transcriptase (RT), protease (PR), and integrase (IN); similar to retroviral genes Putative dityrosine transporter, required for spore wall synthesis; expressed during sporulation; member of the major facilitator superfamily (DHA1 family) of multidrug resistance transporters Putative protein of unknown function
Putative protein of unknown function; YOR214C is not an essential gene Component of the evolutionarily conserved kinetochore‐associated Ndc80 complex (Ndc80p‐Nuf2p‐Spc24p‐Spc25p); involved in chromosome segregation, spindle checkpoint activity and kinetochore clustering Putative glycoside hydrolase of the spore wall envelope; required for normal spore wall assembly, possibly for cross‐linking between the glucan and chitosan layers; expressed during sporulation Arginine transporter; expression is normally very low and it is unclear what conditions would induce significant expression B‐type cyclin involved in cell cycle progression; activates Cdc28p to 277
log2(msn5
.Ts/WT.Ts) adj.p.v
al ‐1.5512 0.0004
‐1.5402 0.0004
‐1.5216 0.0030
‐1.5166 0.0111
‐1.5020 0.0019
‐1.4891 0.0001
‐1.4830 0.0210
‐1.4705 0.0020
‐1.4700 0.0004
‐1.4390 0.0002
‐1.4350 0.0003
‐1.4312 0.0001
‐1.4045 0.0031
‐1.3955 0.0182
‐1.3870 0.0035
‐1.3782 0.0062
‐1.3741 0.0062
‐1.3465 0.0033
Symbols ORF ECM11 YDR446W SVS1 YPL163C PTH1 YHR189W PMA2 YPL036W STE12 YHR084W NA YHL018W KAR4 YCL055W HES1 YOR237W RSB1 YOR049C NA YMR084W CDC6 YJL194W MSB2 YGR014W FRE8 YLR047C SMA1 YPL027W NA YLR042C PCL2 YDL127W NRM1 YNR009W NA YCL021W‐A Description promote the transition from G2 to M phase; accumulates during G2 and M, then targeted via a destruction box motif for ubiquitin‐
mediated degradation by the proteasome Non‐essential protein apparently involved in meiosis, GFP fusion protein is present in discrete clusters in the nucleus throughout mitosis; may be involved in maintaining chromatin structure Cell wall and vacuolar protein, required for wild‐type resistance to vanadate One of two (see also PTH2) mitochondrially‐localized peptidyl‐tRNA hydrolases; dispensable for respiratory growth on rich medium, but required for respiratory growth on minimal medium Plasma membrane H+‐ATPase, isoform of Pma1p, involved in pumping protons out of the cell; regulator of cytoplasmic pH and plasma membrane potential Transcription factor that is activated by a MAP kinase signaling cascade, activates genes involved in mating or pseudohyphal/invasive growth pathways; cooperates with Tec1p transcription factor to regulate genes specific for invasive growth Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to mitochondria and is induced in response to the DNA‐damaging agent MMS Transcription factor required for gene regulation in response to pheromones; also required during meiosis; exists in two forms, a slower‐migrating form more abundant during vegetative growth and a faster‐migrating form induced by pheromone Protein implicated in the regulation of ergosterol biosynthesis; one of a seven member gene family with a common essential function and non‐essential unique functions; similar to human oxysterol binding protein (OSBP) Suppressor of sphingoid long chain base (LCB) sensitivity of an LCB‐
lyase mutation; putative integral membrane transporter or flippase that may transport LCBs from the cytoplasmic side toward the extracytoplasmic side of the membrane Putative protein of unknown function; YMR084W and adjacent ORF YMR085W are merged in related strains Essential ATP‐binding protein required for DNA replication, component of the pre‐replicative complex (pre‐RC) which requires ORC to associate with chromatin and is in turn required for Mcm2‐7p DNA association; homologous to S. pombe Cdc18p Mucin family member involved in the Cdc42p‐ and MAP kinase‐
dependent filamentous growth signaling pathway; also functions as an osmosensor in parallel to the Sho1p‐mediated pathway; potential Cdc28p substrate Protein with sequence similarity to iron/copper reductases, involved in iron homeostasis; deletion mutant has iron deficiency/accumulation growth defects; expression increased in the absence of copper‐responsive transcription factor Mac1p Protein of unknown function involved in the assembly of the prospore membrane during sporulation; interacts with Spo14p Protein of unknown function; localizes to the cytoplasm; YLL042C is not an essential gene Cyclin, interacts with cyclin‐dependent kinase Pho85p; member of the Pcl1,2‐like subfamily, involved in the regulation of polarized growth and morphogenesis and progression through the cell cycle; localizes to sites of polarized cell growth Transcriptional co‐repressor of MBF (MCB binding factor)‐regulated gene expression; Nrm1p associates stably with promoters via MBF to repress transcription upon exit from G1 phase Putative protein of unknown function
278
log2(msn5
.Ts/WT.Ts) adj.p.v
al ‐1.3128 0.0051
‐1.3010 0.0040
‐1.2941 0.0095
‐1.2830 0.0032
‐1.2510 0.0007
‐1.2395 0.0083
‐1.2261 0.0007
‐1.2197 0.0019
‐1.1971 0.0182
‐1.1706 0.0117
‐1.1641 0.0062
‐1.1203 0.0015
‐1.1190 0.0030
‐1.1130 0.0102
‐1.1123 0.0016
‐1.0947 0.0016
‐1.0944 0.0015
‐1.0911 0.0030
Symbols ORF Description AQY1 YPR192W NA YOR316C‐A RTG1 YOL067C NFT1 YKR103W CLN1 YMR199W TIR1 YER011W Spore‐specific water channel that mediates the transport of water across cell membranes, developmentally controlled; may play a role in spore maturation, probably by allowing water outflow, may be involved in freeze tolerance Putative protein of unknown function; identified by fungal homology and RT‐PCR Transcription factor (bHLH) involved in interorganelle communication between mitochondria, peroxisomes, and nucleus Putative transporter of the multidrug resistance‐associated protein (MRP) subfamily; adjacent ORFs YKR103W and YKR104W are merged in different strain backgrounds. G1 cyclin involved in regulation of the cell cycle; activates Cdc28p kinase to promote the G1 to S phase transition; late G1 specific expression depends on transcription factor complexes, MBF (Swi6p‐
Mbp1p) and SBF (Swi6p‐Swi4p) Cell wall mannoprotein of the Srp1p/Tip1p family of serine‐alanine‐
rich proteins; expression is downregulated at acidic pH and induced by cold shock and anaerobiosis; abundance is increased in cells cultured without shaking Protein of unknown function, involved in filamentous growth
DFG10 YIL049W FRM2 YCL026C‐A BSC5 YNR069C PPM2 YOL141W PLB2 YMR006C GPI19 YDR437W NA YMR279C NA YOL014W FUS2 YMR232W PRM2 YIL037C CLN2 YPL256C WHI5 YOR083W SLI15 YBR156C log2(msn5
.Ts/WT.Ts) adj.p.v
al ‐1.0892 0.0048
‐1.0829 0.0109
‐1.0808 0.0025
‐1.0804 0.0130
‐1.0786 0.0012
‐1.0773 0.0025
‐1.0770 0.0005
Protein of unknown function, involved in the integration of lipid signaling pathways with cellular homeostasis; expression induced in cells treated with the mycotoxin patulin; has similarity to bacterial nitroreductases Protein of unknown function, ORF exhibits genomic organization compatible with a translational readthrough‐dependent mode of expression AdoMet‐dependent tRNA methyltransferase also involved in methoxycarbonylation; required for the synthesis of wybutosine (yW), a modified guanosine found at the 3'‐position adjacent to the anticodon of phe‐tRNA; similarity to Ppm1p Phospholipase B (lysophospholipase) involved in phospholipid metabolism; displays transacylase activity in vitro; overproduction confers resistance to lysophosphatidylcholine Subunit of GPI‐GlcNAc transferase involved in synthesis of N‐
acetylglucosaminyl phosphatidylinositol (GlcNAc‐PI), which is the first intermediate in glycosylphosphatidylinositol (GPI) anchor synthesis, shares similarity with mammalian PIG‐P Putative paralog of ATR1, but not required for boron tolerance; identified as a heat‐induced gene in a high‐throughout screen; YMR279C is not an essential gene Putative protein of unknown function
‐1.0733 0.0062
‐1.0651 0.0110
‐1.0581 0.0034
‐1.0523 0.0034
‐1.0492 0.0019
‐1.0426 0.0015
‐1.0419 0.0070
Cytoplasmic protein localized to the shmoo tip; required for the alignment of parental nuclei before nuclear fusion during mating Pheromone‐regulated protein, predicted to have 4 transmembrane segments and a coiled coil domain; regulated by Ste12p; required for efficient nuclear fusion G1 cyclin involved in regulation of the cell cycle; activates Cdc28p kinase to promote the G1 to S phase transition; late G1 specific expression depends on transcription factor complexes, MBF (Swi6p‐
Mbp1p) and SBF (Swi6p‐Swi4p) Repressor of G1 transcription that binds to SCB binding factor (SBF) at SCB target promoters in early G1; phosphorylation of Whi5p by the CDK, Cln3p/Cdc28p relieves repression and promoter binding by Whi5; periodically expressed in G1 Subunit of the conserved chromosomal passenger complex (CPC; Ipl1p‐Sli15p‐Bir1p‐Nbl1p), which regulates kinetochore‐microtubule attachments, activation of the spindle tension checkpoint, and mitotic spindle disassembly ‐1.0404 0.0033
‐1.0365 0.0287
‐1.0334 0.0025
‐1.0283 0.0069
‐1.0253 0.0009
279
log2(msn5
.Ts/WT.Ts) adj.p.v
al Protein of unknown function; associates with meiosis‐specific protein Spo1p NA ‐1.0248 0.0070
‐1.0171 0.0069
Exo‐1,3‐beta‐glucanase, involved in cell wall beta‐glucan assembly; may be anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) anchor Receptor for alpha‐factor pheromone; seven transmembrane‐
domain GPCR that interacts with both pheromone and a heterotrimeric G protein to initiate the signaling response that leads to mating between haploid a and alpha cells Protein of unknown function
‐1.0140 0.0035
‐1.0118 0.0016
‐1.0117 0.0014
Putative GTPase‐activating protein (GAP) involved in the Pkc1p‐
mediated signaling pathway that controls cell wall integrity; appears to specifically regulate 1,3‐beta‐glucan synthesis Evolutionarily‐conserved tail‐anchored outer mitochondrial membrane GTPase which regulates mitochondrial morphology; cells lacking Gem1p contain collapsed, globular, or grape‐like mitochondria; not required for pheromone‐induced cell death Endonuclease that processes hairpin DNA structures with the MRX complex; involved in meiotic and mitotic double‐strand break repair; phosphorylated in response to DNA damage and required for normal resistance to DNA‐damaging agents Putative protein of unknown function with similarity to acyl‐carrier‐
protein reductases; YDL114W is not an essential gene Middle sporulation‐specific mitogen‐activated protein kinase (MAPK) required for production of the outer spore wall layers; negatively regulates activity of the glucan synthase subunit Gsc2p Endosomal protein of unknown function that contains a phox (PX) homology domain and binds to both phosphatidylinositol‐3‐
phosphate (PtdIns(3)P) and proteins involved in ER‐Golgi or vesicular transport Protein of unknown function, contains an N‐terminal epsin‐like domain; proposed to be involved in the trafficking of Arn1p in the absence of ferrichrome Transporter of the ATP‐binding cassette family, involved in uptake of sterols and anaerobic growth Protein required for nuclear membrane fusion during karyogamy, localizes to the membrane with a soluble portion in the endoplasmic reticulum lumen, may form a complex with Jem1p and Kar2p; expression of the gene is regulated by pheromone Chitin transglycosylase that functions in the transfer of chitin to beta(1‐6) and beta(1‐3) glucans in the cell wall; similar to and functionally redundant with Crh1; glycosylphosphatidylinositol (GPI)‐
anchored protein localized to bud neck Membrane protein involved in zinc ion homeostasis, member of the four‐protein IZH family, expression induced by fatty acids and altered zinc levels; deletion reduces sensitivity to excess zinc; possible role in sterol metabolism Putative RNA‐binding protein required for the expression of early and middle sporulation genes Putative protein of unknown function
‐1.0074 0.0012
‐1.0037 0.0049
‐1.0015 0.0040
‐0.9974 0.0080
‐0.9917 0.0040
‐0.9895 0.0090
‐0.9841 0.0152
‐0.9791 0.0055
‐0.9719 0.0009
‐0.9691 0.0019
‐0.9617 0.0241
‐0.9562 0.0109
Symbols ORF Description SPO23 YBR250W NA NA EXG2 YDR261C STE2 YFL026W PRY2 YKR013W LRG1 YDL240W GEM1 YAL048C SAE2 YGL175C NA YDL114W SMK1 YPR054W YPT35 YHR105W ENT4 YLL038C AUS1 YOR011W KAR5 YMR065W UTR2 YEL040W IZH4 YOL101C RIM4 YHL024W NA YMR147W GIC1 YHR061C DCI1 YOR180C NA YJL118W Protein of unknown function involved in initiation of budding and cellular polarization, interacts with Cdc42p via the Cdc42/Rac‐
interactive binding (CRIB) domain Peroxisomal protein; identification as a delta(3,5)‐delta(2,4)‐dienoyl‐
CoA isomerase involved in fatty acid metabolism is disputed Putative protein of unknown function; may interact with ribosomes, based on co‐purification experiments; YJL18W is a non‐essential gene; deletion enhances the toxicity of heterologously expressed 280
‐0.9502 0.0040
‐0.9414 0.0086
‐0.9355 0.0108
‐0.9331 0.0207
Symbols ORF HEM13 YDR044W YHB1 YGR234W PET122 YER153C NA YCR101C NA YGR109W‐B TPO1 YLL028W SPS1 YDR523C CLB4 YLR210W HMLALPHA
1 YCL066W GAL7 YBR018C SRL1 YOR247W MAM1 YER106W MFA2 YNL145W PDR18 YNR070W FCY22 YER060W‐A HMS1 YOR032C KAR9 YPL269W PRM8 YGL053W Description log2(msn5
.Ts/WT.Ts) adj.p.v
al ‐0.9268 0.0048
‐0.9247 0.0103
‐0.9217 0.0102
‐0.9206 0.0209
‐0.9171 0.0023
‐0.9144 0.0071
‐0.9102 0.0439
‐0.9096 0.0020
‐0.9033 0.0030
‐0.9031 0.0035
‐0.8986 0.0012
‐0.8973 0.0197
‐0.8942 0.0056
‐0.8933 0.0065
‐0.8926 0.0215
‐0.8865 0.0025
‐0.8691 0.0020
‐0.8682 0.0012
human alpha‐synuclein
Coproporphyrinogen III oxidase, an oxygen requiring enzyme that catalyzes the sixth step in the heme biosynthetic pathway; transcription is repressed by oxygen and heme (via Rox1p and Hap1p) Nitric oxide oxidoreductase, flavohemoglobin involved in nitric oxide detoxification; plays a role in the oxidative and nitrosative stress responses Mitochondrial translational activator specific for the COX3 mRNA, acts together with Pet54p and Pet494p; located in the mitochondrial inner membrane Putative protein of unknown function; localizes to the membrane fraction; YCR101C is not an essential gene Retrotransposon TYA Gag and TYB Pol genes; transcribed/translated as one unit; polyprotein is processed to make a nucleocapsid‐like protein (Gag), reverse transcriptase (RT), protease (PR), and integrase (IN); similar to retroviral genes Polyamine transporter that recognizes spermine, putrescine, and spermidine; catalyzes uptake of polyamines at alkaline pH and excretion at acidic pH; phosphorylation enhances activity and sorting to the plasma membrane Putative protein serine/threonine kinase expressed at the end of meiosis and localized to the prospore membrane, required for correct localization of enzymes involved in spore wall synthesis B‐type cyclin involved in cell cycle progression; activates Cdc28p to promote the G2/M transition; may be involved in DNA replication and spindle assembly; accumulates during S phase and G2, then targeted for ubiquitin‐mediated degradation Silenced copy of ALPHA1 at HML, encoding a transcriptional coactivator involved in the regulation of mating‐type alpha‐specific gene expression Galactose‐1‐phosphate uridyl transferase, synthesizes glucose‐1‐
phosphate and UDP‐galactose from UDP‐D‐glucose and alpha‐D‐
galactose‐1‐phosphate in the second step of galactose catabolism Mannoprotein that exhibits a tight association with the cell wall, required for cell wall stability in the absence of GPI‐anchored mannoproteins; has a high serine‐threonine content; expression is induced in cell wall mutants Monopolin, kinetochore associated protein involved in chromosome attachment to meiotic spindle Mating pheromone a‐factor, made by a cells; interacts with alpha cells to induce cell cycle arrest and other responses leading to mating; biogenesis involves C‐terminal modification, N‐terminal proteolysis, and export; also encoded by MFA1 Putative transporter of the ATP‐binding cassette (ABC) family, implicated in pleiotropic drug resistance; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐
throughput studies Putative purine‐cytosine permease, very similar to Fcy2p but cannot substitute for its function Basic helix‐loop‐helix (bHLH) protein with similarity to myc‐family transcription factors; overexpression confers hyperfilamentous growth and suppresses the pseudohyphal filamentation defect of a diploid mep1 mep2 homozygous null mutant Karyogamy protein required for correct positioning of the mitotic spindle and for orienting cytoplasmic microtubules, localizes at the shmoo tip in mating cells and at the tip of the growing bud in small‐
budded cells through anaphase Pheromone‐regulated protein with 2 predicted transmembrane 281
Symbols ORF AAR2 YBL074C NRT1 YOR071C MMS21 YEL019C GAL10 YBR019C FDH1 YOR388C STE14 YDR410C PDR15 YDR406W CDA1 YLR307W NA YCR100C RAX2 YLR084C RPL13A YDL082W MSN4 YKL062W YJU2 YKL095W RTC4 YNL254C NA NA NA YDL109C ATP10 YLR393W FMP45 YDL222C NA YJR154W NIS1 YNL078W Description segments and an FF sequence, a motif involved in COPII binding; forms a complex with Prp9p in the ER; member of DUP240 gene family Component of the U5 snRNP, required for splicing of U3 precursors; originally described as a splicing factor specifically required for splicing pre‐mRNA of the MATa1 cistron High‐affinity nicotinamide riboside transporter; also transports thiamine with low affinity; shares sequence similarity with Thi7p and Thi72p; proposed to be involved in 5‐fluorocytosine sensitivity SUMO ligase involved in chromosomal organization and DNA repair; essential subunit of the Mms21‐Smc5‐Smc6 complex; mutants are sensitive to methyl methanesulfonate and show increased spontaneous mutation and mitotic recombination UDP‐glucose‐4‐epimerase, catalyzes the interconversion of UDP‐
galactose and UDP‐D‐glucose in galactose metabolism; also catalyzes the conversion of alpha‐D‐glucose or alpha‐D‐galactose to their beta‐
anomers NAD(+)‐dependent formate dehydrogenase, may protect cells from exogenous formate Farnesyl cysteine‐carboxyl methyltransferase, mediates the carboxyl methylation step during C‐terminal CAAX motif processing of a‐factor and RAS proteins in the endoplasmic reticulum, localizes to the ER membrane Plasma membrane ATP binding cassette (ABC) transporter, multidrug transporter and general stress response factor implicated in cellular detoxification; regulated by Pdr1p, Pdr3p and Pdr8p; promoter contains a PDR responsive element Chitin deacetylase, together with Cda2p involved in the biosynthesis ascospore wall component, chitosan; required for proper rigidity of the ascospore wall Putative protein of unknown function
log2(msn5
.Ts/WT.Ts) adj.p.v
al ‐0.8681 0.0062
‐0.8665 0.0086
‐0.8660 0.0133
‐0.8647 0.0048
‐0.8565 0.0076
‐0.8546 0.0020
‐0.8530 0.0025
‐0.8521 0.0103
‐0.8420 0.0122
N‐glycosylated protein involved in the maintenance of bud site selection during bipolar budding; localization requires Rax1p; RAX2 mRNA stability is regulated by Mpt5p Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl13Bp; not essential for viability; has similarity to rat L13 ribosomal protein Transcriptional activator related to Msn2p; activated in stress conditions, which results in translocation from the cytoplasm to the nucleus; binds DNA at stress response elements of responsive genes, inducing gene expression Essential protein required for pre‐mRNA splicing; associates transiently with the spliceosomal NTC ("nineteen complex") and acts after Prp2p to promote the first catalytic reaction of splicing Protein of unknown function; null mutation suppresses cdc13‐1 temperature sensitivity; (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus NA ‐0.8415 0.0048
‐0.8407 0.0371
‐0.8400 0.0208
‐0.8361 0.0088
‐0.8320 0.0028
‐0.8311 0.0029
Putative lipase; involved in lipid metabolism; YDL109C is not an essential gene Mitochondrial inner membrane protein required for assembly of the F0 sector of mitochondrial F1F0 ATP synthase, interacts genetically with ATP6 Integral membrane protein localized to mitochondria (untagged protein); required for sporulation and maintaining sphingolipid content; has sequence similarity to SUR7 and YNL194C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm Protein localized in the bud neck at G2/M phase; physically interacts ‐0.8304 0.0028
‐0.8282 0.0062
‐0.8273 0.0095
‐0.8261 0.0282
‐0.8216 0.0034
282
Symbols ORF TEC1 YBR083W SIM1 YIL123W SCW11 YGL028C SRB8 YCR081W MEI4 YER044C‐A IRC15 YPL017C NA YJL107C BNA4 YBL098W NA YDR042C MUC1 YIR019C NUT2 YPR168W NA YKR104W NA YGL101W IRC7 YFR055W DED1 YOR204W BBP1 YPL255W SCC2 YDR180W NDJ1 YOL104C Description log2(msn5
.Ts/WT.Ts) adj.p.v
al ‐0.8197 0.0016
‐0.8182 0.0056
‐0.8108 0.0088
‐0.8099 0.0025
‐0.8094 0.0077
‐0.8088 0.0055
‐0.8087 0.0048
‐0.8074 0.0017
‐0.8053 0.0091
‐0.8024 0.0200
‐0.7998 0.0324
‐0.7994 0.0187
‐0.7988 0.0075
‐0.7980 0.0043
‐0.7979 0.0070
‐0.7966 0.0028
‐0.7923 0.0176
‐0.7823 0.0043
with septins; possibly involved in a mitotic signaling network
