Download Antisense derivatives of U7 small nuclear RNA as

Antisense derivatives of U7 small nuclear RNA as
modulators of pre-mRNA splicing
Overview:
PCR-based production of splicing modulation tools in U7 SmOPT (protocol 1)
Subcloning strategy into transfer vector, e.g. pWPTS (protocol 2)
Outcome:
U7 snRNA tool to modulate splicing of a particular target gene by
transfection or vector-based transduction
Questions answered:
How can a specific splicing pattern be modulated?
What is the therapeutic outcome?
Antisense derivatives of U7 small nuclear RNA as
modulators of pre-mRNA splicing
Kathrin Meyer and Daniel Schümperli *
Institut für Zellbiologie, Universität Bern, Bern, Switzerland
*Address correspondence to: Daniel Schümperli, Institut für Zellbiologie, Universität Bern,
Baltzerstrasse 4, CH-3012 Bern, Switzerland,
Phone: +41-31-6314675, Fax +41-31-6314616, e-mail: [email protected]
1.
Abstract
Although it is possible to modulate splicing with antisense oligonucleotides, in
animals or patients, this approach is confronted with problems of efficient
delivery to the tissue of interest and requires repeated administrations of large
amounts of costly materials. In vivo expressed short splicing-modulating RNAs
represent an interesting alternative, be it for gene therapy, to understand the
nature of splicing mutations or for basic studies on alternative splicing.
Modified derivatives of the U7 small nuclear RNA (snRNA) involved in histone
RNA 3' end processing are particularly well suited for this kind of approach.
Two important features are the nuclear accumulation and high stability of the
RNA as part of a small nuclear ribonucleoprotein particle. In particular, U7
derivatives containing two tandem antisense sequences directed against
targets upstream and downstream of an exon can induce the efficient and
specific skipping of that exon. U7 snRNA derivatives can also be equipped with
an additional functional moiety, e.g. an exonic splicing enhancer sequence
capable of tethering a splicing activator protein of the SR family to the exon of
interest, in order to promote the inclusion of this exon in the mRNA. This
article will describe the constructions of such U7 derivatives starting from the
original U7 Sm OPT plasmid. U7 expression cassettes have been successfully
introduced into a great number of cell lines, primary cells or tissues with the
help of lentiviral and adeno-associated viral vectors, and we will also describe
a procedure used for subcloning into such viral delivery vectors.
Keywords: splicing modulation / in vivo expressed U7 snRNA derivatives / gene
therapy / PCR mutagenesis
2
2.
Theoretical background
2.1
What makes U7 snRNA a suitable in vivo splicing modulation tool?
To be effective, splicing-modulating antisense RNAs must accumulate in the nucleoplasm
where splicing occurs. This is why derivatives of U small nuclear RNAs (snRNAs), and in
particular of U7 snRNA, have been widely used for this purpose [1]. Apart from the
advantage that the antisense RNA accumulates as part of a stable small nuclear
ribonucleoprotein (snRNP), U7 snRNA expression cassettes, with their small size, will fit into
all types of gene therapy vectors so that they can be efficiently targeted to many different
tissues and cell types. Toxic side effects have not been observed, and the desired antisense
effect should only be exerted in those cells expressing the targeted pre-mRNA. Thus, in
contrast to gene replacement therapies, the target gene keeps its natural regulatory network
in terms of temporal and spatial expression.
The U7 snRNP is a ribonucleoprotein complex specialized in 3' end processing of
histone pre-mRNA (Fig. 1a) [2]. The first 18-20 nucleotides of the ~60 nucleotide-long U7
snRNA are complementary to a conserved histone downstream element located 3' of the
histone pre-mRNA cleavage site. The next 11 nucleotides constitute a binding site for Sm
and Sm-like proteins, which form a heptameric Sm core structure during the cytoplasmic
maturation phase of the snRNP. The RNA ends in a relatively stable hairpin. A trimethyl
guanosine cap structure at the 5' end and the Sm core are important signals for nuclear
accumulation and, together with the 3' hairpin, serve to stabilise the snRNP particle.
