Download Worksheet 2

Bronze Locus Bioinformatics Instructions and Worksheet
Save this document to your desktop and complete it on your computer!
Complete this worksheet in MS Word on your computer. If you have it in print, open it at
http://www.dnai.org/media/bioinformatics/ccli/bzincorn/bzgene_ws.doc. If you opened this
document in an Internet browser click File, click Save as, and save it to a directory on your C- or
A-drives. Then, close the browser, open the document in MS Word, and follow the instructions
to answer the questions. In doing so, you will discover what causes the color mutations in maize.
Along the way you will become familiar with bioinformatics routines such as locating and
extracting information and sequences about/for genes, genomes, and proteins from databases.
Find the bronze gene by electronic PCR











Save this worksheet to your computer.
Go to http://www.ncbi.nlm.nih.gov.
Click BLAST.
Click blastn.
Paste both primers (cgaatggctgttgcatttccat acgggacgcagttgggcagga) into the Search
window.
Change All organisms to Zea mays.
Click Blast.
Record the Request-id: ____________________________________________
Click Format.
The E Value is the most meaningful indicator for the quality of a hit; the lower the E
Value, the better the hit. Usually, E Values of less than 0.1 indicate meaningful hits. (For
further explanations click the link to Blast FAQ in the upper part of the NCBI Blast result
page.)
Click on the score to view an alignment of the primers with the search hit sequence
(Subject). Each primer aligns with a different region of the hit. The alignment coordinates
in the hit are:
Primer 1
Primer 2








Matches from hit sequence position no.
__________________
__________________
to hit sequence position no.
__________________
__________________
The lowest position no. of these four numbers is:
__________________
The highest position no. of these four numbers is:
__________________
These two positions stretch a region of how many nucleotides? (If you use subtraction
remember to add 1 to arrive at the correct nucleotide number.)
__________________
Record the gi-number for this entry:
__________________
Click the gi-link.
Find the region that contains the matches. What gene is located there? _______________
Scroll down to the nucleotide sequence.
Extract (highlight and copy) the sequence from the lowest to the highest position no.
1

Paste the sequence into the box below; it represents the amplicon that would be amplified
in a PCR reaction using the two primers on corn DNA.
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
_______________________________________________________
Measure the length of the amplicon



Open http://www.dnai.org/geneboy, click Your Sequence.
Paste the sequence into the center window. Click Save.
How long is the sequence? ___________ Does this number match the length of the
amplicon determined above?
Determine the location of the amplicon within the bronze gene





Go to the GenBank entry above.
How long is the coding region of the bz gene? ___________ bp
How many exons and introns does the bz gene consist of? ___ exons, ____ introns.
Where exactly in the bz gene is the start codon located? Position of the A: ___________
Given your data above, where in relation to the bz gene is the amplicon located?
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
Determine the location of the bronze gene in the corn genome













Go to http://www.ncbi.nlm.nih.gov/.
Click Map Viewer.
Click Zea mays.
How many chromosomes does corn have? ____ chromosomes
Perform a BLAST search on a plant genome using the amplicon sequence above.
Record the Request-id: ____________________________________________
Click Format.
What chromosome is the amplicon located on? ____
Click on the number underneath the tagged chromosome.
Zoom all the way out.
How long is the chromosome? _____ Mbp (Mega bp) or _______________ cM
Where about on the chromosome is the bronze locus located? _______________
Zoom step-wise into the chromosome; what genes can you identify on this chromosome?
(If you cannot see any gene names you may have to open Maps & Options, include gene
in the right-hand panel, and/or set gene to master.) What genes are adjacent to bronze?
Find out more about these genes and write a couple of lines about each.
2
1) _________________________________________________________________
________________________________________________________________
2) _________________________________________________________________
________________________________________________________________
3) _________________________________________________________________
________________________________________________________________
4) _________________________________________________________________
________________________________________________________________
5) _________________________________________________________________
________________________________________________________________
Find the bz mutant through electronic PCR








Go to http://www.ncbi.nlm.nih.gov.
Click BLAST.
Click blastn
Paste both primers (cgaatggctgttgcatttccat tctaccgtttccgtttccgttt) into the window.
Click Blast.
Record the Request-id: ____________________________________________
Click Format.
Click on the score for the hit containing Ac to view an alignment of the primers with the
search hit sequence (Subject). The alignment coordinates in the hit are:
Primer 1
Primer 2