Transcription factor required for full Ty1 expression, Ty1‐mediated gene activation, and haploid invasive and diploid pseudohyphal growth; TEA/ATTS DNA‐binding domain family member Protein of the SUN family (Sim1p, Uth1p, Nca3p, Sun4p) that may participate in DNA replication, promoter contains SCB regulation box at ‐300 bp indicating that expression may be cell cycle‐regulated Cell wall protein with similarity to glucanases; may play a role in conjugation during mating based on its regulation by Ste12p Subunit of the RNA polymerase II mediator complex; associates with core polymerase subunits to form the RNA polymerase II holoenzyme; essential for transcriptional regulation; involved in glucose repression Meiosis‐specific protein involved in double‐strand break formation during meiotic recombination; required for chromosome synapsis and production of viable spores Microtubule associated protein; regulates microtubule dynamics; required for accurate meiotic chromosome segregation; null mutant displays large budded cells due to delayed mitotic progression, increased levels of spontaneous Rad52 foci Putative protein of unknown function; expression is induced by activation of the HOG1 mitogen‐activated signaling pathway and this induction is Hog1p/Pbs2p dependent; YJL107C and adjacent ORF, YJL108C are merged in related fungi Kynurenine 3‐mono oxygenase, required for the de novo biosynthesis of NAD from tryptophan via kynurenine; expression regulated by Hst1p; putative therapeutic target for Huntington disease Putative protein of unknown function; expression is increased in ssu72‐ts69 mutant GPI‐anchored cell surface glycoprotein (flocculin) required for pseudohyphal formation, invasive growth, flocculation, and biofilms; transcriptionally regulated by the MAPK pathway (via Ste12p and Tec1p) and the cAMP pathway (via Flo8p) Subunit of the RNA polymerase II mediator complex; associates with core polymerase subunits to form the RNA polymerase II holoenzyme; required for transcriptional activation and has a role in basal transcription Putative transporter of the multidrug resistance‐associated protein (MRP) subfamily; contains a stop codon in S288C; adjacent ORFs YKR103W and YKR104W are merged in different strain backgrounds Putative protein of unknown function; non‐essential gene with similarity to YBR242W; interacts with the DNA helicase Hpr5p Putative cystathionine beta‐lyase; involved in copper ion homeostasis and sulfur metabolism; null mutant displays increased levels of spontaneous Rad52p foci; expression induced by nitrogen limitation in a GLN3, GAT1‐dependent manner ATP‐dependent DEAD (Asp‐Glu‐Ala‐Asp)‐box RNA helicase, required for translation initiation of all yeast mRNAs; mutations in human DEAD‐box DBY are a frequent cause of male infertility Protein required for the spindle pole body (SPB) duplication, localized at the central plaque periphery; forms a complex with a nuclear envelope protein Mps2p and SPB components Spc29p and Kar1p; required for mitotic functions of Cdc5p Subunit of cohesin loading factor (Scc2p‐Scc4p), a complex required for loading of cohesin complexes onto chromosomes; involved in establishing sister chromatid cohesion during DSB repair via histone H2AX; evolutionarily‐conserved adherin Meiosis‐specific telomere protein, required for bouquet formation, 283
Symbols ORF Description effective homolog pairing, ordered cross‐over distribution, sister chromatid cohesion at meiotic telomeres, chromosomal segregation and telomere‐led rapid prophase movement Amino acid transport protein for valine, leucine, isoleucine, and tyrosine, low‐affinity tryptophan and histidine transporter; overexpression confers FK506 and FTY720 resistance Plasma membrane protein that may act together with or upstream of Stt4p to generate normal levels of the essential phospholipid PI4P, at least partially mediates proper localization of Stt4p to the plasma membrane Putative protein of unknown function, potential Cdc28p substrate; transcription is activated by paralogous transcription factors Yrm1p and Yrr1p along with genes involved in multidrug resistance Permease of basic amino acids in the vacuolar membrane
log2(msn5
.Ts/WT.Ts) adj.p.v
al ‐0.7816 0.0016
‐0.7796 0.0249
‐0.7784 0.0136
‐0.7779 0.0070
‐0.7771 0.0021
‐0.7767 0.0034
‐0.7758 0.0102
‐0.7749 0.0056
‐0.7748 0.0232
‐0.7731 0.0022
TAT1 YBR069C SFK1 YKL051W NA YGR035C VBA2 YBR293W THI7 YLR237W SPC42 YKL042W HBT1 YDL223C KSS1 YGR040W PHD1 YKL043W NA YPR071W Plasma membrane transporter responsible for the uptake of thiamine, member of the major facilitator superfamily of transporters; mutation of human ortholog causes thiamine‐
responsive megaloblastic anemia Central plaque component of spindle pole body (SPB); involved in SPB duplication, may facilitate attachment of the SPB to the nuclear membrane Substrate of the Hub1p ubiquitin‐like protein that localizes to the shmoo tip (mating projection); mutants are defective for mating projection formation, thereby implicating Hbt1p in polarized cell morphogenesis Mitogen‐activated protein kinase (MAPK) involved in signal transduction pathways that control filamentous growth and pheromone response; the KSS1 gene is nonfunctional in S288C strains and functional in W303 strains Transcriptional activator that enhances pseudohyphal growth; regulates expression of FLO11, an adhesin required for pseudohyphal filament formation; similar to StuA, an A. nidulans developmental regulator; potential Cdc28p substrate Putative membrane protein; YPR071W is not an essential gene
NA YNR062C Putative membrane protein of unknown function
‐0.7713 0.0039
ERD1 YDR414C ‐0.7569 0.0095
NA YLR012C ‐0.7569 0.0234
POP3 YNL282W ‐0.7522 0.0198
ATG15 YCR068W ‐0.7504 0.0072
UME6 YDR207C Predicted membrane protein required for the retention of lumenal endoplasmic reticulum proteins; mutants secrete the endogenous ER protein, BiP (Kar2p) Putative protein of unknown function; YLR012C is not an essential gene Subunit of both RNase MRP, which cleaves pre‐rRNA, and nuclear RNase P, which cleaves tRNA precursors to generate mature 5' ends Lipase required for intravacuolar lysis of autophagic bodies and Cvt bodies; targeted to intravacuolar vesicles during autophagy via the multivesicular body (MVB) pathway Key transcriptional regulator of early meiotic genes, binds URS1 upstream regulatory sequence, couples metabolic responses to nutritional cues with initiation and progression of meiosis, forms complex with Ime1p, and also with Sin3p‐Rpd3p Putative integral membrane protein of unknown function
‐0.7464 0.0070
‐0.7434 0.0210
Transcription factor, involved in regulating multidrug resistance and oxidative stress response; forms a heterodimer with Pdr1p; contains a Zn(II)2Cys6 zinc finger domain that interacts with a pleiotropic drug resistance element in vitro Rab family GTPase that interacts with the C‐terminal tail domain of Myo2p; mediates distribution of mitochondria and endoplasmic reticuli to daughter cells Protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cell periphery and vacuole ‐0.7386 0.0028
‐0.7380 0.0059
‐0.7335 0.0070
NA YHR140W STB5 YHR178W YPT11 YNL304W NA YOL019W 284
Symbols ORF log2(msn5
.Ts/WT.Ts) Description adj.p.v
al NA NA NA ‐0.7333 0.0158
RPL18B YNL301C ‐0.7313 0.0187
NA YOL163W ‐0.7266 0.0479
MPS2 YGL075C ‐0.7252 0.0044
GAS3 YMR215W ‐0.7239 0.0031
NA YJR124C ‐0.7204 0.0282
PDR12 YPL058C ‐0.7192 0.0051
FIG2 YCR089W ‐0.7180 0.0024
IRC4 YDR540C ‐0.7167 0.0230
HXT5 YHR096C ‐0.7130 0.0334
BUB3 YOR026W ‐0.7124 0.0165
MF(ALPHA)
1 YPL187W ‐0.7113 0.0016
MCD4 YKL165C ‐0.7080 0.0049
CIS3 YJL158C ‐0.7077 0.0016
NA YOR186W ‐0.7077 0.0154
SMP1 YBR182C ‐0.7069 0.0277
FHN1 YGR131W ‐0.7053 0.0145
HUA2 YOR284W ‐0.7041 0.0152
PUN1 YLR414C ‐0.7038 0.0073
NA YAR068W Protein component of the large (60S) ribosomal subunit, identical to Rpl18Ap and has similarity to rat L18 ribosomal protein Putative protein of unknown function; member of the Dal5p subfamily of the major facilitator family Essential membrane protein localized at the nuclear envelope and spindle pole body (SPB), required for insertion of the newly duplicated SPB into the nuclear envelope; potentially phosphorylated by Cdc28p Low abundance, possibly inactive member of the GAS family of GPI‐
containing proteins; putative 1,3‐beta‐glucanosyltransferase with similarity to other GAS family members; localizes to the cell wall; mRNA induced during sporulation Putative protein of unknown function; expression induced under calcium shortage Plasma membrane ATP‐binding cassette (ABC) transporter, weak‐
acid‐inducible multidrug transporter required for weak organic acid resistance; induced by sorbate and benzoate and regulated by War1p; mutants exhibit sorbate hypersensitivity Cell wall adhesin, expressed specifically during mating; may be involved in maintenance of cell wall integrity during mating Putative protein of unknown function; null mutant displays increased levels of spontaneous Rad52p foci; green fluorescent protein (GFP)‐
fusion protein localizes to the cytoplasm and nucleus Hexose transporter with moderate affinity for glucose, induced in the presence of non‐fermentable carbon sources, induced by a decrease in growth rate, contains an extended N‐terminal domain relative to other HXTs Kinetochore checkpoint WD40 repeat protein that localizes to kinetochores during prophase and metaphase, delays anaphase in the presence of unattached kinetochores; forms complexes with Mad1p‐Bub1p and with Cdc20p, binds Mad2p and Mad3p Mating pheromone alpha‐factor, made by alpha cells; interacts with mating type a cells to induce cell cycle arrest and other responses leading to mating; also encoded by MF(ALPHA)2, although MF(ALPHA)1 produces most alpha‐factor Protein involved in glycosylphosphatidylinositol (GPI) anchor synthesis; multimembrane‐spanning protein that localizes to the endoplasmic reticulum; highly conserved among eukaryotes Mannose‐containing glycoprotein constituent of the cell wall; member of the PIR (proteins with internal repeats) family Putative protein of unknown function; proper regulation of expression during heat stress is sphingolipid‐dependent Putative transcription factor involved in regulating the response to osmotic stress; member of the MADS‐box family of transcription factors Protein of unknown function; induced by ketoconazole; promoter region contains sterol regulatory element motif, which has been identified as a Upc2p‐binding site; overexpression complements function of Nce102p in NCE102 deletion strain Cytoplasmic protein of unknown function; computational analysis of large‐scale protein‐protein interaction data suggests a possible role in actin patch assembly Putative protein of unknown function; localizes to bud and cytoplasm; co‐localizes with Sur7p in punctate patches in the plasma membrane; null mutant displays decreased thermotolerance; transcription induced on cell wall damage Fungal‐specific protein of unknown function; induced in respiratory‐
deficient cells ‐0.7036 0.0335
285
Symbols log2(msn5
.Ts/WT.Ts) adj.p.v
al ORF Description NA YNR061C Putative protein of unknown function
‐0.7011 0.0025
NA YJL147C ‐0.6997 0.0043
NA YNL034W ‐0.6963 0.0080
CAR2 YLR438W ‐0.6951 0.0180
WHI3 YNL197C ‐0.6947 0.0201
NA YLR040C ‐0.6903 0.0019
PRP39 YML046W ‐0.6869 0.0017
TOS2 YGR221C ‐0.6843 0.0027
NA YDR124W ‐0.6827 0.0241
AAD6 YFL056C ‐0.6815 0.0292
PDR11 YIL013C ‐0.6740 0.0077
NA YJL160C ‐0.6737 0.0182
TCA17 YEL048C ‐0.6699 0.0411
NA YPL152W‐A ‐0.6694 0.0048
NA YLR415C ‐0.6694 0.0051
PST1 YDR055W ‐0.6671 0.0152
NA YIL166C ‐0.6659 0.0155
SDS3 YIL084C ‐0.6653 0.0243
MCM3 YEL032W Mitochondrial protein of unknown function; homozygous diploid deletion strain has a sporulation defect characterized by elevated dityrosine in the soluble fraction; expression induced by calcium shortage; YJL147W is a non‐essential gene Putative protein of unknown function; YNL034W is not an essential gene L‐ornithine transaminase (OTAse), catalyzes the second step of arginine degradation, expression is dually‐regulated by allophanate induction and a specific arginine induction process; not nitrogen catabolite repression sensitive RNA binding protein that sequesters CLN3 mRNA in cytoplasmic foci; cytoplasmic retention factor for Cdc28p and associated cyclins; regulates cell fate and dose‐dependently regulates the critical cell size required for passage through Start Putative protein of unknown function; localizes to the cell wall; predicted to be a GPI‐attached protein; upregulated by Mcm1p‐
Alpha1p transcription factor; partially overlaps the dubious ORF YLR041W; YLR040C is not essential U1 snRNP protein involved in splicing, contains multiple tetriatricopeptide repeats Protein involved in localization of Cdc24p to the site of bud growth; may act as a membrane anchor; localizes to the bud neck and bud tip; potentially phosphorylated by Cdc28p Putative protein of unknown function; non‐essential gene; expression is strongly induced by alpha factor Putative aryl‐alcohol dehydrogenase with similarity to P. chrysosporium aryl‐alcohol dehydrogenase, involved in the oxidative stress response; expression induced in cells treated with the mycotoxin patulin ATP‐binding cassette (ABC) transporter, multidrug transporter involved in multiple drug resistance; mediates sterol uptake when sterol biosynthesis is compromisedregulated by Pdr1p; required for anaerobic growth Putative protein of unknown function; member of the PIR (proteins with internal repeats) family of cell wall proteins; non‐essential gene that is required for sporulation; mRNA is weakly cell cycle regulated, peaking in mitosis Protein that interacts with subunits of the TRAPP complex and may play a role its assembly or stability; mutation is synthetically lethal with gcs1 deletion; Sedlin_N family member; human Sedlin mutations cause the skeletal disorder SEDT Identified by gene‐trapping, microarray‐based expression analysis, and genome‐wide homology searching Putative protein of unknown function; YLR415C is not an essential gene Cell wall protein that contains a putative GPI‐attachment site; secreted by regenerating protoplasts; up‐regulated by activation of the cell integrity pathway, as mediated by Rlm1p; upregulated by cell wall damage via disruption of FKS1 Putative protein with similarity to the allantoate permease (Dal5p) subfamily of the major facilitator superfamily; mRNA expression is elevated by sulfur limitation; YIL166C is a non‐essential gene Component of the Rpd3p/Sin3p deacetylase complex required for its structural integrity and catalytic activity, involved in transcriptional silencing and required for sporulation; cells defective in SDS3 display pleiotropic phenotypes Protein involved in DNA replication; component of the Mcm2‐7 hexameric complex that binds chromatin as a part of the pre‐
‐0.6633 0.0019
286
Symbols ORF NA YPL272C PIP2 YOR363C COG1 YGL223C RNR1 YER070W NA YMR144W YHK8 YHR048W NA YJR149W FEN2 YCR028C HST3 YOR025W SPR1 YOR190W ASE1 YOR058C SPC29 YPL124W SMA2 YML066C RNR3 YIL066C CDC5 YMR001C AXL2 YIL140W ECM25 YJL201W ECI1 YLR284C ATG29 YPL166W Description log2(msn5
.Ts/WT.Ts) adj.p.v
al ‐0.6627 0.0131
‐0.6605 0.0055
‐0.6579 0.0056
‐0.6579 0.0384
‐0.6562 0.0086
‐0.6523 0.0153
‐0.6496 0.0117
‐0.6495 0.0065
‐0.6470 0.0345
‐0.6467 0.0283
‐0.6467 0.0144
‐0.6440 0.0043
‐0.6404 0.0239
‐0.6382 0.0157
‐0.6375 0.0104
‐0.6372 0.0043
‐0.6367 0.0056
‐0.6365 0.0025
‐0.6347 0.0208
replicative complex
Putative protein of unknown function; gene expression induced in response to ketoconazole; YPL272C is not an essential gene Autoregulatory oleate‐specific transcriptional activator of peroxisome proliferation, contains Zn(2)‐Cys(6) cluster domain, forms heterodimer with Oaf1p, binds oleate response elements (OREs), activates beta‐oxidation genes Essential component of the conserved oligomeric Golgi complex (Cog1p through Cog8p), a cytosolic tethering complex that functions in protein trafficking to mediate fusion of transport vesicles to Golgi compartments Major isoform of the large subunit of ribonucleotide‐diphosphate reductase; the RNR complex catalyzes rate‐limiting step in dNTP synthesis, regulated by DNA replication and DNA damage checkpoint pathways via localization of small subunits Putative protein of unknown function; localized to the nucleus; YMR144W is not an essential gene Presumed antiporter of the DHA1 family of multidrug resistance transporters; contains 12 predicted transmembrane spans; expression of gene is up‐regulated in cells exhibiting reduced susceptibility to azoles Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm Plasma membrane H+‐pantothenate symporter; confers sensitivity to the antifungal agent fenpropimorph Member of the Sir2 family of NAD(+)‐dependent protein deacetylases; involved along with Hst4p in telomeric silencing, cell cycle progression, radiation resistance, genomic stability and short‐
chain fatty acid metabolism Sporulation‐specific exo‐1,3‐beta‐glucanase; contributes to ascospore thermoresistance Mitotic spindle midzone localized microtubule‐associated protein (MAP) family member; required for spindle elongation and stabilization; undergoes cell cycle‐regulated degradation by anaphase promoting complex; potential Cdc28p substrate Inner plaque spindle pole body (SPB) component, links the central plaque component Spc42p to the inner plaque component Spc110p; required for SPB duplication Meiosis‐specific prospore membrane protein; required to produce bending force necessary for proper assembly of the prospore membrane during sporulation Minor isoform of the large subunit of ribonucleotide‐diphosphate reductase; the RNR complex catalyzes rate‐limiting step in dNTP synthesis, regulated by DNA replication and DNA damage checkpoint pathways via localization of small subunits Polo‐like kinase with multiple functions in mitosis and cytokinesis through substrate phosphorylation, also functions in adaptation to DNA damage during meiosis; has similarity to Xenopus Plx1 and S. pombe Plo1p; possible Cdc28p substrate Integral plasma membrane protein required for axial budding in haploid cells, localizes to the incipient bud site and bud neck; glycosylated by Pmt4p; potential Cdc28p substrate Non‐essential protein of unknown function; promoter contains a consensus binding sequence for factor Abf1p Peroxisomal delta3,delta2‐enoyl‐CoA isomerase, hexameric protein that converts 3‐hexenoyl‐CoA to trans‐2‐hexenoyl‐CoA, essential for the beta‐oxidation of unsaturated fatty acids, oleate‐induced Autophagy‐specific protein that is required for recruitment of other ATG proteins to the pre‐autophagosomal structure (PAS); interacts 287
Symbols ORF PCL9 YDL179W THI72 YOR192C MSG5 YNL053W HOF1 YMR032W MSN2 YMR037C CAF120 YNL278W FUS3 YBL016W HPR1 YDR138W HCM1 YCR065W KIP1 YBL063W NA YPL067C MUM3 YOR298W MPD2 YOL088C SFL1 YOR140W RAX1 YOR301W NA YPL041C NA YGL015C Description with Atg17p and localizas to the PAS in a manner interdependent with Atg17p and Cis1p; not conserved Cyclin, forms a functional kinase complex with Pho85p cyclin‐
dependent kinase (Cdk), expressed in late M/early G1 phase, activated by Swi5p Transporter of thiamine or related compound; shares sequence similarity with Thi7p Dual‐specificity protein phosphatase; exists in 2 isoforms; required for maintenance of a low level of signaling through the cell integrity pathway, adaptive response to pheromone; regulates and is regulated by Slt2p; dephosphorylates Fus3p Bud neck‐localized, SH3 domain‐containing protein required for cytokinesis; regulates actomyosin ring dynamics and septin localization; interacts with the formins, Bni1p and Bnr1p, and with Cyk3p, Vrp1p, and Bni5p Transcriptional activator related to Msn4p; activated in stress conditions, which results in translocation from the cytoplasm to the nucleus; binds DNA at stress response elements of responsive genes, inducing gene expression Part of the evolutionarily‐conserved CCR4‐NOT transcriptional regulatory complex involved in controlling mRNA initiation, elongation, and degradation Mitogen‐activated serine/threonine protein kinase involved in mating; phosphoactivated by Ste7p; substrates include Ste12p, Far1p, Bni1p, Sst2p; inhibits invasive growth during mating by phosphorylating Tec1p, promoting its degradation Subunit of THO/TREX complexes that couple transcription elongation with mitotic recombination and with mRNA metabolism and export, subunit of an RNA Pol II complex; regulates lifespan; involved in telomere maintenance; similar to Top1p Forkhead transcription factor that drives S‐phase specific expression of genes involved in chromosome segregation, spindle dynamics, and budding; suppressor of calmodulin mutants with specific SPB assembly defects; telomere maintenance role Kinesin‐related motor protein required for mitotic spindle assembly, chromosome segregation, and 2 micron plasmid partitioning; functionally redundant with Cin8p for chromosomal but not plasmid functions Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm; YPL067C is not an essential gene Protein of unknown function involved in the organization of the outer spore wall layers; has similarity to the tafazzins superfamily of acyltransferases Member of the protein disulfide isomerase (PDI) family, exhibits chaperone activity; overexpression suppresses the lethality of a pdi1 deletion but does not complement all Pdi1p functions; undergoes oxidation by Ero1p Transcriptional repressor and activator; involved in repression of flocculation‐related genes, and activation of stress responsive genes; negatively regulated by cAMP‐dependent protein kinase A subunit Tpk2p Protein involved in bud site selection during bipolar budding; localization requires Rax2p; has similarity to members of the insulin‐
related peptide superfamily Protein of unknown function involved in maintenance of proper telomere length Putative protein of unknown function; null mutants accumulate cargo in the Golgi 288
log2(msn5
.Ts/WT.Ts) adj.p.v
al ‐0.6312 0.0064
‐0.6296 0.0345
‐0.6290 0.0141
‐0.6275 0.0096
‐0.6271 0.0069
‐0.6264 0.0362
‐0.6248 0.0062
‐0.6167 0.0025
‐0.6155 0.0206
‐0.6143 0.0208
‐0.6141 0.0023
‐0.6135 0.0366
‐0.6114 0.0034
‐0.6109 0.0182
‐0.6097 0.0061
‐0.6090 0.0104
‐0.6085 0.0101
Symbols ORF Description GAS1 YMR307W log2(msn5
.Ts/WT.Ts) adj.p.v
al ‐0.6079 0.0049
RGD2 YFL047W Beta‐1,3‐glucanosyltransferase, required for cell wall assembly and also has a role in transcriptional silencing; localizes to the cell surface via a glycosylphosphatidylinositol (GPI) anchor; also found at the nuclear periphery GTPase‐activating protein (RhoGAP) for Cdc42p and Rho5p
‐0.6060 0.0039
NA YOR390W Putative protein of unknown function
‐0.6034 0.0034
PRM3 YPL192C Pheromone‐regulated protein required for nuclear envelope fusion during karyogamy; localizes to the outer face of the nuclear membrane; interacts with Kar5p at the spindle pole body ‐0.6013 0.0138
289
APPENDIX O: Up-regulated genes in msn5Δ cells
in amino acid starvation condition
This section includes the list of transcriptionally differentially expressed genes (cutoff
conditions: log2 FC
0.6 and adjusted p-value < 0.05) in msn5Δ cells in fed condition.