Importantly, the Sm binding sequence of U7 snRNA deviates from the consensus 5’(A/G)AUUU(G/U)UG(G/A)-3’ found in spliceosomal snRNAs. It associates with five Sm
proteins also found in spliceosomal snRNPs and two U7-specific Sm-like proteins, termed
Lsm10 and Lsm11, which are essential for histone RNA processing [3, 4]. However, if the
U7-specific Sm binding sequence is converted to the consensus found in spliceosomal
snRNAs, a new U7 Sm OPT construct is obtained which binds all seven Sm proteins found
in spliceosomal snRNAs (Fig. 1b). This particle can no longer induce the cleavage of the
histone pre-mRNAs, but can still bind to them by RNA:RNA base pairing, thus becoming a
competitive inhibitor for wild-type U7 snRNPs [2]. Another consequence is that the U7 Sm
OPT RNA accumulates as nuclear snRNP about three times more efficiently than its wildtype counterpart.
After having discovered these features, we thought U7 Sm OPT might be an ideal tool
for splicing modulation. As U7 Sm OPT could inhibit histone processing by an antisense
mechanism, it seemed likely that, by exchanging the natural sequence binding to histone
pre-mRNA with one directed against a new target, one could turn U7 Sm OPT into a
sequence-specific competitor for components of the splicing machinery or make it bind any
3
RNA molecule found in the nucleoplasm (Fig. 1b). Its efficient accumulation in the
nucleoplasm seemed to be another bonus for its action in splicing modulation.
These expectations concerning splicing modulation have been fully met in studies on
U7-mediated exon skipping in a variety of genes and disorders including thalassemic globin mutations [5-7], Duchenne Muscular Dystrophy [8-10] and HIV-1/AIDS [11, 12]. U7
tools have also been used to promote the inclusion of a poorly used exon in the case of
Spinal Muscular Atrophy [13-15] or to block intronic cryptic 5' splice sites (ss) activated by
mutation of the natural 5' ss [16].
2.2
Strategic considerations
To induce exon skipping, several types of sequences in and around the exon of interest
can be targeted. Truly comparative results have been mostly obtained in tissue culture
models for three-thalassemic mutations in the second intron of the human -globin gene
that create 5' splice sites (IVS2-654, -705 and -745) and activate a common cryptic 3' ss
further upstream in the same intron, resulting in the inclusion of an aberrant exon in -globin
mRNA and in the loss of -globin protein production (Fig. 2A). In this system, U7 Sm OPT
derivatives targeting the cryptic 3' ss or the 5' ss created by the mutations were able to
induce exon skipping, whereas a U7 construct targeting the branch point upstream of the
aberrant exon had no effect (Fig. 2B) [5, 6]. Based on theoretical considerations, a length of
17-20 nucleotides for the antisense sequences tested should be sufficient. Although
sequences in this length range often work, we have found the optimal length for an
antisense sequence targeting the cryptic 3' ss to be 24 nucleotides. It also seems to be
important that the antisense sequence directly abutts the Sm binding sequence, as the
introduction of spacer nucleotides abolished exon skipping in several examples [6].
Compared to such single target U7 snRNAs, more efficient exon skipping can be obtained
with U7 snRNA derivatives carrying two tandem antisense sequences, targeting sequences
upstream and downstream of the targeted exon or partly overlapping with the 3' and 5' ss [6];
L. Angehrn, J. Marquis and D.S., unpublished results; Fig. 2B). This double-target approach
has proven to be very effective as a means to induce exon skipping in the context of other
transcription units such as the human [9] or mouse [8, 10] dystrophin gene, the cyclophilin A
gene [11] or the multiply spliced HIV-1 transcripts [12]. This is why we suggest to begin a
new exon skipping project by selecting such a combination of two antisense sequences of
18-20 nucleotides each. If it is then necessary to further optimise the strategy, one has to
use different sequence combinations or use one of the exon-internal targeting strategies
described below.