Matches from hit sequence position no.
__________________
__________________
to hit sequence position no.
__________________
__________________
The lowest position no. of these four numbers is: __________________
The highest position no. of these four numbers is: __________________
These two numbers stretch a region of how many nucleotides? __________________
Record the gi-number for this entry: _______________________________________
What is the name of the gene at this location? ________________________________
Is there any other search hit which maps to both primers? What is the name of the gene at
that location? ______________________________________________________
Click the gi-link for the hit containing Ac and identify what sequence the reverse primer
matched. ________________________________________________________________
Determine the nature of the mutation and its position in the mutant gene.

To determine the nature of the mutation align the wt gene with the mutated gene.
o Go to BioServers at http://www.bioservers.org/.
o Enter SequenceServer.
o Click Manage Groups.
o Change Sequence Source: Classes to Public.
3




o Find Jumping Genes Across Kingdoms; check the check box to the left.
o Click OK.
o Change the first entry to corn, bronze endosperm, mutable mutant.
o Change None to corn, purple endosperm, wildtype.
o Click COMPARE.
o Where do the two sequences deviate? From: _____ to: _____
To map the Ac insertion site in the bronze gene determine where in bz::Ac the second set
primers maps:
o Change corn, purple endosperm, wildtype to fp_bz_599.
o Click COMPARE.
o Where do the two sequences align? From: _____ to: _____
o Change fp_bz_599 to rcrp_bzac_132r.
o Click COMPARE.
o Where do the two sequences align? From: _____ to: ______
o Change rcrp_bzac_132r to ac_element.
o Click COMPARE.
o Where do the two sequences align? From: _____ to: _____
So, how many bp after the first primer (bz-599) does the Ac insertion start? ___________
Thus, where in the bronze gene is the Ac insertion located? _______________________
Check your result against the data in the publication describing the analysis of three
bronze alleles in: Sequence of Three bronze Alleles of Maize and Correlation With the
Fine Genetic Structure. Ralston, E. J., English, J. J., Dooner, H. K. (1988). Genetics 119:
185-197.
Determine the function of the bronze gene product








Perform a BLAST search with the 271 bp amplicon in your worksheet (blastn;
Organism=Zea mays)
Record the gi number for the hit with the lowest E-Value: ____________________
Click the gi-hyperlink and scroll down to the entry for the bronze gene
What is the name of the protein? __________________________________________
Record and click the protein_id. __________________________________________
How many amino acids does the protein consist of? __________ amino acids
Click the SwissProt ID.
Find Comments and determine the function of the BZ protein. Record your findings here:
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
Determine the functional domains of the protein



Go to the NCBI homepage, change Entrez to Protein, enter the protein-id from above
into the search window, and click Go.
Click Domains.
Domains in the protein are highlighted as bars. What is the name of the domains in BZ?
4


________________________________________________________________________
Roughly, what are the coordinates for the domains? ______________________________
Move your cursor over the bars, what details about the domains are revealed?
________________________________________________________________________
________________________________________________________________________
View a 3D view of the protein



Go to the NCBI homepage, change Entrez to Protein, enter the protein-id from above
into the search window, and click Go.
Click Blink. In what other species have similar proteins been identified?
________________________________________________________________________
________________________________________________________________________
Click 3D structures. How many structures have been determined for this type of protein?
________________________________________________________________________
________________________________________________________________________
Determine whether the protein has Homologs in other organisms


Perform a BLAST search with the 271 bp amplicon in your worksheet (blastn;
Organism=Zea mays).
Click the gi-hyperlink and extract the amino acid sequence for the product of the bronze
gene.
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________



Use this amino acid sequence for a BLAST search (blastp).
Record the request ID here: ________________________________
Click Format. What organisms contain proteins with significant homology
(Positives>30%) to BZ? Name some proteins. Click their gi-numbers and determine the
function for some of these proteins. _________________________________________
_____________________________________________________________________
_____________________________________________________________________
5




_____________________________________________________________________
What do you know about colors in these species? About anthocyanin production?
Go back to the Blastp window (the one with the Format button).
Click the red bar indicating the conserved domain.
Click Domain Relatives. In what organisms were proteins with this domain identified?
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
_____________________________________________________________________
6