Up-regulated genes in msn5Δ cells in amino acid starvation condition
log2(msn5
.Ts/WT.Ts) adj.p.val High‐affinity inorganic phosphate (Pi) transporter and low‐affinity manganese transporter; regulated by Pho4p and Spt7p; mutation confers resistance to arsenate; exit from the ER during maturation requires Pho86p 6.0173
0.0000
YHR136C Protein with similarity to cyclin‐dependent kinase inhibitors; downregulates low‐affinity phosphate transport during phosphate limitation; overproduction suppresses a plc1 null mutation; GFP‐
fusion protein localizes to the cytoplasm 4.4287
0.0001
PHO89 YBR296C Na+/Pi cotransporter, active in early growth phase; similar to phosphate transporters of Neurospora crassa; transcription regulated by inorganic phosphate concentrations and Pho4p 4.0506
0.0013
PHM6 YDR281C Protein of unknown function, expression is regulated by phosphate levels 2.4826
0.0062
PHO11 YAR071W One of three repressible acid phosphatases, a glycoprotein that is transported to the cell surface by the secretory pathway; induced by phosphate starvation and coordinately regulated by PHO4 and PHO2 2.2526
0.0026
NA YHR214C‐E Putative protein of unknown function; identified by gene‐trapping, microarray‐based expression analysis, and genome‐wide homology searching 2.1899
0.0021
NA YGL262W Putative protein of unknown function; null mutant displays elevated sensitivity to expression of a mutant huntingtin fragment or of alpha‐
synuclein; YGL262W is not an essential gene 1.9801
0.0066
VTC3 YPL019C Subunit of the vacuolar transporter chaperone (VTC) complex involved in membrane trafficking, vacuolar polyphosphate accumulation, microautophagy and non‐autophagic vacuolar fusion 1.8455
0.0009
MTH1 YDR277C Negative regulator of the glucose‐sensing signal transduction pathway, required for repression of transcription by Rgt1p; interacts with Rgt1p and the Snf3p and Rgt2p glucose sensors; phosphorylated by Yck1p, triggering Mth1p degradation 1.6631
0.0012
Symbols ORF Description PHO84 YML123C SPL2 290
COS12 YGL263W Protein of unknown function, member of the DUP380 subfamily of conserved, often subtelomerically‐encoded proteins 1.5196
0.0095
NA YLR053C Putative protein of unknown function
1.4665
0.0069
NA YHR214C‐
D Putative protein of unknown function; identified by gene‐trapping, microarray‐based expression analysis, and genome‐wide homology searching 1.4197
0.0173
SOL4 YGR248W 6‐phosphogluconolactonase with similarity to Sol3p
1.3921
0.0147
REG2 YBR050C Regulatory subunit of the Glc7p type‐1 protein phosphatase; involved with Reg1p, Glc7p, and Snf1p in regulation of glucose‐repressible genes, also involved in glucose‐induced proteolysis of maltose permease 1.3834
0.0015
GDH3 YAL062W NADP(+)‐dependent glutamate dehydrogenase, synthesizes glutamate from ammonia and alpha‐ketoglutarate; rate of alpha‐
ketoglutarate utilization differs from Gdh1p; expression regulated by nitrogen and carbon sources 1.3764
0.0053
MOH1 YBL049W Protein of unknown function, has homology to kinase Snf7p; not required for growth on nonfermentable carbon sources; essential for survival in stationary phase 1.3625
0.0023
RGI1 YER067W Protein of unknown function involved in energy metabolism under respiratory conditions; protein abundance is increased upon intracellular iron depletion 1.3593
0.0093
SSA1 YAL005C ATPase involved in protein folding and nuclear localization signal (NLS)‐directed nuclear transport; member of heat shock protein 70 (HSP70) family; forms a chaperone complex with Ydj1p; localized to the nucleus, cytoplasm, and cell wall 1.3518
0.0026
DGR2 YKL121W Protein of unknown function; null mutant is resistant to 2‐deoxy‐D‐
glucose and displays abnormally elongated buds 1.3377
0.0015
NA YNL144C Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies; YNL144C is not an essential gene 1.3179
0.0210
NA YBL055C 3'‐‐>5' exonuclease and endonuclease with a possible role in apoptosis; has similarity to mammalian and C. elegans apoptotic nucleases 1.2901
0.0016
PHO81 YGR233C Cyclin‐dependent kinase (CDK) inhibitor, regulates Pho80p‐Pho85p and Pcl7p‐Pho85p cyclin‐CDK complexes in response to phosphate levels; inhibitory activity for Pho80p‐Pho85p requires myo‐D‐inositol heptakisphosphate (IP7) generated by Vip1p 1.2787
0.0015
CYB2 YML054C Cytochrome b2 (L‐lactate cytochrome‐c oxidoreductase), component of the mitochondrial intermembrane space, required for lactate utilization; expression is repressed by glucose and anaerobic conditions 1.2371
0.0007
PHO5 YBR093C Repressible acid phosphatase (1 of 3) that also mediates extracellular nucleotide‐derived phosphate hydrolysis; secretory pathway derived cell surface glycoprotein; induced by phosphate starvation and coordinately regulated by PHO4 and PHO2 1.2277
0.0066
YPT53 YNL093W Rab family GTPase, similar to Ypt51p and Ypt52p and to mammalian rab5; required for vacuolar protein sorting and endocytosis 1.2200
0.0033
TRX3 YCR083W Mitochondrial thioredoxin, highly conserved oxidoreductase required to maintain the redox homeostasis of the cell, forms the mitochondrial thioredoxin system with Trr2p, redox state is maintained by both Trr2p and Glr1p 1.2171
0.0004
291
NA YOR289W Putative protein of unknown function; transcription induced by the unfolded protein response; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus 1.1988
0.0016
HUB1 YNR032C‐
A Ubiquitin‐like protein modifier, may function in modification of Sph1p and Hbt1p, functionally complemented by the human or S. pombe ortholog; mechanism of Hub1p adduct formation not yet clear 1.1861
0.0010
NA YKL151C Putative protein of unknown function; YKL151C promoter contains STREs (stress response elements) and expression is induced by heat shock or methyl methanesulfonate; green fluorescent protein (GFP)‐
fusion protein localizes to the cytoplasm 1.1577
0.0012
CSR2 YPR030W Nuclear protein proposed to regulate utilization of nonfermentable carbon sources and endocytosis of plasma membrane proteins; overproduction suppresses chs5 spa2 lethality at high temp; ubiquitinated by Rsp5p, deubiquitinated by Ubp2p 1.1536
0.0022
HXT4 YHR092C High‐affinity glucose transporter of the major facilitator superfamily, expression is induced by low levels of glucose and repressed by high levels of glucose 1.1515
0.0259
NA YLR312C Putative protein of unknown function
1.1370
0.0065
DCS2 YOR173W Non‐essential, stress induced regulatory protein; modulates m7G‐
oligoribonucleotide metabolism; inhibits Dcs1p; regulated by Msn2p, Msn4p, and the Ras‐cAMP‐cAPK signaling pathway; mutant has increased aneuploidy tolerance 1.1227
0.0034
NA NA NA 1.1215
0.0032
ISF1 YMR081C Serine‐rich, hydrophilic protein with similarity to Mbr1p; overexpression suppresses growth defects of hap2, hap3, and hap4 mutants; expression is under glucose control; cotranscribed with NAM7 in a cyp1 mutant 1.1158
0.0131
NA Putative protein of unknown function; predicted to have a role in cell budding based on computational "guilt by association" analysis Outer kinetochore protein, required for accurate mitotic chromosome segregation; component of the kinetochore sub‐
complex COMA (Ctf19p, Okp1p, Mcm21p, Ame1p) that functions as a platform for kinetochore assembly 1.0900
0.0101
CTF19 YGR174W‐
A YPL018W 1.0857
0.0195
RAD28 YDR030C Protein involved in DNA repair, related to the human CSA protein that is involved in transcription‐coupled repair nucleotide excision repair 1.0854
0.0009
NA YNR034W‐
A Putative protein of unknown function; expression is regulated by Msn2p/Msn4p 1.0818
0.0065
TMA23 YMR269W Nucleolar protein of unknown function implicated in ribosome biogenesis; TMA23 may be a fungal‐specific gene as no homologs have been yet identified in higher eukaryotes 1.0680
0.0154
VTC4 YJL012C Vacuolar membrane polyphosphate polymerase; subunit of the vacuolar transporter chaperone (VTC) complex involved in synthesis and transfer of polyP to the vacuole; regulates membrane trafficking; role in non‐autophagic vacuolar fusion 1.0654
0.0016
HXK1 YFR053C Hexokinase isoenzyme 1, a cytosolic protein that catalyzes phosphorylation of glucose during glucose metabolism; expression is highest during growth on non‐glucose carbon sources; glucose‐
induced repression involves the hexokinase Hxk2p 1.0552
0.0076
RTC3 YHR087W Protein of unknown function involved in RNA metabolism; has structural similarity to SBDS, the human protein mutated in Shwachman‐Diamond Syndrome (the yeast SBDS ortholog = SDO1); null mutation suppresses cdc13‐1 temperature sensitivity 1.0531
0.0485
292
NA YDR018C Probable membrane protein with three predicted transmembrane domains; homologous to Ybr042cp, similar to C. elegans F55A11.5 and maize 1‐acyl‐glycerol‐3‐phosphate acyltransferase 1.0382
0.0018
BCD1 YHR040W Essential protein required for the accumulation of box C/D snoRNA 1.0303
0.0152
VTC1 YER072W Subunit of the vacuolar transporter chaperone (VTC) complex involved in membrane trafficking, vacuolar polyphosphate accumulation, microautophagy and non‐autophagic vacuolar fusion; also has mRNA binding activity 1.0297
0.0012
NA YBL086C Protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cell periphery 1.0109
0.0018
CYC7 YEL039C Cytochrome c isoform 2, expressed under hypoxic conditions; electron carrier of the mitochondrial intermembrane space that transfers electrons from ubiquinone‐cytochrome c oxidoreductase to cytochrome c oxidase during cellular respiration 1.0009
0.0260
FUN19 YAL034C Non‐essential protein of unknown function; expression induced in response to heat stress 0.9980
0.0007
TSA2 YDR453C Stress inducible cytoplasmic thioredoxin peroxidase; cooperates with Tsa1p in the removal of reactive oxygen, nitrogen and sulfur species using thioredoxin as hydrogen donor; deletion enhances the mutator phenotype of tsa1 mutants 0.9953
0.0104
NA YGR102C Subunit of the trimeric GatFAB AmidoTransferase(AdT) complex; involved in the formation of Q‐tRNAQ; transposon insertion mutant is salt sensitive and null mutant has growth defects; non‐tagged protein is detected in purified mitochondria 0.9890
0.0025
CHA1 YCL064C Catabolic L‐serine (L‐threonine) deaminase, catalyzes the degradation of both L‐serine and L‐threonine; required to use serine or threonine as the sole nitrogen source, transcriptionally induced by serine and threonine 0.9776
0.0192
UGX2 YDL169C Protein of unknown function, transcript accumulates in response to any combination of stress conditions 0.9618
0.0071
PUT1 YLR142W Proline oxidase, nuclear‐encoded mitochondrial protein involved in utilization of proline as sole nitrogen source; PUT1 transcription is induced by Put3p in the presence of proline and the absence of a preferred nitrogen source 0.9616
0.0016
USV1 YPL230W Putative transcription factor containing a C2H2 zinc finger; mutation affects transcriptional regulation of genes involved in growth on non‐
fermentable carbon sources, response to salt stress and cell wall biosynthesis 0.9583
0.0083
HSP78 YDR258C Oligomeric mitochondrial matrix chaperone that cooperates with Ssc1p in mitochondrial thermotolerance after heat shock; able to prevent the aggregation of misfolded proteins as well as resolubilize protein aggregates 0.9579
0.0012
COX17 YLL009C Copper metallochaperone that transfers copper to Sco1p and Cox11p for eventual delivery to cytochrome c oxidase; contains twin cysteine‐
x9‐cysteine motifs 0.9496
0.0028
STF2 YGR008C Protein involved in regulation of the mitochondrial F1F0‐ATP synthase; Stf1p and Stf2p may act as stabilizing factors that enhance inhibitory action of the Inh1p protein 0.9492
0.0189
FMP46 YKR049C Putative redox protein containing a thioredoxin fold; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies 0.9400
0.0016
293
PHO87 YCR037C Low‐affinity inorganic phosphate (Pi) transporter, involved in activation of PHO pathway; expression is independent of Pi concentration and Pho4p activity; contains 12 membrane‐spanning segments 0.9287
0.0025
HSP104 YLL026W Heat shock protein that cooperates with Ydj1p (Hsp40) and Ssa1p (Hsp70) to refold and reactivate previously denatured, aggregated proteins; responsive to stresses including: heat, ethanol, and sodium arsenite; involved in [PSI+] propagation 0.9260
0.0042
YPS6 YIR039C 0.9259
0.0026
NA YCL073C Putative GPI‐anchored aspartic protease, member of the yapsin family of proteases involved in cell wall growth and maintenance Protein of unconfirmed function; displays a topology characteristic of the Major Facilitators Superfamily of membrane proteins; coding sequence 98% identical to that of YKR106W 0.9120
0.0039
NA YGR226C Dubious open reading frame, unlikely to encode a protein; not conserved in closely related Saccharomyces species; overlaps significantly with a verified ORF, AMA1/YGR225W 0.9005
0.0025
NA YER137C Putative protein of unknown function
0.9003
0.0207
NA YMR090W Putative protein of unknown function with similarity to DTDP‐glucose 4,6‐dehydratases; GFP‐fusion protein localizes to the cytoplasm; up‐
regulated in response to the fungicide mancozeb; not essential for viability 0.8945
0.0055
NA YFR017C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and is induced in response to the DNA‐damaging agent MMS; YFR017C is not an essential gene 0.8890
0.0020
MAL31 YBR298C Maltose permease, high‐affinity maltose transporter (alpha‐glucoside transporter); encoded in the MAL3 complex locus; member of the 12 transmembrane domain superfamily of sugar transporters; functional in genomic reference strain S288C 0.8863
0.0024
UBC12 YLR306W Enzyme that mediates the conjugation of Rub1p, a ubiquitin‐like protein, to other proteins; related to E2 ubiquitin‐conjugating enzymes 0.8802
0.0020
MRPS16 YPL013C Mitochondrial ribosomal protein of the small subunit
0.8708
0.0044
AMS1 YGL156W Vacuolar alpha mannosidase, involved in free oligosaccharide (fOS) degradation; delivered to the vacuole in a novel pathway separate from the secretory pathway 0.8658
0.0131
NA YJL077W‐B Putative protein of unknown function; identified by gene‐trapping, microarray‐based expression analysis, and genome‐wide homology searching 0.8633
0.0102
MIC14 YDR031W Mitochondrial intermembrane space protein, required for normal oxygen consumption; contains twin cysteine‐x9‐cysteine motifs 0.8615
0.0030
ALG14 YBR070C Component of UDP‐GlcNAc transferase required for the second step of dolichyl‐linked oligosaccharide synthesis; anchors the catalytic subunit Alg13p to the ER membrane; similar to bacterial and human glycosyltransferases 0.8593
0.0016
GIS3 YLR094C Protein of unknown function
0.8541
0.0272
NA YMR105W
‐A YKL221W Putative protein of unknown function
0.8520
0.0149
Protein with similarity to mammalian monocarboxylate permeases, which are involved in transport of monocarboxylic acids across the plasma membrane; mutant is not deficient in monocarboxylate transport 0.8483
0.0075
MCH2 294
SYF2 YGR129W Member of the NineTeen Complex (NTC) that contains Prp19p and stabilizes U6 snRNA in catalytic forms of the spliceosome containing U2, U5, and U6 snRNAs; isy1 syf2 cells have defective spindles activiating cell cycle arrest 0.8396
0.0384
DAL1 YIR027C Allantoinase, converts allantoin to allantoate in the first step of allantoin degradation; expression sensitive to nitrogen catabolite repression 0.8333
0.0054
OM45 YIL136W Protein of unknown function, major constituent of the mitochondrial outer membrane; located on the outer (cytosolic) face of the outer membrane 0.8269
0.0260
GAC1 YOR178C Regulatory subunit for Glc7p type‐1 protein phosphatase (PP1), tethers Glc7p to Gsy2p glycogen synthase, binds Hsf1p heat shock transcription factor, required for induction of some HSF‐regulated genes under heat shock 0.8158
0.0493
COA2 YPL189C‐A Cytochrome oxidase assembly factor; null mutation results in respiratory deficiency with specific loss of cytochrome oxidase activity; functions downstream of assembly factors Mss51p and Coa1p and interacts with assembly factor Shy1p 0.8143
0.0051
SFC1 YJR095W Mitochondrial succinate‐fumarate transporter, transports succinate into and fumarate out of the mitochondrion; required for ethanol and acetate utilization 0.8136
0.0123
VTC2 YFL004W Subunit of the vacuolar transporter chaperone (VTC) complex involved in membrane trafficking, vacuolar polyphosphate accumulation, microautophagy and non‐autophagic vacuolar fusion 0.8104
0.0109
MTC3 YGL226W Protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the mitochondrion; mtc3 is synthetically sick with cdc13‐1 0.8094
0.0061
DAD4 YDR320C‐
A Essential subunit of the Dam1 complex (aka DASH complex), couples kinetochores to the force produced by MT depolymerization thereby aiding in chromosome segregation; is transferred to the kinetochore prior to mitosis 0.8058
0.0020
NA YPR159C‐A Identified by gene‐trapping, microarray‐based expression analysis, and genome‐wide homology searching 0.8050
0.0075
UBP9 YER098W Ubiquitin carboxyl‐terminal hydrolase, ubiquitin‐specific protease that cleaves ubiquitin‐protein fusions 0.8030
0.0040
HSP42 YDR171W Small heat shock protein (sHSP) with chaperone activity; forms barrel‐
shaped oligomers that suppress unfolded protein aggregation; involved in cytoskeleton reorganization after heat shock 0.7986
0.0235
CBP4 YGR174C Mitochondrial protein required for assembly of ubiquinol cytochrome‐c reductase complex (cytochrome bc1 complex); interacts with Cbp3p and function is partially redundant with that of Cbp3p 0.7978
0.0019
DIA3 YDL024C Protein of unknown function, involved in invasive and pseudohyphal growth 0.7901
0.0019
BUD27 YFL023W Unconventional prefoldin protein involved in translation initiation; mutants have inappropriate expression of nutrient sensitive genes due to translational derepression of Gcn4p transcription factor; diploid mutants show random budding 0.7900
0.0313
FIS1 YIL065C Protein involved in mitochondrial membrane fission and peroxisome abundance; required for localization of Dnm1p and Mdv1p during mitochondrial division; mediates ethanol‐induced apoptosis and ethanol‐induced mitochondrial fragmentation 0.7878
0.0025
YAE1 YJR067C Protein of unknown function, essential for growth under standard (aerobic) conditions but not under anaerobic conditions 0.7848
0.0035
295
NA YNL200C Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies Vacuolar protein sorting (VPS) protein required for cytoplasm to vacuole targeting of proteins 0.7817
0.0022
VPS62 YGR141W 0.7755
0.0040
YPC1 YBR183W Alkaline ceramidase that also has reverse (CoA‐independent) ceramide synthase activity, catalyzes both breakdown and synthesis of phytoceramide; overexpression confers fumonisin B1 resistance 0.7734
0.0250
SRX1 YKL086W Sulfiredoxin, contributes to oxidative stress resistance by reducing cysteine‐sulfinic acid groups in the peroxiredoxin Tsa1p, which is formed upon exposure to oxidants; conserved in higher eukaryotes 0.7716
0.0061
NA YAR064W Putative protein of unknown function
0.7701
0.0234
GPX1 YKL026C 0.7660
0.0030
GDB1 YPR184W Phospholipid hydroperoxide glutathione peroxidase induced by glucose starvation that protects cells from phospholipid hydroperoxides and nonphospholipid peroxides during oxidative stress Glycogen debranching enzyme containing glucanotranferase and alpha‐1,6‐amyloglucosidase activities, required for glycogen degradation; phosphorylated in mitochondria 0.7653
0.0174
NA YPL247C Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; similar to the petunia WD repeat protein an11; overexpression causes a cell cycle delay or arrest 0.7629
0.0080
HSP82 YPL240C Hsp90 chaperone required for pheromone signaling and negative regulation of Hsf1p; docks with Tom70p for mitochondrial preprotein delivery; promotes telomerase DNA binding and nucleotide addition; interacts with Cns1p, Cpr6p, Cpr7p, Sti1p 0.7489
0.0109
PGM3 YMR278W Phosphoglucomutase, catalyzes interconversion of glucose‐1‐
phosphate and glucose‐6‐phospate; transcription induced in response to stress; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; non‐essential 0.7485
0.0249
RRP17 YDR412W Component of the pre‐60S pre‐ribosomal particle; required for cell viability under standard (aerobic) conditions but not under anaerobic conditions; exonuclease required for 5&#8242; end processing of pre‐
60S ribosomal RNA 0.7468
0.0112
IES2 YNL215W Protein that associates with the INO80 chromatin remodeling complex under low‐salt conditions; essential for growth under anaerobic conditions 0.7451
0.0048
RGM1 YMR182C Putative transcriptional repressor with proline‐rich zinc fingers; overproduction impairs cell growth 0.7449
0.0444
GIT1 YCR098C Plasma membrane permease, mediates uptake of glycerophosphoinositol and glycerophosphocholine as sources of the nutrients inositol and phosphate; expression and transport rate are regulated by phosphate and inositol availability 0.7445
0.0029
NA YIL014C‐A Putative protein of unknown function
0.7402
0.0138
BUD20 YLR074C Protein involved in bud‐site selection; diploid mutants display a random budding pattern instead of the wild‐type bipolar pattern 0.7397
0.0466
NA YBR230W‐
A YPL186C Putative protein of unknown function
0.7382
0.0133
Protein that interacts with Ulp1p, a Ubl (ubiquitin‐like protein)‐
specific protease for Smt3p protein conjugates; detected in a phosphorylated state in the mitochondrial outer membrane; also detected in ER and nuclear envelope 0.7308