Efficient skipping of the aberrant -globin exon has also been obtained when the U7
snRNA derivative carried a sequence complementary to exon-internal sequences (Fig. 2B)
4
[7]. In this case, the U7 snRNP may have acted by masking exonic splicing enhancer (ESE)
sequences or by affecting the flexibility of the exon. In our hands, a U7 Sm OPT derivative
could induce skipping of exon 7 in the human survival of motoneuron 1 (SMN1) and SMN2
genes, even if it did not target a characterised ESE [14]. The exon skipping activity of a U7
Sm OPT derivative targeting exon-internal sequences may be additionally stimulated by
adding a 5' end tail to the U7 RNA that can bind the splicing silencing protein hnRNP A1 as
recently shown for exon 51 of the human dystrophin gene [17].
Two different approaches have been proposed to promote the inclusion of a weak
exon. One approach, originally developed by Hertel and collaborators, is based on the idea
that the weak exon and the subsequent exon compete for forming an active spliceosome
with the 5' ss of the preceding exon (Fig. 3A). In the case of the SMN2 gene, whose poor
exon 7 inclusion is responsible for the disease Spinal Muscular Atrophy (SMA), U7
constructs targeting the 3' ss of exon 8 were indeed able to improve exon 7 inclusion [13,
14]. The other approach, which, in our hands, proved to be more efficient, makes use of U7
snRNAs containing an antisense sequence targeting exon 7 as well as an additional splicing
enhancer sequence, so that a splicing activator of the SR protein family gets recruited to the
weak exon (Fig. 3B) [14]. We could recently demonstrate that improving SMN2 exon 7 use
by this approach indeed has a therapeutic benefit and can even entirely cure a severe SMA
phenotype, when the corresponding U7 expression cassette was introduced into a severe
mouse model for SMA by germline transgenesis [15].
The recent demonstration that defects caused by the weakening of a 5' ss
accompanied by activation of a cryptic 5' ss in the downstream intron can also be corrected
by U7 snRNAs targeting the cryptic site [16] demonstrates that the U7 approach is not
limited to exon skipping/inclusion decisions. Additionally, we point out that the approach
could also be useful beyond the realm of splicing defects caused by mutation. Since the
majority of human genes undergo alternative splicing [18], U7 snRNA-based splicing
modulators could also be used to affect some of these alternative splicing decisions in
medically relevant situations such as neoplasias or diseases of the immune system.
2.3
Gene transfer and regulated expression
It is also important to consider in which system a splicing correcting U7 gene will be used.
Luckily, due to the small size of the U7 expression cassette (~600 bp), it can be delivered to
cells or tissues with many types of vector system.
Even if the ultimate application will necessitate a viral vector, we prefer to modify the
functionally important sequences (antisense sequences with or without SR or hnRNP protein
binding sequence) in the context of the original pSP64-derived U7 Sm OPT plasmid
(protocol 1). The cassette can then be amplified by PCR with mutagenic primers containing
restriction sites to allow for insertion into the vector system of choice (protocol 2).
5
For any cellular assay system that is amenable to DNA transfection by means of lipid
agents or calcium phosphate precipitation (e.g. splicing reporter genes in HeLa cells or in
other easily transfectable cell types), we directly introduce the pSP64-derived U7 Sm OPT
plasmid by this route. The splicing reporter can either be a stable component of the cell
genome or it can be co-transfected along with the modified U7 plasmid.
For cells in culture that are refractory to DNA transfection techniques or if a stable
integration of the U7 cassette into the cell genome is desired, we routinely use lentiviral
transfer vectors. However, as lentiviral vector technology is not established in all laboratories
that may want to use U7-based splicing correction, we point out that it is also possible to
cotransfect the modified U7 plasmid with a suitable selection marker. After the selection has
been applied, individual surviving cell colonies must then be screened for cointegration of the
U7 cassette. An example of such a selection for hygromycin resistance has been described
in the first paper on U7-based splicing correction [5].
Lentiviral vectors can also be used to transfer U7 cassettes to various cell types or to
produce transgenic animals. Lentiviral vectors offer the ability of stable integration and hence
prolonged expression of the U7 cassette in many cell types, including cells of the
hematopoietic system [19]. Moreover, they can be injected into pre-implantation embryos to
generate transgenic mice [20]. We have used this approach to introduce a splicing
correction U7 cassette into mice and then transfer it by conventional breeding into mice of a
severe SMA model [15]. However, it should be made clear that animals transgenic for U7
cassettes can also be produced by more broadly available techniques such as pronuclear
injection of, for example, a simple U7 Sm OPT-derived plasmid.
For gene transfer and long-term expression in non-dividing cell types such as
myofibers, neuronal cells or hepatocytes, the use of non-integrating vectors based on
adenovirus associated virus (AAV) seems to be the ideal choice [21]. Impressive and very
long-lasting results have been obtained with such a vector system with a double-target U7
construct able to induce skipping of exon 21 of the mouse dystrophin gene in the mdx
mouse, a common animal model for Duchenne Muscular Dystrophy [10].
Even though the packaging capacity of AAV vectors is limited, the small U7 cassettes
can easily be accommodated, even together with a marker gene for the monitoring or
selection of transduced cells. It is also possible to introduce several U7 cassettes in tandem,
e.g. to exploit a synergism between different cassettes or to obtain a higher expression due
to the increased copy number of a single one. However, one should not attempt to
incorporate tandem U7 cassettes into lentiviral vectors because of the high tendency of the
viral reverse transcriptase for template switching, which means that all but one copy of a
tandem repeat will be deleted during reverse transcription.
6
Important concerns for in vivo studies and especially for any therapeutic applications in
humans are a potential toxicity and the risk of insertional mutagenesis. In this context we
note that we have on two occasions generated transgenic mice with different U7 cassettes.
One transgenesis experiment was carried out by pronuclear injection, the other by lentiviral
vector transgenesis. In each of these events, mice were bred from multiple founder animals
and over 5-10 generations. In none of these mice have we observed any kind of toxicity or
increased
occurrence
of
neoplasias.
While
some
concerns
regarding
insertional
mutagenesis with lentiviral vectors are still justified [22], this risk is minimal for AAV vectors
because of their non-insertional behaviour. Furthermore, U snRNA promoters are not known
to act as enhancers on nearby genes, which may translate into a lower risk of insertional
mutagenesis if the remainder of the transfer vector is chosen carefully.
For studies in animal models to determine the development of an inherited disease as
well as the therapeutic time window, it may be desirable to induce and repress the
expression of a U7 cassette at will or to express it specifically in certain tissues or cell types.
In this respect it is important to note that the transcription of U snRNA genes is
fundamentally different from that of mRNAs [23]. Except for the U6 and U6 atac RNAs which
are transcribed by RNA polymerase III, all other spliceosomal U snRNAs as well as U7
snRNA are transcribed by a specialised RNA polymerase II complex. This complex interacts
with U snRNA-specific promoter sequences, which differ from those of mRNA promoters.
Transcription is constitutive and terminates in a weakly conserved 3' box located
downstream of the U snRNA coding sequence. Replacement of the promoter by a
regulatable or tissue-specific mRNA promoter is not an option, as it results in a failure to
recognise the 3' box.
However, by adapting a system for the regulated expression of short hairpin RNAs for
RNA interference studies [24], we have recently been able to develop a doxycyclineinducible version of U7 expression cassettes [25]. This system requires two lentiviral vectors
and relies on a doxycycline-sensitive version of the KRAB/KAP1 trancriptional silencing
protein. Concerning tissue-specific expression systems, it may be possible to combine U7
genes with tissue-specific enhancers [8] or to engineer "floxed" U7 genes that can be
activated or inactivated by tissue-specific Cre recombination .
Finally, although this has not been attempted so far, it may well be possible to adapt
the U7-based splicing modulation technology to non-mammalian systems, including
invertebrates and plants.
7
3.
Protocols
2.1
Protocol 1: PCR-based introduction of functional sequences into U7 SmOPT
Generation of PCR primers for a desired U7 construct
The original U7 SmOPT vector [26] contains the murine U7 gene as a 570 bp HaeIII
fragment inserted into the unique SmaI site of the pSP64 polylinker. The wild-type U7 Sm
binding site has been converted to the Sm OPT sequence and single StuI and HpaI sites
have been inserted upstream and downstream of the U7 snRNA sequence, respectively, all
by site directed mutagenesis. The orientation of the U7 gene is against the Sp6 promoter so
that riboprobes for RNAse protection assays can be generated by run-off transcription of
StuI-linearised plasmids with SP6 RNA polymerase [6]. Figs. 4a and 4b show a scheme and
the sequence of the regions relevant for cloning, respectively.