0.0027
UIP4 296
DAL3 YIR032C Ureidoglycolate hydrolase, converts ureidoglycolate to glyoxylate and urea in the third step of allantoin degradation; expression sensitive to nitrogen catabolite repression 0.7308
0.0362
NA YMR244C‐
A Putative protein of unknown function; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and nucleus and is induced in response to the DNA‐damaging agent MMS; YMR244C‐A is not an essential gene 0.7252
0.0061
MRPL51 YPR100W Mitochondrial ribosomal protein of the large subunit
0.7213
0.0048
RIO1 YOR119C Essential serine kinase involved in cell cycle progression and processing of the 20S pre‐rRNA into mature 18S rRNA 0.7196
0.0069
HIT1 YJR055W Protein of unknown function, required for growth at high temperature 0.7192
0.0131
TRM13 YOL125W 2'‐O‐methyltransferase responsible for modification of tRNA at position 4; C‐terminal domain has similarity to Rossmann‐fold (RFM) superfamily of RNA methyltransferases 0.7142
0.0388
NA YOR032W‐
A Identified by gene‐trapping, microarray‐based expression analysis, and genome‐wide homology searching 0.7141
0.0449
NA YLR156W Putative protein of unknown function; exhibits a two‐hybrid interaction with Jsn1p in a large‐scale analysis 0.7139
0.0112
NA YOL114C Putative protein of unknown function with similarity to human ICT1 and prokaryotic factors that may function in translation termination; YOL114C is not an essential gene 0.7136
0.0225
NA YFL054C Putative channel‐like protein; similar to Fps1p; mediates passive diffusion of glycerol in the presence of ethanol 0.7120
0.0030
AUA1 YFL010W‐
A Protein required for the negative regulation by ammonia of Gap1p, which is a general amino acid permease 0.7116
0.0020
KIN82 YCR091W Putative serine/threonine protein kinase implicated in the regulation of phospholipid asymmetry through the activation of phospholipid translocases (flippases) Lem3p‐Dnf1p/Dnf2p; similar to Fpk1p 0.7107
0.0268
CUS2 YNL286W Protein that binds to U2 snRNA and Prp11p, may be involved in U2 snRNA folding; contains two RNA recognition motifs (RRMs) 0.7092
0.0019
URM1 YIL008W Ubiquitin‐like protein involved in thiolation of cytoplasmic tRNAs; receives sulfur from the E1‐like enzyme Uba4p and transfers it to tRNA; also functions as a protein tag with roles in nutrient sensing and oxidative stress response 0.7054
0.0234
MBR1 YKL093W Protein involved in mitochondrial functions and stress response; overexpression suppresses growth defects of hap2, hap3, and hap4 mutants 0.7043
0.0056
GLC3 YEL011W Glycogen branching enzyme, involved in glycogen accumulation; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern 0.7022
0.0085
NA Putative protein of unknown function
0.6998
0.0071
PBI2 YGR169C‐
A YNL015W Cytosolic inhibitor of vacuolar proteinase B (PRB1), required for efficient vacuole inheritance; with thioredoxin forms protein complex LMA1, which assists in priming SNARE molecules and promotes vacuole fusion 0.6981
0.0215
PYK2 YOR347C Pyruvate kinase that appears to be modulated by phosphorylation; PYK2 transcription is repressed by glucose, and Pyk2p may be active under low glycolytic flux 0.6923
0.0131
EMI1 YDR512C Non‐essential protein required for transcriptional induction of the early meiotic‐specific transcription factor IME1, also required for sporulation; contains twin cysteine‐x9‐cysteine motifs 0.6824
0.0025
297
NGL3 YML118W Putative endonuclease, has a domain similar to a magnesium‐
dependent endonuclease motif in mRNA deadenylase Ccr4p; similar to Ngl1p and Ngl2p 0.6799
0.0235
NA YHR138C Putative protein of unknown function; has similarity to Pbi2p; double null mutant lacking Pbi2p and Yhr138p exhibits highly fragmented vacuoles 0.6765
0.0063
GCY1 YOR120W Putative NADP(+) coupled glycerol dehydrogenase, proposed to be involved in an alternative pathway for glycerol catabolism; also has mRNA binding activity; member of the aldo‐keto reductase (AKR) family 0.6754
0.0056
COX13 YGL191W Subunit VIa of cytochrome c oxidase, which is the terminal member of the mitochondrial inner membrane electron transport chain; not essential for cytochrome c oxidase activity but may modulate activity in response to ATP 0.6743
0.0040
ERR3 YMR323W Protein of unknown function, has similarity to enolases
0.6742
0.0349
NA YAR029W Member of DUP240 gene family but contains no transmembrane domains; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm in a punctate pattern 0.6719
0.0230
PRX1 YBL064C Mitochondrial peroxiredoxin (1‐Cys Prx) with thioredoxin peroxidase activity, has a role in reduction of hydroperoxides; reactivation requires Trr2p and glutathione; induced during respiratory growth and oxidative stress; phosphorylated 0.6701
0.0049
COS4 YFL062W Protein of unknown function, member of the DUP380 subfamily of conserved, often subtelomerically‐encoded proteins 0.6699
0.0131
HBN1 YCL026C‐B Putative protein of unknown function; similar to bacterial nitroreductases; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm and nucleus; protein becomes insoluble upon intracellular iron depletion 0.6678
0.0221
NA YFL041W‐
A Putative protein of unknown function; identified by fungal homology and RT‐PCR 0.6676
0.0050
CRS5 YOR031W Copper‐binding metallothionein, required for wild‐type copper resistance 0.6672
0.0120
CAT8 YMR280C Zinc cluster transcriptional activator necessary for derepression of a variety of genes under non‐fermentative growth conditions, active after diauxic shift, binds carbon source responsive elements 0.6671
0.0092
NA YKL107W Putative protein of unknown function; proposed to be a palmitoylated membrane protein 0.6645
0.0319
CAR1 YPL111W Arginase, responsible for arginine degradation, expression responds to both induction by arginine and nitrogen catabolite repression; disruption enhances freeze tolerance 0.6645
0.0109
NA YKL018C‐A Putative protein of unknown function; identified by homology; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm 0.6631
0.0059
MND2 YIR025W Subunit of the anaphase‐promoting complex (APC); necessary for maintaining sister chromatid cohesion in prophase I of meiosis by inhibiting premature ubiquitination and subsequent degradation of substrates by the APC(Ama1) ubiquitin ligase 0.6627
0.0039
FMP10 YER182W Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies 0.6600
0.0078
DAN4 YJR151C Cell wall mannoprotein with similarity to Tir1p, Tir2p, Tir3p, and Tir4p; expressed under anaerobic conditions, completely repressed during aerobic growth 0.6591
0.0054
298
CGR1 YGL029W Protein involved in nucleolar integrity and processing of the pre‐rRNA for the 60S ribosome subunit; transcript is induced in response to cytotoxic stress but not genotoxic stress 0.6578
0.0430
ATS1 YAL020C Protein required, with Elongator complex, Kti11p, and Kti12p, for modification of wobble nucleosides in tRNA; has a potential role in regulatory interactions between microtubules and the cell cycle 0.6567
0.0078
NA YDL160C‐A Putative protein of unknown function; mutant in a srs2 mutant background displays MMS hypersensitivity; ortholog of human MHF2, a component of the Fanconi anemia (FA) complex that is involved in maintaining genome stability 0.6555
0.0208
SNF3 YDL194W Plasma membrane low glucose sensor that regulates glucose transport; contains 12 predicted transmembrane segments and a long C‐terminal tail required for induction of hexose transporters; also senses fructose and mannose; similar to Rgt2p 0.6539
0.0074
REX3 YLR107W RNA exonuclease; required for maturation of the RNA component of RNase MRP; functions redundantly with Rnh70p and Rex2p in processing of U5 snRNA and RNase P RNA; member of RNase D family of exonucleases 0.6536
0.0069
NA YOL164W‐
A Putative protein of unknown function; identified by fungal homology and RT‐PCR 0.6530
0.0359
COS2 YBR302C Protein of unknown function, member of the DUP380 subfamily of conserved, often subtelomerically‐encoded proteins 0.6524
0.0073
TOA1 YOR194C TFIIA large subunit; involved in transcriptional activation, acts as antirepressor or as coactivator; homologous to largest and second largest subunits of human and Drosophila TFIIA 0.6522
0.0227
ASR1 YPR093C Ubiquitin ligase that modifies and regulates RNA Pol II; involved in a putative alcohol‐responsive signaling pathway; accumulates in the nucleus under alcohol stress; contains a Ring/PHD finger domain similar to the mammalian rA9 protein 0.6490
0.0094
GRX1 YCL035C Hydroperoxide and superoxide‐radical responsive heat‐stable glutathione‐dependent disulfide oxidoreductase with active site cysteine pair; protects cells from oxidative damage 0.6475
0.0115
CRP1 YHR146W Protein that binds to cruciform DNA structures
0.6469
0.0028
CPD1 YGR247W Cyclic nucleotide phosphodiesterase, hydrolyzes ADP‐ribose 1'', 2''‐
cyclic phosphate to ADP‐ribose 1''‐phosphate; may have a role in tRNA splicing; no detectable phenotype is conferred by null mutation or by overexpression 0.6466
0.0032
SSA2 YLL024C ATP binding protein involved in protein folding and vacuolar import of proteins; member of heat shock protein 70 (HSP70) family; associated with the chaperonin‐containing T‐complex; present in the cytoplasm, vacuolar membrane and cell wall 0.6461
0.0107
TOP3 YLR234W DNA Topoisomerase III, conserved protein that functions in a complex with Sgs1p and Rmi1p to relax single‐stranded negatively‐supercoiled DNA preferentially, involved in telomere stability and regulation of mitotic recombination 0.6445
0.0146
CUE4 YML101C Protein of unknown function; has a CUE domain that binds ubiquitin, which may facilitate intramolecular monoubiquitination 0.6434
0.0031
MOG1 YJR074W Conserved nuclear protein that interacts with GTP‐Gsp1p, which is a Ran homolog of the Ras GTPase family, and stimulates nucleotide release, involved in nuclear protein import, nucleotide release is inhibited by Yrb1p 0.6417
0.0048
299
TPC1 YGR096W Mitochondrial membrane transporter that mediates uptake of the essential cofactor thiamine pyrophosphate (ThPP) into mitochondria; expression appears to be regulated by carbon source; member of the mitochondrial carrier family 0.6399
0.0075
STI1 YOR027W Hsp90 cochaperone, interacts with the Ssa group of the cytosolic Hsp70 chaperones and activates Ssa1p ATPase activity; interacts with Hsp90 chaperones and inhibits their ATPase activity; homolog of mammalian Hop 0.6373
0.0052
NA YIR018C‐A Putative protein of unknown function; identified by expression profiling and mass spectrometry 0.6368
0.0481
NA Putative protein of unknown function
0.6356
0.0109
VIP1 YMR182W
‐A YLR410W Inositol hexakisphosphate (IP6) and inositol heptakisphosphate (IP7) kinase; IP7 production is important for phosphate signaling; involved in cortical actin cytoskeleton function, and invasive pseudohyphal growth analogous to S. pombe asp1 0.6332
0.0059
NQM1 YGR043C 0.6321
0.0167
BRE2 YLR015W Transaldolase of unknown function; transcription is repressed by Mot1p and induced by alpha‐factor and during diauxic shift Subunit of COMPASS (Set1C) complex, which methylates Lys4 of histone H3 and functions in silencing at telomeres; has a C‐terminal Sdc1 Dpy‐30 Interaction (SDI) domain that mediates binding to Sdc1p; similar to trithorax‐group protein ASH2L 0.6310
0.0059
MOD5 YOR274W Delta 2‐isopentenyl pyrophosphate:tRNA isopentenyl transferase, required for biosynthesis of the modified base isopentenyladenosine in mitochondrial and cytoplasmic tRNAs; gene is nuclear and encodes two isozymic forms 0.6248
0.0356
MER1 YNL210W Protein with RNA‐binding motifs required for meiosis‐specific mRNA splicing; required for chromosome pairing and meiotic recombination 0.6239
0.0354
ECM4 YKR076W Omega class glutathione transferase; not essential; similar to Ygr154cp; green fluorescent protein (GFP)‐fusion protein localizes to the cytoplasm 0.6174
0.0127
SDH4 YDR178W Membrane anchor subunit of succinate dehydrogenase (Sdh1p, Sdh2p, Sdh3p, Sdh4p), which couples the oxidation of succinate to the transfer of electrons to ubiquinone as part of the TCA cycle and the mitochondrial respiratory chain 0.6155
0.0065
NA YDR391C Putative protein of unknown function, possibly involved in zinc homeostasis; Bdf1p‐dependent transcription induced by salt stress; green fluorescent protein (GFP)‐fusion protein localizes to both the cytoplasm and the nucleus 0.6152
0.0081
TEN1 YLR010C Protein that regulates telomeric length; protects telomeric ends in a complex with Cdc13p and Stn1p 0.6147
0.0051
EMP46 YLR080W 0.6143
0.0323
NA YPL039W Integral membrane component of endoplasmic reticulum‐derived COPII‐coated vesicles, which function in ER to Golgi transport Putative protein of unknown function; YPL039W is not an essential gene 0.6138
0.0062
NCE101 YJL205C Protein of unknown function, involved in secretion of proteins that lack classical secretory signal sequences 0.6120
0.0030
NVJ1 YHR195W Nuclear envelope protein, anchored to the nuclear inner membrane, that interacts with the vacuolar membrane protein Vac8p to promote formation of nucleus‐vacuole junctions during piecemeal microautophagy of the nucleus (PMN) 0.6113
0.0120
RAD2 YGR258C Single‐stranded DNA endonuclease, cleaves single‐stranded DNA during nucleotide excision repair to excise damaged DNA; subunit of Nucleotide Excision Repair Factor 3 (NEF3); homolog of human XPG protein 0.6112
0.0065
300
QCR8 YJL166W Subunit 8 of ubiquinol cytochrome‐c reductase complex, which is a component of the mitochondrial inner membrane electron transport chain; oriented facing the intermembrane space; expression is regulated by Abf1p and Cpf1p 0.6105
0.0055
LAP4 YKL103C Vacuolar aminopeptidase yscI; zinc metalloproteinase that belongs to the peptidase family M18; often used as a marker protein in studies of autophagy and cytosol to vacuole targeting (CVT) pathway 0.6101
0.0097
SEM1 YDR363W‐
A Component of the lid subcomplex of the regulatory subunit of the 26S proteasome; involved in mRNA export mediated by the TREX‐2 complex (Sac3p‐Thp1p); ortholog of human DSS1 0.6080
0.0187
FMP33 YJL161W Putative protein of unknown function; the authentic, non‐tagged protein is detected in highly purified mitochondria in high‐throughput studies 0.6077
0.0144
MXR2 YCL033C Methionine‐R‐sulfoxide reductase, involved in the response to oxidative stress; protects iron‐sulfur clusters from oxidative inactivation along with MXR1; involved in the regulation of lifespan 0.6049
0.0025
PRP2 YNR011C RNA‐dependent ATPase in the DEAH‐box family, required for activation of the spliceosome before the first transesterification step in RNA splicing; orthologous to human protein DHX16 0.6044
0.0062
NA YPR015C Putative protein of unknown function; overexpression causes a cell cycle delay or arrest 0.6044
0.0100
YCT1 YLL055W High‐affinity cysteine‐specific transporter with similarity to the Dal5p family of transporters; green fluorescent protein (GFP)‐fusion protein localizes to the endoplasmic reticulum; YCT1 is not an essential gene 0.6023
0.0209
NHA1 YLR138W Na+/H+ antiporter involved in sodium and potassium efflux through the plasma membrane; required for alkali cation tolerance at acidic pH 0.6001
0.0073
301
APPENDIX P: R codes for microarray data
analysis
This section includes the R codes for microarray data analysis to generate the differential
expressed genes in this project.
## download packages required for microarray analysis
>source("http://bioconductor.org/biocLite.R")
>biocLite("affyPLM")
## check working environment
>sessionInfo()
R version 2.13.0 (2011-04-13)
Platform: i386-pc-mingw32/i386 (32-bit)
locale:
[1] LC_COLLATE=English_United States.1252
[2] LC_CTYPE=English_United States.1252
[3] LC_MONETARY=English_United States.1252
[4] LC_NUMERIC=C
[5] LC_TIME=English_United States.1252
attached base packages:
[1] stats
graphics grDevices utils
other attached packages:
[1] affycoretools_1.24.0
[4] yeast2.db_2.5.0
[7] DBI_0.2-5
[10] yeast2probe_2.8.0
[13] limma_3.8.2
datasets
KEGG.db_2.5.0
org.Sc.sgd.db_2.5.0
annotate_1.30.0
yeast2cdf_2.8.0
affy_1.30.0
base
GO.db_2.5.0
RSQLite_0.9-4
genefilter_1.34.0
AnnotationDbi_1.14.1
Biobase_2.12.1
loaded via a namespace (and not attached):
[1] affyio_1.20.0
annaffy_1.24.0
[4] Biostrings_2.20.4
Category_2.18.0
[7] GOstats_2.18.0
graph_1.30.0
[10] IRanges_1.10.6
preprocessCore_1.14.0
[13] RCurl_1.6-10.1
splines_2.13.0
[16] tools_2.13.0
XML_3.4-2.2
302
methods
biomaRt_2.8.1
gcrma_2.24.1
GSEABase_1.14.0
RBGL_1.28.0
survival_2.36-5
xtable_1.5-6
###########
###########
###########
importing cel files
follow online manual -- limma
###########
###########
###########
setwd("F://2007- Data in Hopper Lab//Microarray data analysis//R
wd//wt_mtr10_msn5")
library("affy")
library("limma")
targets <- readTargets("targets_all.txt")
aaa <- ReadAffy(filenames = targets $ filename)
pData(aaa)
setwd("F://2007- Data in Hopper Lab//Microarray data
analysis//R_Output//WT_mtr10_msn5_output")
pdf("Box plot-Raw data.pdf", width=5, height=5)
par(mar=c(10,4,2,1))
boxplot(aaa, las=3, cex.axis=0.7, ylab="log2 intensity", main="Raw
data");dev.off()
###########
###########
###########
#########
#########
#########
Remove S.p. probes
##### from BioC list--Jenny Jenny Drnevich, Ph.D.
##### Functional Genomics Bioinformatics Specialist
##### W.M. Keck Center for Comparative and Functional Genomics
##### Roy J. Carver Biotechnology Center, University of
#####Illinois,Urbana-Champaign
library("yeast2probe")
###
###
###
###
###
###
The first part is just creating two ojects (ResetEnvir and
RemoveProbes) originally
written by Ariel Chernomoretz and modified by Jenny Drnevich to
remove individual probes and/or entire probesets. Just highlight
everything from here until
you see STOP and paste it to R all at once
ResetEnvir <- function(cleancdf){
cdfpackagename
<- paste(cleancdf,"cdf",sep="")
probepackagename <- paste(cleancdf,"probe",sep="")
ll<-search()
cdfpackagepos <- grep(cdfpackagename,ll)
if(length(cdfpackagepos)>0) detach(pos=cdfpackagepos)
ll<-search()
probepackagepos <- grep(probepackagename,ll)
if(length(probepackagepos)>0) detach(pos=probepackagepos)
require(cdfpackagename,character.only=T)
require(probepackagename,character.only=T)
303
require(affy)
}
RemoveProbes <- function(listOutProbes=NULL,
listOutProbeSets=NULL,
cleancdf,destructive=TRUE)
{
#default probe dataset values
cdfpackagename
<- paste(cleancdf,"cdf",sep="")
probepackagename <- paste(cleancdf,"probe",sep="")
require(cdfpackagename,character.only = TRUE)
require(probepackagename,character.only = TRUE)
probe.env.orig <- get(probepackagename)
if(!is.null(listOutProbes)){
# taking probes out from CDF env
probes<- unlist(lapply(listOutProbes,function(x){
a<-strsplit(x,"at")
aux1<-paste(a[[1]][1],"at",sep="")
aux2<-as.integer(a[[1]][2])
c(aux1,aux2)
}))
n1<-as.character(probes[seq(1,(length(probes)/2))*2-1])
n2<-as.integer(probes[seq(1,(length(probes)/2))*2])
probes<-data.frame(I(n1),n2)
probes[,1]<-as.character(probes[,1])
probes[,2]<-as.integer(probes[,2])
pset<-unique(probes[,1])
for(i in seq(along=pset)){
ii <-grep(pset[i],probes[,1])
iout<-probes[ii,2]
a<-get(pset[i],env=get(cdfpackagename))
a<-a[-iout,]
assign(pset[i],a,env=get(cdfpackagename))
}
}
# taking probesets out from CDF env
if(!is.null(listOutProbeSets)){
rm(list=listOutProbeSets,envir=get(cdfpackagename))
}
# setting the PROBE env accordingly (idea from gcrma
compute.affinities.R)
tmp <- get("xy2indices",paste("package:",cdfpackagename,sep=""))
newAB
<- new("AffyBatch",cdfName=cleancdf)
pmIndex <- unlist(indexProbes(newAB,"pm"))
subIndex<match(tmp(probe.env.orig$x,probe.env.orig$y,cdf=cdfpackagename),pmIndex
)
rm(newAB)
304
iNA
}
<- which(is.na(subIndex))
if(length(iNA)>0){
ipos<-grep(probepackagename,search())
assign(probepackagename,probe.env.orig[-iNA,],pos=ipos)
}
### STOP HERE!!!! PASTE THE ABOVE INTO R AND CHECK TO SEE YOU HAVE
### THE TWO OBJECTS (ResetEnvir and RemoveProbes) WORKSPACE WITH ls()
## All you need now is your affybatch object, and a character vector
## of probe set names
## and/or another vector of individual probes that you want to remove.
## If your affybatch object is called 'rawdata' and the vector of
probesets
## is 'maskedprobes', all you need to do is:
## here after: rawdata = aaa,
maskedprobes <- scan("sp_IDs.txt", what="")
maskedprobes[1]
maskedprobes <- as.vector(maskedprobes)
## cleancdf <- cleancdfname(rawdata at cdfName,addcdf=FALSE)
cleancdf <- cleancdfname(aaa @cdfName,addcdf=FALSE)
# Make sure starting with the original cdf with all the
# probes and probesets.
ResetEnvir(cleancdf)
# Double-check to make sure all probesets are present in your
# affybatch by typing in
# the name of your affybatch and looking at the output.
# rawdata
aaa
# To remove some probe sets (but not individual probes in this
#example), use:
RemoveProbes(listOutProbes=NULL, listOutProbeSets=maskedprobes,
cleancdf)
#
#
#
#
#
#
#
#
The cdf file will be temporarily modified to mask the indicated
probesets & probes, which you can check by typing in the name of
your affybatch again and seeing that the number of probesets
have decreased. The masking can be undone by using ResetEnvir
as above, or by quitting the session. However, any Expression Set
objects created when the cdf is modified will have the masked
probesets removed permanently because they do not refer to the
cdf like an affybatch object does.