A U7 construct of interest can be generated by PCR by using a heat-stable DNA
polymerase with proof-reading ability (e.g. PfuUltra, Stratagene), a mutagenic primer in the
appropriate region of the U7 gene and a common primer in the Sp6 promoter region of the
plasmid (pSP+vector, Fig. 4b). The mutagenic primer must contain from 5' to 3':
(a)
Plasmid sequences encompassing 4 nucleotides preceding and 7-8 nucleotides
following the unique StuI site (underlined). This sequence ends with the first 1-2
nucleotides of the U7 coding region (yellow).
5’-ACAGAGGCCTTTCCGCA(A) ...
(b)
The functional sequence that is to be introduced at the 5' end of U7 snRNA and
that will replace the original sequence complementary to histone pre-mRNA.
(c)
a 3' anchor containing 9-11 nucleotides corresponding to the Sm OPT site:
... AATTTTTGG(AG)-3'
This primer design works well when the sequence to be introduced is between 15 and
25 nucleotides long. For longer inserts, the yield and purity of the primers may be low,
resulting in inefficient PCR and positive clones containing sequence errors. In this case we
advise to produce the U7 construct in two steps. In the first step, (b) will correspond to the
downstream part of the insert that should be positioned adjacent to the Sm OPT site. Once
this clone has been obtained, a second PCR introduces the upstream part of the sequence
of interest as (b) and uses the first 9-11 nucleotides of the first inserted sequence as anchor
(c). This two-step approach can in fact yield a useful intermediate that can serve as control,
e.g. if the first PCR introduces an antisense sequence and the second one adds a splicing
enhancer or silencer or if two separate antisense sequences are to be inserted to yield a
double-target construct.
8
Once this PCR has been performed, the product is purified by electrophoresis on an
agarose gel, excision of the band and elution with a PCR/gel elution kit (e.g. Wizard SV kit,
Promega). It is then digested with HindIII and StuI, repurified on a PCR/gel elution column
and ligated into the HindIII/StuI opened pSP64-U7 Sm OPT vector. Plasmids from ampicillinresistant colonies must then be screened by restriction and sequence analysis.
PCR reaction with PfuUltra (or another proof reading enzyme):
Reaction mix:
H2O
34.5 μl
10x Buffer
5
μl
dNTPs (10mM)
1
μl
Fw primer (10μM)
2
μl
Re primer (10μM)
2
μl
Template DNA
0.5 μl
PfuUltra (3U/μl)
1
μl
---------------------------------------------------Reaction volume
50
μl
PCR conditions:
1. 95°C – 3min
2. 95°C – 45s
3. 50°C – 60s
4. 72°C – 90s
5. 72°C – 10min
}
(2.- 4. 35x)
Template DNA: pSP64-U7 Sm OPT, diluted to a concentration of 1000 pg/μl
Fw primer:
pSP+vector 5’-TCATACACATACGATTTAGGTGAC-3’
Re primer:
specific mutagenic primer designed as described above
2.1
Protocol 2: Transfer of a U7 cassette into a lentiviral vector for stable integration into
the genome
Subcloning strategy
In principle, the U7 cassette obtained by protocol 1 can be cloned into any type of vector.
We frequently use pWPTS, a lentiviral vector that was generated in D. Trono’s laboratory at
the EPFL, Lausanne-Dorigny, Switzerland and that can be obtained from this source by
request. This vector contains a unique Cla I site upstream of the CMV promoter-driven GFP
gene (Figs. 5a and 5b). Even though this ClaI site can only be cleaved if the plasmid is
amplified in a dam- mutant E. coli strain, it is conveniently located and allows good
expression of both the U7 and GFP genes. This protocol describes how the U7 cassette can
be amplified with mutagenic primers introducing SfuI and ClaI sites upstream and
downstream of the U7 gene, respectively. Since these two enzymes yield compatible 5'
overhangs (CG), a ligation with ClaI cut pWPTS will result in a vector that retains a unique
ClaI site downstream of the U7 insert. This site can then be used to insert further genetic
material if required.