305
aaa
## check id numbers to see if it decreases
## normalize with 5900 probesets
library("affy")
eset <- rma(aaa)
dim(exprs(eset))
### Box plot
setwd("F://2007- Data in Hopper Lab//Microarray data
analysis//R_Output//WT_mtr10_msn5_output")
pdf("Box plot-after removingProbes and RMA normalized.pdf", width=5,
height=5)
par(mar=c(10,4,2,1))
boxplot(eset, main="After Remove probes and RMA normalized", ylab="log2
intensity",
las=2, cex.axis=0.7) ; dev.off()
#####
#####
#####
follow online manual(M. Bioconductor exercise)
& add annotation info.
#####
#####
#####
### Generate RMA expression data, MAS5 P/M/A calls
setwd("F://2007- Data in Hopper Lab//Microarray data
analysis//R_Output//WT_mtr10_msn5_output")
eset.pm <- mas5calls(aaa)
# Generates MAS 5.0
P/M/A calls, not working in one cdf env?
frame1 <- data.frame(exprs(eset), exprs(eset.pm)) # Combine RMA
intensities, P/M/A calls in one data frame
frame2 <- frame1[, sort(names(frame1))]
# Sorts columns by
cel file name.
#write.table(frame1, file="All_expression value and PA calls.txt",
sep="\t")
#write.table(frame2, file="All_expression value and PA
calls_sortbyname.txt", sep="\t")
#############
#############
#############
#############
#############
#############
Pre-processing
####
#### step 1. filter -- to get rid of low/no singals
####
(by log2intensities, no hypothesis tested)
####
library("genefilter")
306
f1 <- anyNA
f2 <- pOverA(0.50, 6)
ff <- filterfun(f1, f2)
selected <- genefilter(exprs(eset), ff)
esetsub <- eset[selected,]
ef
<- exprs(esetsub) ;
;
sum(selected)
## esetsub is a filtered matrix
ef[1:5, 1:3]; dim(ef)
write.table(ef, file="All_RMA_expression
value_filtered.txt",quote=FALSE, sep='\t')
frame2.esetsub <- frame2[selected,]; dim(frame2.esetsub)
write.table(frame2.esetsub, file="All_RMA_expression value_filtered
plusPAcall.txt",quote=FALSE, sep='\t')
#######
#######
#######
add and export annotation info.
library("annotate") ;
library("yeast2.db") ;
#######
#######
#######
for all probesets
ls("package:annotate")
ls("package:yeast2.db")
annotation(eset) <- "yeast2.db"
annotation(esetsub) <- "yeast2.db"
## get information for esetsub
probeIDs <- featureNames(esetsub)
# get affyIDs from esetsub
length(probeIDs)
; probeIDs[5]
# check
# Retrieves gene descriptions
symbols <- as.vector(unlist(mget(probeIDs,yeast2GENENAME)))
symbols[5] ; length(symbols)
# check
orf
<- as.vector(unlist(mget(probeIDs,yeast2ORF)))
; orf[1:5]
;length(orf)
# Retrieves ORF
desrp <- as.vector(unlist(mget(probeIDs, yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, orf, desrp, sep="."))
sym.orf.des[1:3]
sym.des
<- as.vector(paste(symbols, desrp, sep="."))
# build data frame
df
<- as.data.frame(exprs(esetsub))
;
; dim(df)
# Generates data frame with above annotation data.
Annot <- data.frame(probeIDs, orf, symbols, desrp, sym.des, df,
row.names=NULL) ; dim(Annot)
write.table(Annot, file="annot_filtered_dataset_no PA.txt",
sep="\t",quote=FALSE)
307
#############
#############
#############
#############
#############
#############
To generate DEG
#####
##### 1. Build dataframe
#####
wt.pm.f <- exprs(esetsub[, 1:2])- exprs(esetsub[, 3:4]) ; dim(wt.pm.f)
wt.pm.f.avg <- rowMeans(wt.pm.f)
wt.pm.s <- exprs(esetsub[, 5:6])- exprs(esetsub[, 7:8]) ; dim(wt.pm.s)
wt.pm.s.avg <- rowMeans(wt.pm.s)
wt.pm.sf <- wt.pm.s - wt.pm.f ; dim(wt.pm.sf)
wt.pm.sf.avg <- rowMeans(wt.pm.sf)
msn5.pm.f <- exprs(esetsub[, 9:10]) - exprs(esetsub[, 11:12])
msn5.pm.f.avg <- rowMeans(msn5.pm.f)
msn5.pm.s <- exprs(esetsub[, 13:14])- exprs(esetsub[, 15:16])
msn5.pm.s.avg <- rowMeans(msn5.pm.s)
msn5.pm.sf <- msn5.pm.s - msn5.pm.f
msn5.pm.sf.avg <- rowMeans(msn5.pm.sf)
mtr10.pm.f <- exprs(esetsub[, 17:18]) - exprs(esetsub[, 19:20])
mtr10.pm.f.avg <- rowMeans(mtr10.pm.f)
mtr10.pm.s <- exprs(esetsub[, 21:22])- exprs(esetsub[, 23:24])
mtr10.pm.s.avg <- rowMeans(mtr10.pm.s)
mtr10.pm.sf <- mtr10.pm.s - mtr10.pm.f
mtr10.pm.sf.avg <- rowMeans(mtr10.pm.sf)
wt.pt.f <- exprs(esetsub[, 1:2])- exprs(esetsub[, 25:26])
dim(wt.pt.f)
wt.pt.f.avg <- rowMeans(wt.pt.f)
wt.pt.s <- exprs(esetsub[, 5:6])- exprs(esetsub[, 27:28])
dim(wt.pt.s)
wt.pt.s.avg <- rowMeans(wt.pt.s)
wt.pt.sf <- wt.pt.s - wt.pt.f ; dim(wt.pt.sf)
wt.pt.sf.avg <- rowMeans(wt.pt.sf)
;
;
msn5.pt.f <- exprs(esetsub[, 9:10])- exprs(esetsub[, 29:30]) ;
dim(msn5.pt.f)
msn5.pt.f.avg <- rowMeans(msn5.pt.f)
msn5.pt.s <- exprs(esetsub[, 13:14])-exprs(esetsub[, 31:32])
msn5.pt.s.avg <- rowMeans(msn5.pt.s)
msn5.pt.sf <- msn5.pt.s - msn5.pt.f
msn5.pt.sf.avg <- rowMeans(msn5.pt.sf)
mtr10.pt.f <- exprs(esetsub[, 17:18])- exprs(esetsub[, 33:34]) ;
dim(mtr10.pt.f)
mtr10.pt.f.avg <- rowMeans(mtr10.pt.f)
mtr10.pt.s <- exprs(esetsub[, 21:22])-exprs(esetsub[, 35:36])
mtr10.pt.s.avg <- rowMeans(mtr10.pt.s)
mtr10.pt.sf <- mtr10.pt.s - mtr10.pt.f
mtr10.pt.sf.avg <- rowMeans(mtr10.pt.sf)
308
### TXN
wt.t.f
wt.t.s
wt.t.f.avg
wt.t.s.avg
<<<<-
msn5.t.f <msn5.t.s <msn5.t.f.avg
msn5.t.s.avg
exprs(esetsub[, 25:26]) ; dim(wt.t.f)
exprs(esetsub[, 27:28])
rowMeans (wt.t.f)
rowMeans (wt.t.s)
exprs(esetsub[, 29:30])
exprs(esetsub[, 31:32])
<- rowMeans (msn5.t.f)
<- rowMeans (msn5.t.s)
mtr10.t.f <mtr10.t.s <mtr10.t.f.avg
mtr10.t.s.avg
exprs(esetsub[, 33:34])
exprs(esetsub[, 35:36])
<- rowMeans (mtr10.t.f)
<- rowMeans (mtr10.t.s)
setwd("F:/2007- Data in Hopper Lab/Microarray data
analysis/R_Output/WT_mtr10_msn5_output")
pm.mtr10.and.wt <- cbind(wt.pm.f , mtr10.pm.f, wt.pm.s , mtr10.pm.s)
dim(pm.mtr10.and.wt)
pm.msn5.and.wt <- cbind(wt.pm.f , msn5.pm.f, wt.pm.s , msn5.pm.s)
dim(pm.msn5.and.wt)
txn.mtr10.and.wt <- cbind(wt.t.f , mtr10.t.f, wt.t.s , mtr10.t.s)
dim(txn.mtr10.and.wt)
txn.msn5.and.wt <- cbind(wt.t.f , msn5.t.f, wt.t.s , msn5.t.s)
;
dim(txn.msn5.and.wt)
pt.mtr10.and.wt <- cbind(wt.pt.f , mtr10.pt.f, wt.pt.s , mtr10.pt.s)
dim(pt.mtr10.and.wt)
######
###### Step 2. statistical analysis -- limma
######
##### Step 2.1 Model-fit
#####
##### compare P/M values
library("limma")
dim(pm.mtr10.and.wt)
dim(pm.msn5.and.wt)
### (Pf/Mf) or (Ps/Ms)
### mtr10
pm.mtr10.and.wt.exprs <- new("ExpressionSet",
exprs=as.matrix(pm.mtr10.and.wt)) ; dim(pm.mtr10.and.wt.exprs)
mtr10.design <- model.matrix(~0+factor(c(1,1,2,2,3,3,4,4)))
colnames(mtr10.design) <- c("wt.f", "mtr10.f", "wt.s", "mtr10.s") ;
mtr10.design
309
;
;
;
;
mtr10.fit
<- lmFit(exprs(pm.mtr10.and.wt.exprs), mtr10.design)
contrast.matrix.mtr10 <- makeContrasts("Pf/Mf-mtr10/wt" = mtr10.f-wt.f,
"Ps/Ms-mtr10/wt" = mtr10.s-wt.s,
levels=mtr10.design)
contrast.matrix.mtr10
fit2.mtr10 <- contrasts.fit(mtr10.fit, contrast.matrix.mtr10)
fit3.mtr10 <- eBayes(fit2.mtr10)
### msn5
pm.msn5.and.wt.exprs <- new("ExpressionSet",
exprs=as.matrix(pm.msn5.and.wt)) ; dim(pm.msn5.and.wt.exprs)
msn5.design <- model.matrix(~0+factor(c(1,1,2,2,3,3,4,4)))
colnames(msn5.design) <- c("wt.f", "msn5.f", "wt.s", "msn5.s") ;
msn5.design
msn5.fit
<- lmFit(exprs(pm.msn5.and.wt.exprs), msn5.design)
contrast.matrix.msn5 <- makeContrasts("Pf/Mf-msn5/wt" = msn5.f-wt.f,
"Ps/Ms-msn5/wt" = msn5.s-wt.s,
levels=msn5.design)
contrast.matrix.msn5
fit2.msn5 <- contrasts.fit(msn5.fit, contrast.matrix.msn5)
fit3.msn5 <- eBayes(fit2.msn5)
#####
##### Model-fit – compare P/T values
#####
library("limma")
dim(pt.mtr10.and.wt)
### (Pf/Tf) or (Ps/Ts)
### mtr10
pt.mtr10.and.wt.exprs <- new("ExpressionSet",
exprs=as.matrix(pt.mtr10.and.wt)) ; dim(pt.mtr10.and.wt.exprs)
pt.design <- model.matrix(~0+factor(c(1,1,2,2,3,3,4,4)))
colnames(pt.design) <- c("wt.f", "mtr10.f", "wt.s", "mtr10.s") ;
pt.design
pt.fit
<- lmFit(exprs(pt.mtr10.and.wt.exprs), pt.design)
pt.contrast.matrix <- makeContrasts("Pf/Tf-mtr10/wt" = mtr10.f-wt.f,
"Ps/Ts-mtr10/wt" = mtr10.s-wt.s,
levels=pt.design)
pt.contrast.matrix
pt.fit2 <- contrasts.fit(pt.fit, pt.contrast.matrix)
pt.fit3 <- eBayes(pt.fit2)
310
#####
##### Model-fit – compare Txn (T) values
#####
library("limma")
dim(txn.mtr10.and.wt)
### Tf or Ts
### mtr10
txn.mtr10.and.wt.exprs <- new("ExpressionSet",
exprs=as.matrix(txn.mtr10.and.wt)) ; dim(txn.mtr10.and.wt.exprs)
design.txn.mtr10 <- model.matrix(~0+factor(c(1,1,2,2,3,3,4,4)))
colnames(design.txn.mtr10) <- c("wt.Tf", "mtr10.Tf", "wt.Ts",
"mtr10.Ts") ; design.txn.mtr10
fit.txn.mtr10
<- lmFit(exprs(txn.mtr10.and.wt.exprs),
design.txn.mtr10)
contrast.matrix.txn.mtr10 <- makeContrasts("Tf-mtr10/wt" = mtr10.Tfwt.Tf,
"Ts-mtr10/wt" = mtr10.Ts-wt.Ts,
levels=design.txn.mtr10)
contrast.matrix.txn.mtr10
fit2.txn.mtr10 <- contrasts.fit(fit.txn.mtr10,
contrast.matrix.txn.mtr10)
fit3.txn.mtr10 <- eBayes(fit2.txn.mtr10)
### msn5
txn.msn5.and.wt.exprs <- new("ExpressionSet",
exprs=as.matrix(txn.msn5.and.wt)) ; dim(txn.msn5.and.wt.exprs)
design.txn.msn5 <- model.matrix(~0+factor(c(1,1,2,2,3,3,4,4)))
colnames(design.txn.msn5) <- c("wt.Tf", "msn5.Tf", "wt.Ts", "msn5.Ts")
; design.txn.msn5
fit.txn.msn5
<- lmFit(exprs(txn.msn5.and.wt.exprs), design.txn.msn5)
contrast.matrix.txn.msn5 <- makeContrasts("Tf-msn5/wt" = msn5.Tf-wt.Tf,
"Ts-msn5/wt" = msn5.Ts-wt.Ts,
levels=design.txn.msn5)
contrast.matrix.txn.msn5
fit2.txn.msn5 <- contrasts.fit(fit.txn.msn5, contrast.matrix.txn.msn5)
fit3.txn.msn5 <- eBayes(fit2.txn.msn5)
#####
#####
#####
#####
Step 2.2 Select Deferential-expressed genes (DEG)
P/M values
### Pf/Mf or Ps/Ms
results.mtr10 <- decideTests(fit3.mtr10, method="separate",
adjust.method="BH", p.value=0.05) ; summary(results.mtr10)
results.msn5 <- decideTests(fit3.msn5, method="separate",
adjust.method="BH", p.value=0.05) ; summary(results.msn5)
pdf("Venn Diagram- PM values_mtr10 vs wt.pdf")
311
vennDiagram(results.mtr10, include=c("up","down"), cex=1.2, lwd=2,
counts.col=c("red", "green4"),
circle.col=c("burlywood4"),
main= "P/M value_p value cutoff 0.05") ; dev.off()
pdf("Venn Diagram- PM values_msn5 vs wt.pdf")
vennDiagram(results.msn5, include=c("up","down"), cex=1.2, lwd=2,
counts.col=c("red", "green4"),
circle.col=c("burlywood4"),
main= "P/M value_p value cutoff 0.05") ; dev.off()
top.pm.f.mtr10 <- topTable(fit3.mtr10, coef=1, adjust="BH",
sort.by="P", number=6000)
top.pm.f.mtr10 <- top.pm.f.mtr10[top.pm.f.mtr10$adj.P.Val <0.05,] ;
dim(top.pm.f.mtr10)
top.pm.f.up.mtr10
<- top.pm.f.mtr10[top.pm.f.mtr10$adj.P.Val <0.05
&(top.pm.f.mtr10 $logFC > 0.6 ),] ; dim(top.pm.f.up.mtr10)
top.pm.f.down.mtr10 <- top.pm.f.mtr10[top.pm.f.mtr10$adj.P.Val <0.05
&(top.pm.f.mtr10 $logFC < -0.6 ),] ; dim(top.pm.f.down.mtr10)
top.pm.s.mtr10 <- topTable(fit3.mtr10, coef=2, adjust="BH",
sort.by="P", number=6000)
top.pm.s.mtr10 <- top.pm.s.mtr10[top.pm.s.mtr10$adj.P.Val <0.05,] ;
dim(top.pm.s.mtr10)
top.pm.s.up.mtr10
<- top.pm.s.mtr10[top.pm.s.mtr10$adj.P.Val <0.05
&(top.pm.s.mtr10 $logFC > 0.6 ),] ; dim(top.pm.s.up.mtr10)
top.pm.s.down.mtr10 <- top.pm.s.mtr10[top.pm.s.mtr10$adj.P.Val <0.05
&(top.pm.s.mtr10 $logFC < -0.6 ),] ; dim(top.pm.s.down.mtr10)
top.pm.f.msn5 <- topTable(fit3.msn5, coef=1, adjust="BH", sort.by="P",
number=6000)
top.pm.f.msn5 <- top.pm.f.msn5[top.pm.f.msn5$adj.P.Val <0.05,] ;
dim(top.pm.f.msn5)
top.pm.f.up.msn5
<- top.pm.f.msn5[top.pm.f.msn5$adj.P.Val <0.05
&(top.pm.f.msn5 $logFC > 0 ),] ; dim(top.pm.f.up.msn5)
top.pm.f.down.msn5 <- top.pm.f.msn5[top.pm.f.msn5$adj.P.Val <0.05
&(top.pm.f.msn5 $logFC < 0 ),] ; dim(top.pm.f.down.msn5)
top.pm.s.msn5 <- topTable(fit3.msn5, coef=2, adjust="BH", sort.by="P",
number=6000)
top.pm.s.msn5 <- top.pm.s.msn5[top.pm.s.msn5$adj.P.Val <0.05,] ;
dim(top.pm.s.msn5)
top.pm.s.up.msn5
<- top.pm.s.msn5[top.pm.s.msn5$adj.P.Val <0.05
&(top.pm.s.msn5 $logFC > 0 ),] ; dim(top.pm.s.up.msn5)
top.pm.s.down.msn5 <- top.pm.s.msn5[top.pm.s.msn5$adj.P.Val <0.05
&(top.pm.s.msn5 $logFC < 0 ),] ; dim(top.pm.s.down.msn5)
nn <- intersect (top.pm.f.down.mtr10$ID,
top.pm.f.down.msn5$ID);length(nn)
# number is 7
312
#####
#####
#####
Select DEG
--
P/T values
### Pf/Tf or Ps/Ts## use adj.p value 0.01 for DEG selection
results.pt.mtr10 <- decideTests(pt.fit3, method="separate",
adjust.method="BH", p.value=0.01, lfc=0.6);
summary(results.pt.mtr10)
pdf("Venn Diagram- PT values_mtr10 vs wt.pdf")
vennDiagram(results.pt.mtr10, include=c("up","down"), cex=1.2, lwd=2,
counts.col=c("red", "green4"),
circle.col=c("burlywood4"),
main= "P/T value_p value cutoff 0.01 and lfc=0.6") ;
dev.off()
top.pt.f.mtr10 <- topTable(pt.fit3, coef=1, adjust="BH", sort.by="P",
number=6000)
top.pt.f.mtr10 <- top.pt.f.mtr10[top.pt.f.mtr10$adj.P.Val <0.01,] ;
dim(top.pt.f.mtr10)
top.pt.f.mtr10.up
<- top.pt.f.mtr10[top.pt.f.mtr10$adj.P.Val <0.01
&(top.pt.f.mtr10 $logFC > 0.6 ),] ; dim(top.pt.f.mtr10.up)
top.pt.f.mtr10.down <- top.pt.f.mtr10[top.pt.f.mtr10$adj.P.Val <0.01
&(top.pt.f.mtr10 $logFC < -0.6 ),] ; dim(top.pt.f.mtr10.down)
top.pt.s.mtr10 <- topTable(pt.fit3, coef=2, adjust="BH", sort.by="P",
number=6000)
top.pt.s.mtr10 <- top.pt.s.mtr10[top.pt.s.mtr10$adj.P.Val <0.01,] ;
dim(top.pt.s.mtr10)
top.pt.s.mtr10.up
<- top.pt.s.mtr10[top.pt.s.mtr10$adj.P.Val <0.01
&(top.pt.s.mtr10 $logFC > 0.6 ),] ; dim(top.pt.s.mtr10.up)
top.pt.s.mtr10.down <- top.pt.s.mtr10[top.pt.s.mtr10$adj.P.Val <0.01
&(top.pt.s.mtr10 $logFC < -0.6 ),] ; dim(top.pt.s.mtr10.down)
#####
#####
#####
Select DEG
--
Txn values
#### Tf or Ts
results.txn.mtr10 <- decideTests(fit3.txn.mtr10, method="separate",
adjust.method="BH", p.value=0.001, lfc=0.6) ;
summary(results.txn.mtr10)
results.txn.msn5 <- decideTests(fit3.txn.msn5, method="separate",
adjust.method="BH", p.value=0.05, lfc=0.6) ;
summary(results.txn.msn5)
pdf("Venn Diagram- Txn values_mtr10 vs wt.pdf")
vennDiagram(results.txn.mtr10, include=c("up","down"), cex=1.2, lwd=3,
counts.col=c("red2", "green4"),
circle.col=c("burlywood4"),
main= "Txn_p value cutoff 0.001 and lfc=0.6") ; dev.off()
313
pdf("Venn Diagram- Txn values_msn5 vs wt.pdf")
vennDiagram(results.txn.msn5, include=c("up","down"), cex=1.2, lwd=3,
counts.col=c("red2", "green4"),
circle.col=c("burlywood4"),
main= "Txn_p value cutoff 0.05 and lfc=0.6") ; dev.off()
top.Tf.mtr10 <- topTable(fit3.txn.mtr10, coef=1, adjust="BH",
sort.by="P", number=6000)
top.Tf.mtr10 <- top.Tf.mtr10[top.Tf.mtr10$adj.P.Val <0.001,] ;
dim(top.Tf.mtr10)
top.Tf.up.mtr10
<- top.Tf.mtr10[top.Tf.mtr10$adj.P.Val <0.001 &
(top.Tf.mtr10 $logFC > 0.6 ),]; dim(top.Tf.up.mtr10)
top.Tf.down.mtr10 <- top.Tf.mtr10[top.Tf.mtr10$adj.P.Val <0.001 &
(top.Tf.mtr10 $logFC < -0.6 ),]; dim(top.Tf.down.mtr10)
top.Ts.mtr10 <- topTable(fit3.txn.mtr10, coef=2, adjust="BH",
sort.by="P", number=6000)
top.Ts.mtr10 <- top.Ts.mtr10 [top.Ts.mtr10 $adj.P.Val <0.001,] ;
dim(top.Ts.mtr10 )
top.Ts.up.mtr10
<- top.Ts.mtr10 [top.Ts.mtr10 $adj.P.Val <0.001 &
(top.Ts.mtr10 $logFC > 0.6 ),]; dim(top.Ts.up.mtr10 )
top.Ts.down.mtr10 <- top.Ts.mtr10 [top.Ts.mtr10 $adj.P.Val <0.001 &
(top.Ts.mtr10 $logFC < -0.6 ),]; dim(top.Ts.down.mtr10 )
top.Tf.msn5 <- topTable(fit3.txn.msn5, coef=1, adjust="BH",
sort.by="P", number=6000)
top.Tf.msn5 <- top.Tf.msn5[top.Tf.msn5$adj.P.Val <0.05,] ;
dim(top.Tf.msn5)
top.Tf.up.msn5
<- top.Tf.msn5[top.Tf.msn5$adj.P.Val <0.05 &
(top.Tf.msn5 $logFC > 0.6 ),]; dim(top.Tf.up.msn5)
top.Tf.down.msn5 <- top.Tf.msn5[top.Tf.msn5$adj.P.Val <0.05 &
(top.Tf.msn5 $logFC < -0.6 ),]; dim(top.Tf.down.msn5)
top.Ts.msn5 <- topTable(fit3.txn.msn5, coef=2, adjust="BH",
sort.by="P", number=6000)
top.Ts.msn5 <- top.Ts.msn5 [top.Ts.msn5 $adj.P.Val <0.05,] ;
dim(top.Ts.msn5 )
top.Ts.up.msn5
<- top.Ts.msn5 [top.Ts.msn5 $adj.P.Val <0.05 &
(top.Ts.msn5 $logFC > 0.6 ),]; dim(top.Ts.up.msn5 )
top.Ts.down.msn5 <- top.Ts.msn5 [top.Ts.msn5 $adj.P.Val <0.05 &
(top.Ts.msn5 $logFC < -0.6 ),]; dim(top.Ts.down.msn5 )
rr.up
<- intersect(top.Tf.up.msn5$ID , top.Tf.up.mtr10$ID)
;length(rr.up)
rr.down <- intersect(top.Tf.down.msn5$ID , top.Tf.down.mtr10$ID)
;length(rr.down)
yy.up
<- intersect(top.Ts.up.msn5$ID, top.Ts.up.mtr10$ID)
;length(yy.up)
yy.down <- intersect(top.Ts.down.msn5$ID, top.Ts.down.mtr10$ID)
;length(yy.down)
314
#####
#####
#####
Step 2.3 Build annotation tables with expression values
#####
#####
mtr10
Generate mtr10 annotation table with P/M up-regulated genes
P/M values
top.pm.f.up.mtr10.id <- as.vector(top.pm.f.up.mtr10$ID)
;length(top.f.up.mtr10.id)
# Retrieves gene descriptions
symbols <- as.vector(unlist(mget(top.pm.f.up.mtr10.id,
yeast2GENENAME)))
# Retrieves ORF
ORF
<- as.vector(unlist(mget(top.pm.f.up.mtr10.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.pm.f.up.mtr10.id,
yeast2DESCRIPTION)))
# Build together
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.pm.f.up.df.mtr10
<- data.frame(probeIDs=top.pm.f.up.mtr10.id,
symbols, ORF, des, sym.orf.des);dim(top.pm.f.up.df.mtr10)
# Retrieves expression value
pm.f.up.mtr10.2 <data.frame(exprs(pm.mtr10.and.wt.exprs)[top.pm.f.up.mtr10.id, ])
# Merges everything with above expression data.
output.pm.f.up.mtr10
<- merge(top.pm.f.up.df.mtr10 ,pm.f.up.mtr10.2,
by.x="probeIDs", by.y=0, all=T);dim(output.pm.f.up.mtr10)
output.pm.f.up.mtr10.2 <- cbind(output.pm.f.up.mtr10,
top.pm.f.up.mtr10) ;dim(output.pm.f.up.mtr10.2)
# Export dataframe
write.table(output.pm.f.up.mtr10.2,
file="annot_limma_P0.05_pm.f.up.mtr10_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
##### Generate mtr10 annotation table with P/M down-regulated genes
top.pm.f.down.mtr10.id <- as.vector(top.pm.f.down.mtr10$ID)
;length(top.pm.f.down.mtr10.id)
symbols <- as.vector(unlist(mget(top.pm.f.down.mtr10.id,
yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.pm.f.down.mtr10.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.pm.f.down.mtr10.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.pm.f.down.df.mtr10
<- data.frame(probeIDs=top.pm.f.down.mtr10.id,
symbols, ORF, des, sym.orf.des);dim(top.pm.f.down.df.mtr10)
pm.f.down.mtr10.2 <data.frame(exprs(pm.mtr10.and.wt.exprs)[top.pm.f.down.mtr10.id, ])
315
output.pm.f.down.mtr10 <- merge(top.pm.f.down.df.mtr10
,pm.f.down.mtr10.2, by.x="probeIDs", by.y=0,
all=T);dim(output.pm.f.down.mtr10)
output.pm.f.down.mtr10.2 <- cbind(output.pm.f.down.mtr10,
top.pm.f.down.mtr10) ;dim(output.pm.f.down.mtr10.2)
write.table(output.pm.f.down.mtr10.2,
file="annot_limma_P0.05_pm.f.down.mtr10_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
### Generate mtr10 annotation table with P/M.starved up-regulated
###genes
top.pm.s.up.mtr10.id <- as.vector(top.pm.s.up.mtr10$ID)
;length(top.pm.s.up.mtr10.id)
symbols <- as.vector(unlist(mget(top.pm.s.up.mtr10.id,
yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.pm.s.up.mtr10.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.pm.s.up.mtr10.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.pm.s.up.df.mtr10
<- data.frame(probeIDs=top.pm.s.up.mtr10.id,
symbols, ORF, des, sym.orf.des);dim(top.pm.s.up.df.mtr10)
pm.s.up.mtr10.2 <data.frame(exprs(pm.mtr10.and.wt.exprs)[top.pm.s.up.mtr10.id, ])
output.pm.s.up.mtr10
<- merge(top.pm.s.up.df.mtr10 ,pm.s.up.mtr10.2,
by.x="probeIDs", by.y=0, all=T);dim(output.pm.s.up.mtr10)
output.pm.s.up.mtr10.2 <- cbind(output.pm.s.up.mtr10,
top.pm.s.up.mtr10) ;dim(output.pm.s.up.mtr10.2)
write.table(output.pm.s.up.mtr10.2,
file="annot_limma_P0.05_pm.s.up.mtr10_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
### Generate mtr10 annotation table with P/M.starved down-regulated
###genes
top.pm.s.down.mtr10.id <- as.vector(top.pm.s.down.mtr10$ID)
;length(top.pm.s.down.mtr10.id)
symbols <- as.vector(unlist(mget(top.pm.s.down.mtr10.id,
yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.pm.s.down.mtr10.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.pm.s.down.mtr10.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.pm.s.down.df.mtr10
<- data.frame(probeIDs=top.pm.s.down.mtr10.id,
symbols, ORF, des, sym.orf.des);dim(top.pm.s.down.df.mtr10)
pm.s.down.mtr10.2 <data.frame(exprs(pm.mtr10.and.wt.exprs)[top.pm.s.down.mtr10.id, ])
output.pm.s.down.mtr10
<- merge(top.pm.s.down.df.mtr10
,pm.s.down.mtr10.2, by.x="probeIDs", by.y=0,
all=T);dim(output.pm.s.down.mtr10)
output.pm.s.down.mtr10.2 <cbind(output.pm.s.down.mtr10, top.pm.s.down.mtr10)
;dim(output.pm.s.down.mtr10.2)
write.table(output.pm.s.down.mtr10.2,
file="annot_limma_P0.05_pm.s.down.mtr10_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
316
### msn5
### P/M values
dim(pm.msn5.and.wt.exprs)
### Generate msn5 annotation table with P/M.fed down-regulated genes
top.pm.f.down.msn5.id <- as.vector(top.pm.f.down.msn5$ID)
;length(top.pm.f.down.msn5.id)
symbols <- as.vector(unlist(mget(top.pm.f.down.msn5.id,
yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.pm.f.down.msn5.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.pm.f.down.msn5.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.pm.f.down.df.msn5
<- data.frame(probeIDs=top.pm.f.down.msn5.id,
symbols, ORF, des, sym.orf.des);dim(top.pm.f.down.df.msn5)
pm.f.down.msn5.2
<data.frame(exprs(pm.msn5.and.wt.exprs)[top.pm.f.down.msn5.id, ])
output.pm.f.down.msn5
<- merge(top.pm.f.down.df.msn5
,pm.f.down.msn5.2, by.x="probeIDs", by.y=0,
all=T);dim(output.pm.f.down.msn5)
output.pm.f.down.msn5.2 <cbind(output.pm.f.down.msn5, top.pm.f.down.msn5)
;dim(output.pm.f.down.msn5.2)
write.table(output.pm.f.down.msn5.2,
file="annot_limma_P0.05_pm.f.down.msn5_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
## P/T values
## mtr10 only
dim(pt.mtr10.and.wt.exprs)
### Generate mtr10 annotation table with P/T.fed up-regulated genes
top.pt.f.mtr10.up.id <- as.vector(top.pt.f.mtr10.up$ID)
;length(top.pt.f.mtr10.up.id )
symbols <- as.vector(unlist(mget(top.pt.f.mtr10.up.id,
yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.pt.f.mtr10.up.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.pt.f.mtr10.up.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.pt.f.up.df.mtr10
<- data.frame(probeIDs=top.pt.f.mtr10.up.id,
symbols, ORF, des, sym.orf.des);dim(top.pt.f.up.df.mtr10)
pt.f.up.mtr10.2 <data.frame(exprs(pt.mtr10.and.wt.exprs)[top.pt.f.mtr10.up.id, ])
output.pt.f.up.mtr10
<- merge(top.pt.f.up.df.mtr10 ,pt.f.up.mtr10.2,
by.x="probeIDs", by.y=0, all=T);dim(output.pt.f.up.mtr10)
output.pt.f.up.mtr10.2 <- cbind(output.pt.f.up.mtr10,
top.pt.f.mtr10.up) ;dim(output.pt.f.up.mtr10.2)
write.table(output.pt.f.up.mtr10.2,
file="annot_limma_P0.01_pt.f.up.mtr10_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
317
### Generate mtr10 annotation table with P/T.fed down-regulated genes
top.pt.f.mtr10.down.id <- as.vector(top.pt.f.mtr10.down$ID)
;length(top.pt.f.mtr10.down.id )
symbols <- as.vector(unlist(mget(top.pt.f.mtr10.down.id,
yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.pt.f.mtr10.down.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.pt.f.mtr10.down.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.pt.f.down.df.mtr10
<- data.frame(probeIDs=top.pt.f.mtr10.down.id,
symbols, ORF, des, sym.orf.des);dim(top.pt.f.down.df.mtr10)
pt.f.down.mtr10.2 <data.frame(exprs(pt.mtr10.and.wt.exprs)[top.pt.f.mtr10.down.id, ])
output.pt.f.down.mtr10
<- merge(top.pt.f.down.df.mtr10
,pt.f.down.mtr10.2, by.x="probeIDs", by.y=0,
all=T);dim(output.pt.f.down.mtr10)
output.pt.f.down.mtr10.2 <cbind(output.pt.f.down.mtr10, top.pt.f.mtr10.down)
;dim(output.pt.f.down.mtr10.2)
write.table(output.pt.f.down.mtr10.2,
file="annot_limma_P0.01_pt.f.down.mtr10_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
### Generate mtr10 annotation table with P/T.starved up-regulated genes
top.pt.s.mtr10.up.id <- as.vector(top.pt.s.mtr10.up$ID)
;length(top.pt.s.mtr10.up.id )
symbols <- as.vector(unlist(mget(top.pt.s.mtr10.up.id,
yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.pt.s.mtr10.up.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.pt.s.mtr10.up.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.pt.s.up.df.mtr10
<- data.frame(probeIDs=top.pt.s.mtr10.up.id,
symbols, ORF, des, sym.orf.des);dim(top.pt.s.up.df.mtr10)
pt.s.up.mtr10.2 <data.frame(exprs(pt.mtr10.and.wt.exprs)[top.pt.s.mtr10.up.id, ])
output.pt.s.up.mtr10
<- merge(top.pt.s.up.df.mtr10 ,pt.s.up.mtr10.2,
by.x="probeIDs", by.y=0, all=T);dim(output.pt.s.up.mtr10)
output.pt.s.up.mtr10.2 <- cbind(output.pt.s.up.mtr10,
top.pt.s.mtr10.up) ;dim(output.pt.s.up.mtr10.2)
write.table(output.pt.s.up.mtr10.2,
file="annot_limma_P0.01_pt.s.up.mtr10_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
### Generate mtr10 annotation table with P/T.starved down-regulated
###genes
top.pt.s.mtr10.down.id <- as.vector(top.pt.s.mtr10.down$ID)
;length(top.pt.s.mtr10.down.id )
symbols <- as.vector(unlist(mget(top.pt.s.mtr10.down.id,
yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.pt.s.mtr10.down.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.pt.s.mtr10.down.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
318
top.pt.s.down.df.mtr10
<- data.frame(probeIDs=top.pt.s.mtr10.down.id,
symbols, ORF, des, sym.orf.des);dim(top.pt.s.down.df.mtr10)
pt.s.down.mtr10.2 <data.frame(exprs(pt.mtr10.and.wt.exprs)[top.pt.s.mtr10.down.id, ])
output.pt.s.down.mtr10
<- merge(top.pt.s.down.df.mtr10
,pt.s.down.mtr10.2, by.x="probeIDs", by.y=0,
all=T);dim(output.pt.s.down.mtr10)
output.pt.s.down.mtr10.2 <- cbind(output.pt.s.down.mtr10,
top.pt.s.mtr10.down) ;dim(output.pt.s.down.mtr10.2)
write.table(output.pt.s.down.mtr10.2,
file="annot_limma_P0.01_pt.s.down.mtr10_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
## Txn values
## mtr10
dim(txn.mtr10.and.wt.exprs)
### Generate mtr10 annotation table with Total.fed up-regulated
###genes
top.Tf.up.mtr10.id <- as.vector(top.Tf.up.mtr10$ID)
;length(top.Tf.up.mtr10.id)
symbols <- as.vector(unlist(mget(top.Tf.up.mtr10.id, yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.Tf.up.mtr10.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.Tf.up.mtr10.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.Tf.up.df.mtr10
<- data.frame(probeIDs=top.Tf.up.mtr10.id,
symbols, ORF, des, sym.orf.des);dim(top.Tf.up.df.mtr10)
Tf.up.mtr10.2 <data.frame(exprs(pm.mtr10.and.wt.exprs)[top.Tf.up.mtr10.id, ])
output.Tf.up.mtr10
<- merge(top.Tf.up.df.mtr10 ,Tf.up.mtr10.2,
by.x="probeIDs", by.y=0, all=T);dim(output.Tf.up.mtr10)
output.Tf.up.mtr10.2 <- cbind(output.Tf.up.mtr10, top.Tf.up.mtr10)
;dim(output.Tf.up.mtr10.2)
write.table(output.Tf.up.mtr10.2,
file="annot_limma_P0.05_Tf.up.mtr10_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
### Generate mtr10 annotation table with Total.fed down-regulated
###genes
top.Tf.down.mtr10.id <- as.vector(top.Tf.down.mtr10$ID)
;length(top.Tf.down.mtr10.id)
symbols <- as.vector(unlist(mget(top.Tf.down.mtr10.id,
yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.Tf.down.mtr10.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.Tf.down.mtr10.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.Tf.down.df.mtr10
<- data.frame(probeIDs=top.Tf.down.mtr10.id,
symbols, ORF, des, sym.orf.des);dim(top.Tf.down.df.mtr10)
319
Tf.down.mtr10.2 <data.frame(exprs(pm.mtr10.and.wt.exprs)[top.Tf.down.mtr10.id, ])
output.Tf.down.mtr10
<- merge(top.Tf.down.df.mtr10 ,Tf.down.mtr10.2,
by.x="probeIDs", by.y=0, all=T);dim(output.Tf.down.mtr10)
output.Tf.down.mtr10.2 <- cbind(output.Tf.down.mtr10,
top.Tf.down.mtr10) ;dim(output.Tf.down.mtr10.2)
write.table(output.Tf.down.mtr10.2,
file="annot_limma_P0.05_Tf.down.mtr10_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
### Generate mtr10 annotation table with Total.starved up-regulated
###genes
top.Ts.up.mtr10.id <- as.vector(top.Ts.up.mtr10$ID)
;length(top.Ts.up.mtr10.id)
symbols <- as.vector(unlist(mget(top.Ts.up.mtr10.id, yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.Ts.up.mtr10.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.Ts.up.mtr10.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.Ts.up.df.mtr10
<- data.frame(probeIDs=top.Ts.up.mtr10.id,
symbols, ORF, des, sym.orf.des);dim(top.Ts.up.df.mtr10)
Ts.up.mtr10.2 <data.frame(exprs(pm.mtr10.and.wt.exprs)[top.Ts.up.mtr10.id, ])
output.Ts.up.mtr10
<- merge(top.Ts.up.df.mtr10 ,Ts.up.mtr10.2,
by.x="probeIDs", by.y=0, all=T);dim(output.Ts.up.mtr10)
output.Ts.up.mtr10.2 <- cbind(output.Ts.up.mtr10, top.Ts.up.mtr10)
;dim(output.Ts.up.mtr10.2)
write.table(output.Ts.up.mtr10.2,
file="annot_limma_P0.05_Ts.up.mtr10_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
### Generate mtr10 annotation table with Total.starved down-regulated
###genes
top.Ts.down.mtr10.id <- as.vector(top.Ts.down.mtr10$ID)
;length(top.Ts.down.mtr10.id)
symbols <- as.vector(unlist(mget(top.Ts.down.mtr10.id,
yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.Ts.down.mtr10.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.Ts.down.mtr10.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.Ts.down.df.mtr10
<- data.frame(probeIDs=top.Ts.down.mtr10.id,
symbols, ORF, des, sym.orf.des);dim(top.Ts.down.df.mtr10)
Ts.down.mtr10.2 <data.frame(exprs(pm.mtr10.and.wt.exprs)[top.Ts.down.mtr10.id, ])
output.Ts.down.mtr10
<- merge(top.Ts.down.df.mtr10 ,Ts.down.mtr10.2,
by.x="probeIDs", by.y=0, all=T);dim(output.Ts.down.mtr10)
output.Ts.down.mtr10.2 <- cbind(output.Ts.down.mtr10,
top.Ts.down.mtr10) ;dim(output.Ts.down.mtr10.2)
write.table(output.Ts.down.mtr10.2,
file="annot_limma_P0.05_Ts.down.mtr10_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
320
## Txn values
## msn5
dim(txn.msn5.and.wt.exprs)
### Generate msn5 annotation table with Total.fed up-regulated genes
top.Tf.up.msn5.id <- as.vector(top.Tf.up.msn5$ID)
;length(top.Tf.up.msn5.id)
symbols <- as.vector(unlist(mget(top.Tf.up.msn5.id, yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.Tf.up.msn5.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.Tf.up.msn5.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.Tf.up.df.msn5
<- data.frame(probeIDs=top.Tf.up.msn5.id, symbols,
ORF, des, sym.orf.des);dim(top.Tf.up.df.msn5)
Tf.up.msn5.2 <data.frame(exprs(pm.msn5.and.wt.exprs)[top.Tf.up.msn5.id, ])
output.Tf.up.msn5
<- merge(top.Tf.up.df.msn5 ,Tf.up.msn5.2,
by.x="probeIDs", by.y=0, all=T);dim(output.Tf.up.msn5)
output.Tf.up.msn5.2 <- cbind(output.Tf.up.msn5, top.Tf.up.msn5)
;dim(output.Tf.up.msn5.2)
write.table(output.Tf.up.msn5.2,
file="annot_limma_P0.05_Tf.up.msn5_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
### Generate msn5 annotation table with Total.fed down-regulated genes
top.Tf.down.msn5.id <- as.vector(top.Tf.down.msn5$ID)
;length(top.Tf.down.msn5.id)
symbols <- as.vector(unlist(mget(top.Tf.down.msn5.id,
yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.Tf.down.msn5.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.Tf.down.msn5.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.Tf.down.df.msn5
<- data.frame(probeIDs=top.Tf.down.msn5.id,
symbols, ORF, des, sym.orf.des);dim(top.Tf.down.df.msn5)
Tf.down.msn5.2 <data.frame(exprs(pm.msn5.and.wt.exprs)[top.Tf.down.msn5.id, ])
output.Tf.down.msn5
<- merge(top.Tf.down.df.msn5 ,Tf.down.msn5.2,
by.x="probeIDs", by.y=0, all=T);dim(output.Tf.down.msn5)
output.Tf.down.msn5.2 <- cbind(output.Tf.down.msn5, top.Tf.down.msn5)
;dim(output.Tf.down.msn5.2)
write.table(output.Tf.down.msn5.2,
file="annot_limma_P0.05_Tf.down.msn5_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
### Generate msn5 annotation table with Total.starved up-regulated
###genes
top.Ts.up.msn5.id <- as.vector(top.Ts.up.msn5$ID)
;length(top.Ts.up.msn5.id)
symbols <- as.vector(unlist(mget(top.Ts.up.msn5.id, yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.Ts.up.msn5.id, yeast2ORF)))
321
des
<- as.vector(unlist(mget(top.Ts.up.msn5.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.Ts.up.df.msn5
<- data.frame(probeIDs=top.Ts.up.msn5.id, symbols,
ORF, des, sym.orf.des);dim(top.Ts.up.df.msn5)
Ts.up.msn5.2 <data.frame(exprs(pm.msn5.and.wt.exprs)[top.Ts.up.msn5.id, ])
output.Ts.up.msn5
<- merge(top.Ts.up.df.msn5 ,Ts.up.msn5.2,
by.x="probeIDs", by.y=0, all=T);dim(output.Ts.up.msn5)
output.Ts.up.msn5.2 <- cbind(output.Ts.up.msn5, top.Ts.up.msn5)
;dim(output.Ts.up.msn5.2)
write.table(output.Ts.up.msn5.2,
file="annot_limma_P0.05_Ts.up.msn5_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
### Generate msn5 annotation table with Total.starved down-regulated
###genes
top.Ts.down.msn5.id <- as.vector(top.Ts.down.msn5$ID)
;length(top.Ts.down.msn5.id)
symbols <- as.vector(unlist(mget(top.Ts.down.msn5.id,
yeast2GENENAME)))
ORF
<- as.vector(unlist(mget(top.Ts.down.msn5.id, yeast2ORF)))
des
<- as.vector(unlist(mget(top.Ts.down.msn5.id,
yeast2DESCRIPTION)))
sym.orf.des <- as.vector(paste(symbols, ORF, des, sep="."))