9
PCR reaction with PfuUltra (or another proof reading enzyme):
Reaction mix:
H2O
34.5 μl
10x Buffer
5
μl
dNTPs (10mM)
1
μl
ClaI primer (10μM)
2
μl
SfuI primer (10μM)
2
μl
Template DNA
0.5 μl
PfuUltra (3U/μl)
1
μl
---------------------------------------------------Reaction volume
50
μl
PCR conditions:
1. 95°C – 3min
2. 95°C – 45s
3. 50°C – 60s
4. 72°C – 90s
5. 72°C – 10min
}
(2.- 4. 35x)
Template DNA: modified pSP64-U7 Sm OPT vector resulting from protocol 1, diluted to a
concentration of 1000 pg/μl
ClaI primer:
5’-GGCTGCAGATCGATTCTAGAGG-3’
mutant nucleotides (red, bold) replace SalI by ClaI site (underlined)
SfuI primer:
5’-ACGAATTCGAACTCGCCCCC-3’
mutant nucleotide (red, bold) replaces SacI by SfuI site (underlined)
Additional remarks

Note that, although the ClaI site in the PCR primer overlaps with a GATC sequence, this
site will not be methylated in the PCR product which, therefore, can be cut by ClaI.

This principle of retaining a unique site on one side of the insert can be adapted for many
restriction enzyme recognition sequences serving as insertion sites in other vectors.

If one plans to use the same cloning strategy for many different U7 cassettes, it may be
useful first to introduce the two restriction enzyme recognition sites into pSP64-U7 Sm
OPT by site directed mutagenesis and then to use this new template to generate
appropriate U7 derivatives by protocol 1. The second PCR amplification (protocol 2) can
then be omitted, and the U7 cassette can be subcloned by restriction enzyme digestion
and ligation. This is particularly useful if the cloning vector is large and difficult to
sequence, because it means that one can verify the sequence of the insert in the
modified U7 Sm OPT intermediate and then rely on an identification of clones in the final
vector by restriction digestion. For example, as we are frequently using vectors with ClaI
cloning sites, we have recently converted the original SalI and SacI sites of pSP64-U7
Sm OPT into ClaI and SfuI restriction sites to generate plasmid pU7-ClaI-SfuI-SmOPT.
4.
Example of an experiment
Mutagenic PCR (protocol 1) with four different primers:
Shown below are four primers used in reference [14]. The orientation is 5' to 3'; lengths in
nucleotides are indicated in brackets. Color codes: StuI restriction site; enhancer tail (1 and
2) or scrambled sequence (3); sequence complementary to SMN2 exon 7 (1, 3, 4) or
scrambled sequence (2).
10
ACAGAGGCCTTTCCGCAA GGAGGACGGAGGACGGAGGACATTTGATTTTGTCTAAAAC AATTTTTGG (67)
ACAGAGGCCTTTCCGCAA GGAGGACGGAGGACGGAGGACAGCTAATTATATTCTGTTA AATTTTTGG (67)
ACAGAGGCCTTTCCGCAA GCCCTTCCCCCTCTGCTTGTCTTTTGATTTTGTCTAAAAC AATTTTTGG (67)
ACAGAGGCCTTTCCGCAA
TTGATTTTGTCTAAAAC AATTTTTGG (44)
(a)
(b)
(c)
common primer pSP+vector. Length 24 nucleotides.
TCATACACATACGATTTAGGTGAC
insert Figure 6
5.
Troubleshooting
No PCR product:
- increase anchor sequence length for the U7 reverse primer
- reduce annealing temperature for the PCR to 40° or 45°C
- increase cycle number
- add DMSO to the PCR reaction mix
- check the primer sequence for correctness
No clones obtained: - control transfection efficiency of competent bacteria
- verify vector:insert amounts (2-10-fold molar excess of insert:
~100 ng of vector)
- verify fragment purification procedure
- check ligation efficiency
Clones with aberrant sequences:
- analyse more clones
- test other proofreading polymerase
- optimise PCR conditions
- check for specificity of primers and for secondary structures near
primer binding sites
No effect on splicing with the designed U7 construct:
- try alternative strategies (see strategical considerations), with or
without enhancer/silencer tail
- try different silencer/enhancer attracting sequences
- try to combine different strategies by cotransfecting several
constructs
- move binding site of U7 snRNA to the left or right
- change length of antisense sequence
11
6.