top.Ts.down.df.msn5
<- data.frame(probeIDs=top.Ts.down.msn5.id,
symbols, ORF, des, sym.orf.des);dim(top.Ts.down.df.msn5)
Ts.down.msn5.2 <data.frame(exprs(pm.msn5.and.wt.exprs)[top.Ts.down.msn5.id, ])
output.Ts.down.msn5
<- merge(top.Ts.down.df.msn5 ,Ts.down.msn5.2,
by.x="probeIDs", by.y=0, all=T);dim(output.Ts.down.msn5)
output.Ts.down.msn5.2 <- cbind(output.Ts.down.msn5, top.Ts.down.msn5)
;dim(output.Ts.down.msn5.2)
write.table(output.Ts.down.msn5.2,
file="annot_limma_P0.05_Ts.down.msn5_vs_WT_usesmall dataset.txt",
sep="\t",quote=FALSE)
##### Step 3
##### Generate graphs of DEGs
#####
###
### Volcano plot
###
## Step 3.1
## average PM values
wt.pm.f <- exprs(esetsub[, 1:2])- exprs(esetsub[, 3:4]) ; dim(wt.pm.f)
wt.pm.f.avg <- rowMeans(wt.pm.f)
wt.pm.s <- exprs(esetsub[, 5:6])- exprs(esetsub[, 7:8]) ; dim(wt.pm.s)
wt.pm.s.avg <- rowMeans(wt.pm.s)
wt.pm.sf <- wt.pm.s - wt.pm.f ; dim(wt.pm.sf)
322
wt.pm.sf.avg <- rowMeans(wt.pm.sf)
msn5.pm.f <- exprs(esetsub[, 9:10]) - exprs(esetsub[, 11:12])
msn5.pm.f.avg <- rowMeans(msn5.pm.f)
msn5.pm.s <- exprs(esetsub[, 13:14])- exprs(esetsub[, 15:16])
msn5.pm.s.avg <- rowMeans(msn5.pm.s)
msn5.pm.sf <- msn5.pm.s - msn5.pm.f
msn5.pm.sf.avg <- rowMeans(msn5.pm.sf)
mtr10.pm.f <- exprs(esetsub[, 17:18]) - exprs(esetsub[, 19:20])
mtr10.pm.f.avg <- rowMeans(mtr10.pm.f)
mtr10.pm.s <- exprs(esetsub[, 21:22])- exprs(esetsub[, 23:24])
mtr10.pm.s.avg <- rowMeans(mtr10.pm.s)
mtr10.pm.sf <- mtr10.pm.s - mtr10.pm.f
mtr10.pm.sf.avg <- rowMeans(mtr10.pm.sf)
## mtr10
mtr10.pm.f.dif
<- mtr10.pm.f.avg-wt.pm.f.avg;
length(mtr10.pm.f.dif)
mtr10.pm.s.dif
<- mtr10.pm.s.avg-wt.pm.s.avg;
length(mtr10.pm.s.dif)
logp.mtr10.pm.f <- -log10(fit3.mtr10$p.value[,1])
adj.p.val
logp.mtr10.pm.s <- -log10(fit3.mtr10$p.value[,2])
## msn5
msn5.pm.f.dif
msn5.pm.s.dif
logp.msn5.pm.f
logp.msn5.pm.s
<<-
<- msn5.pm.f.avg-wt.pm.f.avg
<- msn5.pm.s.avg-wt.pm.s.avg
-log10(fit3.msn5$p.value[,1])
-log10(fit3.msn5$p.value[,2])
### NOT
### NOT adj.p.val
## PT values
## mtr10
mtr10.pt.f.dif
<- mtr10.pt.f.avg-wt.pt.f.avg;
length(mtr10.pt.f.dif)
mtr10.pt.s.dif
<- mtr10.pt.s.avg-wt.pt.s.avg;
length(mtr10.pt.s.dif)
logp.mtr10.pt.f <- -log10(pt.fit3$p.value[,1])
### NOT adj.p.val
logp.mtr10.pt.s <- -log10(pt.fit3$p.value[,2])
## Txn values
## mtr10
mtr10.Tf.dif
mtr10.Ts.dif
logp.mtr10.Tf
adj.p.val
logp.mtr10.Ts
## msn5
msn5.Tf.dif
msn5.Ts.dif
<- mtr10.t.f.avg - wt.t.f.avg
<- mtr10.t.s.avg - wt.t.s.avg
<- -log10(fit3.txn.mtr10$p.value[,1])
<-
-log10(fit3.txn.mtr10$p.value[,2])
<- msn5.t.f.avg - wt.t.f.avg
<- msn5.t.s.avg - wt.t.s.avg
323
### NOT
logp.msn5.Tf
adj.p.val
logp.msn5.Ts
<-
-log10(fit3.txn.msn5$p.value[,1])
<-
-log10(fit3.txn.msn5$p.value[,2])
### NOT
## Step 3.2
## Making plots
pdf("Volcano plot of limma_PM values_mtr10 vs wt.pdf")
plot(mtr10.pm.f.dif, -log10(fit3.mtr10$p.value[,1]),
xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0",
main = "Volcano plot of limma -- Pf/Mf_mtr10 vs wt")
points(mtr10.pm.f.dif[top.pm.f.down.mtr10$ID],
logp.mtr10.pm.f[top.pm.f.down.mtr10$ID], pch = 20, col= "blue3")
points(mtr10.pm.f.dif[top.pm.f.up.mtr10$ID],
logp.mtr10.pm.f[top.pm.f.up.mtr10$ID], pch = 20, col= "red3")
abline(h =2.7, col="darkolivegreen4", lty=2)
## h value is
smallest of -log10(p.value)
abline(v = 0.6, col="darkolivegreen4", lty=2)
abline(v = -0.6, col="darkolivegreen4", lty=2)
plot(mtr10.pm.s.dif, -log10(fit3.mtr10$p.value[,2]),
xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0",
main = "Volcano plot of limma -- Ps/Ms_mtr10 vs wt")
points(mtr10.pm.s.dif[top.pm.s.down.mtr10$ID],
logp.mtr10.pm.s[top.pm.s.down.mtr10$ID], pch = 20, col= "blue3")
points(mtr10.pm.s.dif[top.pm.s.up.mtr10$ID],
logp.mtr10.pm.s[top.pm.s.up.mtr10$ID], pch = 20, col= "red3")
abline(h =4.2, col="darkolivegreen4", lty=2)
abline(v = 0.6, col="darkolivegreen4", lty=2)
abline(v = -0.6, col="darkolivegreen4", lty=2);dev.off()
pdf("Volcano plot of limma_PT values_mtr10 vs wt.pdf")
plot(mtr10.pt.f.dif, -log10(pt.fit3$p.value[,1]),
xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0",
main = "Volcano plot of limma -- Pf/Tf_mtr10 vs wt")
points(mtr10.pt.f.dif[top.pt.f.mtr10.down$ID],
logp.pt.f[top.pt.f.mtr10.down$ID], pch = 20, col= "blue3")
points(mtr10.pt.f.dif[top.pt.f.mtr10.up$ID],
logp.pt.f[top.pt.f.mtr10.up$ID], pch = 20, col= "red3")
abline(v = 0.6, col="darkolivegreen4", lty=2)
abline(v = -0.6, col="darkolivegreen4", lty=2)
plot(mtr10.pt.s.dif, -log10(pt.fit3$p.value[,2]),
xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0",
main = "Volcano plot of limma -- Pf/Tf_mtr10 vs wt")
points(mtr10.pt.s.dif[top.pt.s.mtr10.down$ID],
logp.pt.s[top.pt.s.mtr10.down$ID], pch = 20, col= "blue3")
points(mtr10.pt.s.dif[top.pt.s.mtr10.up$ID],
logp.pt.s[top.pt.s.mtr10.up$ID], pch = 20, col= "red3")
abline(h = 3.1, col="darkolivegreen4", lty=2)
abline(v = 0.6, col="darkolivegreen4", lty=2)
abline(v = -0.6, col="darkolivegreen4", lty=2);dev.off()
324
## plots of Txn values
pdf("Volcano plot of limma_Txn values_mtr10 vs wt.pdf")
plot(mtr10.Tf.dif, -log10(fit3.txn.mtr10$p.value[,1]),
xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0",
main = "Volcano plot of limma -- Tf_mtr10 vs wt")
points(mtr10.Tf.dif[top.Tf.down.mtr10 $ID],
logp.mtr10.Tf[top.Tf.down.mtr10 $ID], pch = 20, col= "blue3")
points(mtr10.Tf.dif[top.Tf.up.mtr10 $ID],
logp.mtr10.Tf[top.Tf.up.mtr10$ID], pch = 20, col= "red3")
abline(h = 4, col="darkolivegreen4", lty=2)
abline(v = 0.6, col="darkolivegreen4", lty=2)
abline(v = -0.6, col="darkolivegreen4", lty=2)
plot(mtr10.Ts.dif, -log10(fit3.txn.mtr10$p.value[,2]),
xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0",
main = "Volcano plot of limma -- Ts_mtr10 vs wt")
points(mtr10.Ts.dif[top.Ts.down.mtr10 $ID],
logp.mtr10.Ts[top.Ts.down.mtr10 $ID], pch = 20, col= "blue3")
points(mtr10.Ts.dif[top.Ts.up.mtr10 $ID],
logp.mtr10.Ts[top.Ts.up.mtr10$ID], pch = 20, col= "red3")
abline(h = 3.63, col="darkolivegreen4", lty=2)
abline(v = 0.6, col="darkolivegreen4", lty=2)
abline(v = -0.6, col="darkolivegreen4", lty=2);dev.off()
pdf("Volcano plot of limma_Txn values_msn5 vs wt.pdf")
plot(msn5.Tf.dif, -log10(fit3.txn.msn5$p.value[,1]),
xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0",
main = "Volcano plot of limma -- Tf_msn5 vs wt")
points(msn5.Tf.dif[top.Tf.down.msn5 $ID],
logp.msn5.Tf[top.Tf.down.msn5 $ID], pch = 20, col= "blue3")
points(msn5.Tf.dif[top.Tf.up.msn5 $ID],
logp.msn5.Tf[top.Tf.up.msn5$ID], pch = 20, col= "red3")
abline(h = 2.1, col="darkolivegreen4", lty=2)
abline(v = 0.6, col="darkolivegreen4", lty=2)
abline(v = -0.6, col="darkolivegreen4", lty=2)
plot(msn5.Ts.dif, -log10(fit3.txn.msn5$p.value[,2]),
xlab="diff(logFC)",ylab="-log10 p value", cex=0.5, col="#A0A0A0",
main = "Volcano plot of limma -- Ts_msn5 vs wt")
points(msn5.Ts.dif[top.Ts.down.msn5 $ID],
logp.msn5.Ts[top.Ts.down.msn5 $ID], pch = 20, col= "blue3")
points(msn5.Ts.dif[top.Ts.up.msn5 $ID],
logp.msn5.Ts[top.Ts.up.msn5$ID], pch = 20, col= "red3")
abline(h = 1.95, col="darkolivegreen4", lty=2)
abline(v = 0.6, col="darkolivegreen4", lty=2)
abline(v = -0.6, col="darkolivegreen4", lty=2);dev.off()
325
References
Abelson, J., Trotta, C.R., and Li, H. (1998). tRNA Splicing. Journal of Biological
Chemistry 273, 12685-12688.
Aitchison, J.D., and Rout, M.P. (2012). The Yeast Nuclear Pore Complex and Transport
Through It. Genetics 190, 855-883.
Alexandrov, A., Chernyakov, I., Gu, W., Hiley, S.L., Hughes, T.R., Grayhack, E.J., and
Phizicky, E.M. (2006). Rapid tRNA decay can result from lack of nonessential
modifications. Mol Cell 21, 87-96.
Andrew, E. (1998). MEC1-Dependent Phosphorylation of Rad9p in Response to DNA
Damage. Molecular Cell 2, 183-189.
Arava, Y., Wang, Y., Storey, J.D., Liu, C.L., Brown, P.O., and Herschlag, D. (2003).
Genome-wide analysis of mRNA translation profiles in Saccharomyces cerevisiae. Proc
Natl Acad Sci U S A 100, 3889-3894.
Arts, G.J., Fornerod, M., and Mattaj, I.W. (1998a). Identification of a nuclear export
receptor for tRNA. Curr Biol 8, 305-314.
Arts, G.J., Kuersten, S., Romby, P., Ehresmann, B., and Mattaj, I.W. (1998b). The role of
exportin-t in selective nuclear export of mature tRNAs. EMBO J 17, 7430-7441.
Ashe, M.P., De Long, S.K., and Sachs, A.B. (2000). Glucose depletion rapidly inhibits
translation initiation in yeast. Mol Biol Cell 11, 833-848.
Bakhrat, A., Baranes-Bachar, K., Reshef, D., Voloshin, O., Krichevsky, O., and Raveh,
D. (2008). Nuclear export of Ho endonuclease of yeast via Msn5. Curr Genet 54, 271281.
Barhoom, S., Kaur, J., Cooperman, B.S., Smorodinsky, N.I., Smilansky, Z., Ehrlich, M.,
and Elroy-Stein, O. (2011). Quantitative single cell monitoring of protein synthesis at
subcellular resolution using fluorescently labeled tRNA. Nucleic Acids Res 39, e129.
326
Baroni, M., Livian, S., Martegani, E., and Alberghina, L. (1986). Molecular cloning and
regulation of the expression of the MET2 gene of Saccharomyces cerevisiae. Gene 46,
71-78.
Begley, U., Dyavaiah, M., Patil, A., Rooney, J.P., DiRenzo, D., Young, C.M., Conklin,
D.S., Zitomer, R.S., and Begley, T.J. (2007). Trm9-catalyzed tRNA modifications link
translation to the DNA damage response. Molecular Cell 28, 860-870.
Blais, J.D., Filipenko, V., Bi, M., Harding, H.P., Ron, D., Koumenis, C., Wouters, B.G.,
and Bell, J.C. (2004). Activating Transcription Factor 4 Is Translationally Regulated by
Hypoxic Stress. Molecular and Cellular Biology 24, 7469-7482.
Blondel, M., Alepuz, P.M., Huang, L.S., Shaham, S., Ammerer, G., and Peter, M. (1999).
Nuclear export of Far1p in response to pheromones requires the export receptor
Msn5p/Ste21p. Genes Dev 13, 2284-2300.
Bohnsack, M.T., Czaplinski, K., and Gorlich, D. (2004). Exportin 5 is a RanGTPdependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA 10,
185-191.
Bollman, K.M., Aukerman, M.J., Park, M.Y., Hunter, C., Berardini, T.Z., and Poethig,
R.S. (2003). HASTY, the Arabidopsis ortholog of exportin 5/MSN5, regulates phase
change and morphogenesis. Development 130, 1493-1504.
Bolstad, B.M., Irizarry, R.A., Astrand, M., and Speed, T.P. (2003). A comparison of
normalization methods for high density oligonucleotide array data based on variance and
bias. Bioinformatics 19, 185-193.
Cantara, W.A., Crain, P.F., Rozenski, J., McCloskey, J.A., Harris, K.A., Zhang, X.,
Vendeix, F.A., Fabris, D., and Agris, P.F. (2011). The RNA Modification Database,
RNAMDB: 2011 update. Nucleic Acids Res 39, D195-201.
Castelli, L.M., Lui, J., Campbell, S.G., Rowe, W., Zeef, L.A., Holmes, L.E., Hoyle, N.P.,
Bone, J., Selley, J.N., Sims, P.F., et al. (2011). Glucose depletion inhibits translation
initiation via eIF4A loss and subsequent 48S preinitiation complex accumulation, while
the pentose phosphate pathway is coordinately up-regulated. Mol Biol Cell 22, 33793393.
Chen, D.-C., Yang, B.-C., and Kuo, T.-T. (1992a). One-step transformation of yeast in
stationary phase. Current Genetics 21, 83-84.
Chen, J.Y., Joyce, P.B., Wolfe, C.L., Steffen, M.C., and Martin, N.C. (1992b).
Cytoplasmic and mitochondrial tRNA nucleotidyltransferase activities are derived from
the same gene in the yeast Saccharomyces cerevisiae. Journal of Biological Chemistry
267, 14879-14883.
327
Cherest, H., Surdin-Kerjan, Y., Antoniewski, J., and De Robichon-Szulmajster, H.
(1973). S-Adenosyl Methionine-Mediated Repression of Methionine Biosynthetic
Enzymes in Saccharomyces cerevisiae. Journal of Bacteriology 114, 928-933.
Chernyakov, I., Whipple, J.M., Kotelawala, L., Grayhack, E.J., and Phizicky, E.M.
(2008). Degradation of several hypomodified mature tRNA species in Saccharomyces
cerevisiae is mediated by Met22 and the 5'-3' exonucleases Rat1 and Xrn1. Genes Dev
22, 1369-1380.
Chook, Y.M., and Süel, K.E. (2011). Nuclear import by karyopherin-βs: Recognition and
inhibition. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1813, 15931606.
Ciesla, M., and Boguta, M. (2008). Regulation of RNA polymerase III transcription by
Maf1 protein. Acta Biochim Pol 55, 215-225.
Coller, J., and Parker, R. (2005). General translational repression by activators of mRNA
decapping. Cell 122, 875-886.
Cook, A.G., Fukuhara, N., Jinek, M., and Conti, E. (2009). Structures of the tRNA export
factor in the nuclear and cytosolic states. Nature 461, 60-65.
Dahlberg, J., and Lund, E. (2012). Nuclear translation or nuclear peptidyl transferase?
Nucleus 3.
David, A., Dolan, B.P., Hickman, H.D., Knowlton, J.J., Clavarino, G., Pierre, P.,
Bennink, J.R., and Yewdell, J.W. (2012). Nuclear translation visualized by ribosomebound nascent chain puromycylation. The Journal of Cell Biology 197, 45-57.
Day, D.A., and Tuite, M.F. (1998). Post-transcriptional gene regulatory mechanisms in
eukaryotes: an overview. J Endocrinol 157, 361-371.
DeVit, M.J., and Johnston, M. (1999). The nuclear exportin Msn5 is required for nuclear
export of the Mig1 glucose repressor of Saccharomyces cerevisiae. Curr Biol 9, 12311241.
Dhungel, N., and Hopper, A.K. (2012). Beyond tRNA cleavage: novel essential function
for yeast tRNA splicing endonuclease unrelated to tRNA processing. Genes &
Development 26, 503-514.
Dichtl, B., Stevens, A., and Tollervey, D. (1997). Lithium toxicity in yeast is due to the
inhibition of RNA processing enzymes. EMBO J 16, 7184-7195.
Dieci, G., Fiorino, G., Castelnuovo, M., Teichmann, M., and Pagano, A. (2007). The
expanding RNA polymerase III transcriptome. Trends Genet 23, 614-622.
328
Esakova, O., and Krasilnikov, A.S. (2010). Of proteins and RNA: The RNase P/MRP
family. RNA 16, 1725-1747.
Feng, W., and Hopper, A.K. (2002). A Los1p-independent pathway for nuclear export of
intronless tRNAs in Saccharomycescerevisiae. Proc Natl Acad Sci U S A 99, 5412-5417.
Ferrezuelo, F., Steiner, B., Aldea, M., and Futcher, B. (2002). Biogenesis of yeast
telomerase depends on the importin mtr10. Mol Cell Biol 22, 6046-6055.
Fodor, S.P., Read, J.L., Pirrung, M.C., Stryer, L., Lu, A.T., and Solas, D. (1991). Lightdirected, spatially addressable parallel chemical synthesis. Science 251, 767-773.
Forlani, N., Martegani, E., and Alberghina, L. (1991). Posttranscriptional regulation of
the expression of MET2 gene of Saccharomyces cerevisiae. Biochim Biophys Acta 1089,
47-53.
Gallardo, F., Olivier, C., Dandjinou, A.T., Wellinger, R.J., and Chartrand, P. (2008).
TLC1 RNA nucleo-cytoplasmic trafficking links telomerase biogenesis to its recruitment
to telomeres. EMBO J 27, 748-757.
Gasch, A.P., Spellman, P.T., Kao, C.M., Carmel-Harel, O., Eisen, M.B., Storz, G.,
Botstein, D., and Brown, P.O. (2000). Genomic expression programs in the response of
yeast cells to environmental changes. Mol Biol Cell 11, 4241-4257.
Gasch, A.P., and Werner-Washburne, M. (2002). The genomics of yeast responses to
environmental stress and starvation. Funct Integr Genomics 2, 181-192.
Gentleman, R.C., Carey, V.J., Bates, D.M., Bolstad, B., Dettling, M., Dudoit, S., Ellis,
B., Gautier, L., Ge, Y., Gentry, J., et al. (2004). Bioconductor: open software
development for computational biology and bioinformatics. Genome Biol 5, R80.
Ghavidel, A., Kislinger, T., Pogoutse, O., Sopko, R., Jurisica, I., and Emili, A. (2007).
Impaired tRNA nuclear export links DNA damage and cell-cycle checkpoint. Cell 131,
915-926.
Goldstein, A.L., and McCusker, J.H. (1999). Three new dominant drug resistance
cassettes for gene disruption in Saccharomyces cerevisiae. Yeast 15, 1541-1553.
Greenbaum, D., Jansen, R., and Gerstein, M. (2002). Analysis of mRNA expression and
protein abundance data: an approach for the comparison of the enrichment of features in
the cellular population of proteins and transcripts. Bioinformatics 18, 585-596.
Gueldener, U., Heinisch, J., Koehler, Voss, D., and Hegemann (2002). A second set of
<em>loxP</EM> markercassettes for Cre-mediated multiple gene knockouts in budding
yeast. Nucleic Acids Research 30, e23-e23.
329
Gustavsson, M., and Ronne, H. (2008). Evidence that tRNA modifying enzymes are
important in vivo targets for 5-fluorouracil in yeast. RNA 14, 666-674.
Gustilo, E.M., Vendeix, F.A., and Agris, P.F. (2008). tRNA's modifications bring order
to gene expression. Curr Opin Microbiol 11, 134-140.
Gwizdek, C., Ossareh-Nazari, B., Brownawell, A.M., Doglio, A., Bertrand, E., Macara,
I.G., and Dargemont, C. (2003). Exportin-5 mediates nuclear export of minihelixcontaining RNAs. J Biol Chem 278, 5505-5508.
Hackmann, A., Gross, T., Baierlein, C., and Krebber, H. (2011). The mRNA export
factor Npl3 mediates the nuclear export of large ribosomal subunits. EMBO Rep 12,
1024-1031.
Hani, J., and Feldmann, H. (1998). tRNA genes and retroelements in the yeast genome.
Nucleic Acids Research 26, 689-696.
Hinnebusch, A.G. (1988). Mechanisms of gene regulation in the general control of amino
acid biosynthesis in Saccharomyces cerevisiae. Microbiol Rev 52, 248-273.
Hinnebusch, A.G. (1997). Translational regulation of yeast GCN4. A window on factors
that control initiator-trna binding to the ribosome. J Biol Chem 272, 21661-21664.
Hinnebusch, A.G. (2005). TRANSLATIONAL REGULATION OF GCN4 AND THE
GENERAL AMINO ACID CONTROL OF YEAST*. Annual Review of Microbiology
59, 407-450.
Holmes, L.E., Campbell, S.G., De Long, S.K., Sachs, A.B., and Ashe, M.P. (2004). Loss
of translational control in yeast compromised for the major mRNA decay pathway. Mol
Cell Biol 24, 2998-3010.
Hopper, A.K. (2006). Cellular dynamics of small RNAs. Crit Rev Biochem Mol Biol 41,
3-19.
Hopper, A.K., Pai, D.A., and Engelke, D.R. (2010). Cellular dynamics of tRNAs and
their genes. FEBS Lett 584, 310-317.
Hopper, A.K., and Phizicky, E.M. (2003). tRNA transfers to the limelight. Genes Dev 17,
162-180.
Hopper, A.K., and Shaheen, H.H. (2008). A decade of surprises for tRNA nuclearcytoplasmic dynamics. Trends Cell Biol 18, 98-104.
Hurt, D.J., Wang, S.S., Lin, Y.H., and Hopper, A.K. (1987). Cloning and characterization
of LOS1, a Saccharomyces cerevisiae gene that affects tRNA splicing. Mol Cell Biol 7,
1208-1216.
330
Hurto, R.L., and Hopper, A.K. (2011). P-body components, Dhh1 and Pat1, are involved
in tRNA nuclear-cytoplasmic dynamics. RNA 17, 912-924.
Hurto, R.L., Tong, A.H., Boone, C., and Hopper, A.K. (2007). Inorganic phosphate
deprivation causes tRNA nuclear accumulation via retrograde transport in
Saccharomyces cerevisiae. Genetics 176, 841-852.
Irizarry, R.A., Bolstad, B.M., Collin, F., Cope, L.M., Hobbs, B., and Speed, T.P. (2003).
Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res 31, e15.
Jones, G.M., Stalker, J., Humphray, S., West, A., Cox, T., Rogers, J., Dunham, I., and
Prelich, G. (2008). A systematic library for comprehensive overexpression screens in
Saccharomyces cerevisiae. Nat Methods 5, 239-241.
Kadaba, S., Krueger, A., Trice, T., Krecic, A.M., Hinnebusch, A.G., and Anderson, J.
(2004). Nuclear surveillance and degradation of hypomodified initiator tRNAMet in S.
cerevisiae. Genes Dev 18, 1227-1240.
Kadaba, S., Wang, X., and Anderson, J.T. (2006). Nuclear RNA surveillance in
Saccharomyces cerevisiae: Trf4p-dependent polyadenylation of nascent hypomethylated
tRNA and an aberrant form of 5S rRNA. RNA 12, 508-521.
Kadowaki, T., Chen, S., Hitomi, M., Jacobs, E., Kumagai, C., Liang, S., Schneiter, R.,
Singleton, D., Wisniewska, J., and Tartakoff, A.M. (1994). Isolation and characterization
of Saccharomyces cerevisiae mRNA transport-defective (mtr) mutants. J Cell Biol 126,
649-659.
Kaffman, A., Rank, N.M., O'Neill, E.M., Huang, L.S., and O'Shea, E.K. (1998). The
receptor Msn5 exports the phosphorylated transcription factor Pho4 out of the nucleus.
Nature 396, 482-486.
Kalhor, H.R., Penjwini, M., and Clarke, S. (2005). A novel methyltransferase required for
the formation of the hypermodified nucleoside wybutosine in eucaryotic tRNA. Biochem
Biophys Res Commun 334, 433-440.
Kim, J.H., Brachet, V., Moriya, H., and Johnston, M. (2006). Integration of
transcriptional and posttranslational regulation in a glucose signal transduction pathway
in Saccharomyces cerevisiae. Eukaryot Cell 5, 167-173.
Kim, T., Yoon, J., Cho, H., Lee, W.B., Kim, J., Song, Y.H., Kim, S.N., Yoon, J.H., KimHa, J., and Kim, Y.J. (2005). Downregulation of lipopolysaccharide response in
Drosophila by negative crosstalk between the AP1 and NF-kappaB signaling modules.
Nat Immunol 6, 211-218.
331
Kornitzer, D., Raboy, B., Kulka, R.G., and Fink, G.R. (1994). Regulated degradation of
the transcription factor Gcn4. EMBO J 13, 6021-6030.
Kuersten, S., Ohno, M., and Mattaj, I.W. (2001). Nucleocytoplasmic transport: Ran, beta
and beyond. Trends Cell Biol 11, 497-503.
Kuhn, K.M., DeRisi, J.L., Brown, P.O., and Sarnow, P. (2001). Global and specific
translational regulation in the genomic response of Saccharomyces cerevisiae to a rapid
transfer from a fermentable to a nonfermentable carbon source. Mol Cell Biol 21, 916927.
Kutay, U., Lipowsky, G., Izaurralde, E., Bischoff, F.R., Schwarzmaier, P., Hartmann, E.,
and Gorlich, D. (1998). Identification of a tRNA-specific nuclear export receptor. Mol
Cell 1, 359-369.
LaCava, J., Houseley, J., Saveanu, C., Petfalski, E., Thompson, E., Jacquier, A., and
Tollervey, D. (2005). RNA degradation by the exosome is promoted by a nuclear
polyadenylation complex. Cell 121, 713-724.
Lawless, C., Pearson, R.D., Selley, J.N., Smirnova, J.B., Grant, C.M., Ashe, M.P., Pavitt,
G.D., and Hubbard, S.J. (2009). Upstream sequence elements direct post-transcriptional
regulation of gene expression under stress conditions in yeast. BMC Genomics 10, 7.
Lee, M.S., Henry, M., and Silver, P.A. (1996). A protein that shuttles between the
nucleus and the cytoplasm is an important mediator of RNA export. Genes &
Development 10, 1233-1246.
Letzring, D.P., Dean, K.M., and Grayhack, E.J. (2010). Control of translation efficiency
in yeast by codon–anticodon interactions. RNA 16, 2516-2528.
Lipowsky, G., Bischoff, F.R., Izaurralde, E., Kutay, U., Schafer, S., Gross, H.J., Beier,
H., and Gorlich, D. (1999). Coordination of tRNA nuclear export with processing of
tRNA. RNA 5, 539-549.
Longtine, M.S., McKenzie, A., 3rd, Demarini, D.J., Shah, N.G., Wach, A., Brachat, A.,
Philippsen, P., and Pringle, J.R. (1998). Additional modules for versatile and economical
PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, 953961.
Lund, E., and Dahlberg, J.E. (1998). Proofreading and aminoacylation of tRNAs before
export from the nucleus. Science 282, 2082-2085.
Lund, E., Guttinger, S., Calado, A., Dahlberg, J.E., and Kutay, U. (2004). Nuclear export
of microRNA precursors. Science 303, 95-98.
332
Lundin, C., North, M., Erixon, K., Walters, K., Jenssen, D., Goldman, A.S.H., and
Helleday, T. (2005). Methyl methanesulfonate (MMS) produces heat-labile DNA damage
but no detectable in vivo DNA double-strand breaks. Nucleic Acids Research 33, 37993811.
McCarthy, J.E.G. (1998). Posttranscriptional Control of Gene Expression in Yeast.
Microbiology and Molecular Biology Reviews 62, 1492-1553.
Mori, S., Kajita, T., Endo, T., and Yoshihisa, T. (2011). The intron of tRNA-TrpCCA is
dispensable for growth and translation of Saccharomyces cerevisiae. RNA 17, 17601769.
Murthi, A., Shaheen, H.H., Huang, H.Y., Preston, M.A., Lai, T.P., Phizicky, E.M., and
Hopper, A.K. (2010). Regulation of tRNA bidirectional nuclear-cytoplasmic trafficking
in Saccharomyces cerevisiae. Mol Biol Cell 21, 639-649.
Nakanishi, K., and Nureki, O. (2005). Recent progress of structural biology of tRNA
processing and modification. Mol Cells 19, 157-166.
Nakielny, S., and Dreyfuss, G. (1999). Transport of proteins and RNAs in and out of the
nucleus. Cell 99, 677-690.
Natarajan, K., Meyer, M.R., Jackson, B.M., Slade, D., Roberts, C., Hinnebusch, A.G.,
and Marton, M.J. (2001). Transcriptional profiling shows that Gcn4p is a master regulator
of gene expression during amino acid starvation in yeast. Mol Cell Biol 21, 4347-4368.
Noma, A., Kirino, Y., Ikeuchi, Y., and Suzuki, T. (2006). Biosynthesis of wybutosine, a
hyper-modified nucleoside in eukaryotic phenylalanine tRNA. EMBO J 25, 2142-2154.
Ogawa, N., DeRisi, J., and Brown, P.O. (2000). New components of a system for
phosphate accumulation and polyphosphate metabolism in Saccharomyces cerevisiae
revealed by genomic expression analysis. Mol Biol Cell 11, 4309-4321.
Ohira, T., and Suzuki, T. (2011). Retrograde nuclear import of tRNA precursors is
required for modified base biogenesis in yeast. Proc Natl Acad Sci U S A 108, 1050210507.
Paushkin, S.V., Patel, M., Furia, B.S., Peltz, S.W., and Trotta, C.R. (2004). Identification
of a human endonuclease complex reveals a link between tRNA splicing and pre-mRNA
3' end formation. Cell 117, 311-321.
Pemberton, L.F., Rosenblum, J.S., and Blobel, G. (1997). A distinct and parallel pathway
for the nuclear import of an mRNA-binding protein. J Cell Biol 139, 1645-1653.
Phizicky, E.M., and Hopper, A.K. (2010). tRNA biology charges to the front. Genes Dev
24, 1832-1860.
333
Qiu, H., Hu, C., Anderson, J., Bjork, G.R., Sarkar, S., Hopper, A.K., and Hinnebusch,
A.G. (2000). Defects in tRNA processing and nuclear export induce GCN4 translation
independently of phosphorylation of the alpha subunit of eukaryotic translation initiation
factor 2. Mol Cell Biol 20, 2505-2516.
R development Core Team (2011). R: A language and environment for statistical
computing.
Reich, M., Liefeld, T., Gould, J., Lerner, J., Tamayo, P., and Mesirov, J.P. (2006).
GenePattern 2.0. Nat Genet 38, 500-501.
Reid, D.W., and Nicchitta, C.V. (2012). The enduring enigma of nuclear translation. The
Journal of Cell Biology 197, 7-9.
Rhee, S.Y., Wood, V., Dolinski, K., and Draghici, S. (2008). Use and misuse of the gene
ontology annotations. Nat Rev Genet 9, 509-515.
Ribbeck, K., Lipowsky, G., Kent, H.M., Stewart, M., and Gorlich, D. (1998). NTF2
mediates nuclear import of Ran. EMBO J 17, 6587-6598.
Rodriguez, M.S., Dargemont, C., and Stutz, F. (2004). Nuclear export of RNA. Biol Cell
96, 639-655.
Rouse, J., and Jackson, S.P. (2000). LCD1: an essential gene involved in checkpoint
control and regulation of the MEC1 signalling pathway in Saccharomyces cerevisiae.
EMBO J 19, 5801-5812.
Ruepp, A., Zollner, A., Maier, D., Albermann, K., Hani, J., Mokrejs, M., Tetko, I.,
Guldener, U., Mannhaupt, G., Munsterkotter, M., et al. (2004). The FunCat, a functional
annotation scheme for systematic classification of proteins from whole genomes. Nucleic
Acids Res 32, 5539-5545.
Santangelo, G.M. (2006). Glucose signaling in Saccharomyces cerevisiae. Microbiol Mol
Biol Rev 70, 253-282.
Sarkar, S., Azad, A.K., and Hopper, A.K. (1999). Nuclear tRNA aminoacylation and its
role in nuclear export of endogenous tRNAs in Saccharomyces cerevisiae. Proc Natl
Acad Sci U S A 96, 14366-14371.
Sarkar, S., and Hopper, A.K. (1998). tRNA nuclear export in saccharomyces cerevisiae:
in situ hybridization analysis. Mol Biol Cell 9, 3041-3055.
Schena, M., Shalon, D., Davis, R.W., and Brown, P.O. (1995). Quantitative monitoring
of gene expression patterns with a complementary DNA microarray. Science 270, 467470.
334
Seiple, L., Jaruga, P., Dizdaroglu, M., and Stivers, J.T. (2006). Linking uracil base
excision repair and 5-fluorouracil toxicity in yeast. Nucleic Acids Research 34, 140-151.
Senger, B., Simos, G., Bischoff, F.R., Podtelejnikov, A., Mann, M., and Hurt, E. (1998).
Mtr10p functions as a nuclear import receptor for the mRNA-binding protein Npl3p.
EMBO J 17, 2196-2207.
Shaheen, H.H., and Hopper, A.K. (2005). Retrograde movement of tRNAs from the
cytoplasm to the nucleus in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 102,
11290-11295.
Shaheen, H.H., Horetsky, R.L., Kimball, S.R., Murthi, A., Jefferson, L.S., and Hopper,
A.K. (2007). Retrograde nuclear accumulation of cytoplasmic tRNA in rat hepatoma cells
in response to amino acid deprivation. Proc Natl Acad Sci U S A 104, 8845-8850.
Shemer, R., Meimoun, A., Holtzman, T., and Kornitzer, D. (2002). Regulation of the
Transcription Factor Gcn4 by Pho85 Cyclin Pcl5. Molecular and Cellular Biology 22,
5395-5404.
Shenton, D., Smirnova, J.B., Selley, J.N., Carroll, K., Hubbard, S.J., Pavitt, G.D., Ashe,
M.P., and Grant, C.M. (2006). Global translational responses to oxidative stress impact
upon multiple levels of protein synthesis. J Biol Chem 281, 29011-29021.
Sherlock, G. (2000). Analysis of large-scale gene expression data. Curr Opin Immunol
12, 201-205.
Shimada, Y., Gulli, M.P., and Peter, M. (2000). Nuclear sequestration of the exchange
factor Cdc24 by Far1 regulates cell polarity during yeast mating. Nat Cell Biol 2, 117124.
Smirnova, J.B., Selley, J.N., Sanchez-Cabo, F., Carroll, K., Eddy, A.A., McCarthy, J.E.,
Hubbard, S.J., Pavitt, G.D., Grant, C.M., and Ashe, M.P. (2005). Global gene expression
profiling reveals widespread yet distinctive translational responses to different eukaryotic
translation initiation factor 2B-targeting stress pathways. Mol Cell Biol 25, 9340-9349.
Smyth, G.K. (2004). Linear models and empirical bayes methods for assessing
differential expression in microarray experiments. Stat Appl Genet Mol Biol 3, Article3.
Springer, M., Wykoff, D.D., Miller, N., and O'Shea, E.K. (2003). Partially
phosphorylated Pho4 activates transcription of a subset of phosphate-responsive genes.
PLoS Biol 1, E28.
Stage-Zimmermann, T., Schmidt, U., and Silver, P.A. (2000). Factors affecting nuclear
export of the 60S ribosomal subunit in vivo. Mol Biol Cell 11, 3777-3789.
335
Starck, S.R., Jiang, V., Pavon-Eternod, M., Prasad, S., McCarthy, B., Pan, T., and
Shastri, N. (2012). Leucine-tRNA Initiates at CUG Start Codons for Protein Synthesis
and Presentation by MHC Class I. Science 336, 1719-1723.
Stewart, M. (2003). Structural biology. Nuclear trafficking. Science 302, 1513-1514.
Takano, A., Endo, T., and Yoshihisa, T. (2005). tRNA actively shuttles between the
nucleus and cytosol in yeast. Science 309, 140-142.
Teixeira, M.T., Forstemann, K., Gasser, S.M., and Lingner, J. (2002). Intracellular
trafficking of yeast telomerase components. EMBO Rep 3, 652-659.
Thomas-Chollier, M., Defrance, M., Medina-Rivera, A., Sand, O., Herrmann, C.,
Thieffry, D., and van Helden, J. (2011). RSAT 2011: regulatory sequence analysis tools.
Nucleic Acids Research 39, W86-W91.
Thomas-Chollier, M., Sand, O., Turatsinze, J.V., Janky, R., Defrance, M., Vervisch, E.,
Brohee, S., and van Helden, J. (2008). RSAT: regulatory sequence analysis tools. Nucleic
Acids Res 36, W119-127.
Thomas, D., and Surdin-Kerjan, Y. (1997). Metabolism of sulfur amino acids in
Saccharomyces cerevisiae. Microbiol Mol Biol Rev 61, 503-532.
Thompson, D.M., and Parker, R. (2009). Stressing out over tRNA cleavage. Cell 138,
215-219.
Thompson, M., Haeusler, R.A., Good, P.D., and Engelke, D.R. (2003). Nucleolar
Clustering of Dispersed tRNA Genes. Science 302, 1399-1401.
Tuller, T., Kupiec, M., and Ruppin, E. (2007). Determinants of protein abundance and
translation efficiency in S. cerevisiae. PLoS Comput Biol 3, e248.
Tuller, T., Ruppin, E., and Kupiec, M. (2009). Properties of untranslated regions of the S.
cerevisiae genome. BMC Genomics 10, 391.
Tusher, V.G., Tibshirani, R., and Chu, G. (2001). Significance analysis of microarrays
applied to the ionizing radiation response. Proc Natl Acad Sci U S A 98, 5116-5121.
van Helden, J. (2003). Regulatory Sequence Analysis Tools. Nucleic Acids Research 31,
3593-3596.
Vanacova, S., Wolf, J., Martin, G., Blank, D., Dettwiler, S., Friedlein, A., Langen, H.,
Keith, G., and Keller, W. (2005). A new yeast poly(A) polymerase complex involved in
RNA quality control. PLoS Biol 3, e189.
336
Vyas, K., Chaudhuri, S., Leaman, D.W., Komar, A.A., Musiyenko, A., Barik, S., and
Mazumder, B. (2009). Genome-wide polysome profiling reveals an inflammationresponsive posttranscriptional operon in gamma interferon-activated monocytes. Mol
Cell Biol 29, 458-470.
Walker, S.C., and Engelke, D.R. (2006). Ribonuclease P: the evolution of an ancient
RNA enzyme. Crit Rev Biochem Mol Biol 41, 77-102.
Whitney, M.L., Hurto, R.L., Shaheen, H.H., and Hopper, A.K. (2007). Rapid and
reversible nuclear accumulation of cytoplasmic tRNA in response to nutrient availability.
Mol Biol Cell 18, 2678-2686.
Willis, I.M., and Moir, R.D. (2007). Integration of nutritional and stress signaling
pathways by Maf1. Trends Biochem Sci 32, 51-53.
Wilson, W.A., and Roach, P.J. (2002). Nutrient-regulated protein kinases in budding
yeast. Cell 111, 155-158.
Windgassen, M., Sturm, D., Cajigas, I.J., Gonzalez, C.I., Seedorf, M., Bastians, H., and
Krebber, H. (2004). Yeast shuttling SR proteins Npl3p, Gbp2p, and Hrb1p are part of the
translating mRNPs, and Npl3p can function as a translational repressor. Mol Cell Biol 24,
10479-10491.
Winzeler, E.A., Lee, B., McCusker, J.H., and Davis, R.W. (1999). Whole genome
genetic-typing in yeast using high-density oligonucleotide arrays. Parasitology 118, 7380.
Wolfe, C.L., Lou, Y.C., Hopper, A.K., and Martin, N.C. (1994). Interplay of
heterogeneous transcriptional start sites and translational selection of AUGs dictate the
production of mitochondrial and cytosolic/nuclear tRNA nucleotidyltransferase from the
same gene in yeast. Journal of Biological Chemistry 269, 13361-13366.
Yi, R., Qin, Y., Macara, I.G., and Cullen, B.R. (2003). Exportin-5 mediates the nuclear
export of pre-microRNAs and short hairpin RNAs. Genes Dev 17, 3011-3016.
Yoshihisa, T., Yunoki-Esaki, K., Ohshima, C., Tanaka, N., and Endo, T. (2003).
Possibility of cytoplasmic pre-tRNA splicing: the yeast tRNA splicing endonuclease
mainly localizes on the mitochondria. Mol Biol Cell 14, 3266-3279.
Zaitseva, L., Myers, R., and Fassati, A. (2006). tRNAs promote nuclear import of HIV-1
intracellular reverse transcription complexes. PLoS Biol 4, e332.
337