Figure legends
Fig. 1. Turning U7 snRNA into a splicing modulation tool. (A) The U7 snRNP binds, via
the 5' end of its U7 snRNA moiety, to the histone downstream element (HDE) that follows
the histone pre-mRNA 3' processing site (arrow). Additional factors involved in the 3' end
processing reaction are the histone hairpin binding protein (HBP; also called stem-loop
binding protein, SLBP), a zinc finger protein of 100 kDa (ZFP100) and a heat-labile factor
(HLF) composed of various proteins involved in cleavage/polyadenylation of poly(A)+
mRNAs. CPSF-73 is the processing endonuclease. Five Sm proteins and the two Lsm
proteins Lsm10 and Lsm11 bind to the wild-type U7 Sm binding site whose sequence is
indicated below the picture. Lsm11 is essential for 3' end cleavage [2, 27]. (B) By replacing
the wild-type U7 Sm binding site with a consensus sequence derived from spliceosomal
snRNAs, the resulting RNA assembles with the seven Sm proteins found in spliceosomal
snRNAs. As a result, this U7 Sm OPT RNA accumulates more efficiently in the nucleoplasm
and will no longer mediate histone pre-mRNA cleavage, although it can still bind to histone
pre-mRNA and act as a competitive inhibitor for wild-type U7 snRNPs. By further replacing
the sequence binding to the HDE with one complementary to a particular target in a splicing
substrate, one can create U7 snRNAs capable of modulating specific splicing events [1, 2].
12
Fig. 2. Exon skipping strategies using modified U7 Sm OPT snRNAs. (A) Thalassemic
mutations in the second intron of the human -globin gene that have been used to establish
U7-based exon skipping. These mutations create 5' splice sites (ss) at positions 654, 705 or
745 of the second -globin intron. This activates a cryptic 3' ss upstream in the same intron,
resulting in the inclusion of an aberrant exon containing an early stop codon and, therefore,
in the loss of -globin protein production. Asterisks, potential branch points; grey shaded
area, part of aberrant intron fused in frame to exon 2, ending with premature stop codon.
(adapted from [6]. (B) U7 Sm OPT snRNA-based strategies that have been used
successfully. Top: Single-target constructs (top) targeting 3' ss, 5' ss or exon-internal
sequences, preferably exonic splicing enhancers. Bottom left: Double-target U7 snRNAs that
base-pair simultaneously to two regions upstream and downstream of the exon of and
presumably act by forcing the exon of interest into a looped structure. Bottom right:
bifunctional U7 snRNA targeting an exon-internal sequence and additionally containing a
binding sequence for the splicing silencing protein hnRNP A1. Figure modified from [1]. See
main text for references for the individual strategies.
13
Fig. 3. Exon inclusion strategies using modified U7 Sm OPT snRNAs. The picture
shows exons 6-8 of the human SMN2 gene. Compared to the SMN1 gene, one of two
splicing enhancers (SE1 and 2) is altered by a C>U transition, resulting in frequent skipping
of SMN2 exon 7. (A) Exon 7 inclusion (and production of full-length SMN protein) can be
stimulated by a U7 snRNA derivative targeting the 3' splice site of exon 8 [13]. (B)
Alternatively, a bifunctional U7 snRNA that binds to exon 7 and carries a splicing enhancer
sequence at its 5' end can strongly stimulate exon 7 inclusion by providing a binding site for
a splicing stimulatory SR protein, eg. ASF/SF2 [14]. As Spinal Muscular Atrophy patients
have no or only non-functional SMN1 genes and the disease is caused by motoneuron death
due to insufficient SMN protein levels, these strategies represent excellent options for a
gene repair therapy.
14
Fig. 4. PCR-based introduction of functional sequences into U7 SmOPT. (A) Map of the
relevant region of pSP64-U7 Sm OPT and outline of protocol 1. A mutagenic primer covering
the StuI site, the histone antisense region (light green) and the Sm binding site (light blue) of
U7 Sm OPT RNA is used in a PCR reaction with the pSP+vector primer (that can also be
used to sequence inserts) and pSP64-U7 Sm OPT as template. The PCR product and
pSP64-U7 Sm OPT are cut with StuI and HindIII, and the appropriate fragments are religated to generate the plasmid containing the desired replacements in the original antisense
region (asterisks). (B) DNA sequence of the plasmid region shown in (A) with relevant
features indicated.
15
Fig. 5. Subcloning of a U7 cassette into lentiviral vector pWPTS. The entire U7 snRNA
cassette including U7 Promoter and 3' flanking region is amplified by PCR with mutagenic
primers containing SfuI and ClaI recognition sequences. After cleavage with these restriction
enzymes, the fragment can be ligated into ClaI cut pWPTS-GFP. Note that SfuI and ClaI
produce compatible 5' overhangs. The cassette can go into the vector in both orientations.
Ther ClaI junction will always restore a single ClaI site in the vector. Because of an overlap
of the ClaI site with a DAM methylation site, the vector DNA must be amplified in an E. coli
dam- strain in order to be cleavable by ClaI.
Fig. 6. Agarose gel analysis of PCR reactions. A negative photograph of a 2% agarose
gel is shown. The lanes are labeled with the names of the mutagenic oligos, loaded in the
same order as presented in the sequences above. PCR conditions were identical to the ones
shown in protocol 1, except that the annealing temperature was adjusted to 45°C. The
expected size of the PCR products is 339bp (316 for U7-BiWT-NoTail). These bands were
later excised and the PCR products isolated from the gel, prior to digestion with StuI and
HindIII.
16
7.
References
[1] Asparuhova,M., Kole,R., & Schümperli,D. (2004). Antisense derivatives of U7 and other small
nuclear RNAs as tools to modify pre-mRNA splicing patterns. Gene Therapy Regul. 2, 321349.
[2] Schümperli,D. & Pillai,R.S. (2004). The special Sm core structure of the U7 snRNP: far-reaching
significance of a small nuclear ribonucleoprotein. Cell Mol. Life Sci. 60, 2560-2570.
[3] Pillai,R.S., Will,C.L., Lührmann,R., Schümperli,D., & Müller,B. (2001). Purified U7 snRNPs lack
the Sm proteins D1 and D2 but contain Lsm10, a new 14 kDa Sm D1-like protein. EMBO J. 20,
5470-5479.
[4] Pillai,R.S., Grimmler,M., Meister,G., Will,C.L., Lührmann,R., Fischer,U., & Schümperli,D. (2003).
Unique Sm core structure of U7 snRNPs: assembly by a specialized SMN complex and the
role of a new component, Lsm11, in histone RNA processing. Genes Dev. 17, 2321-2333.
[5] Gorman,L., Suter,D., Emerick,V., Schümperli,D., & Kole,R. (1998). Stable alteration of premRNA splicing patterns by modified U7 small nuclear RNAs. Proc. Natl. Acad. Sci. USA 95,
4929-4934.
[6] Suter,D., Tomasini,R., Reber,U., Gorman,L., Kole,R., & Schümperli,D. (1999). Double-target
antisense U7 snRNAs promote efficient skipping of an aberrant exon in three human betathalassemic mutations. Hum. Mol. Genet. 8, 2415-2423.
[7] Vacek,M.M., Ma,H., Gemignani,F., Lacerra,G., Kafri,T., & Kole,R. (2003). High-level expression
of hemoglobin A in human thalassemic erythroid progenitor cells following lentiviral vector
delivery of an antisense snRNA. Blood 101, 104-111.
[8] Brun,C., Suter,D., Pauli,C., Dunant,P., Lochmüller,H., Burgunder,J.M., Schümperli,D., & Weis,J.
(2003). U7 snRNAs induce correction of mutated dystrophin pre-mRNA by exon skipping. Cell
Mol. Life Sci. 60, 557-566.
[9] De Angelis,F.G., Sthandier,O., Berarducci,B., Toso,S., Galluzzi,G., Ricci,E., Cossu,G., &
Bozzoni,I. (2002). Chimeric snRNA molecules carrying antisense sequences against the splice
junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a
dystrophin synthesis in Delta 48-50 DMD cells. Proc. Natl. Acad. Sci. U. S. A 99, 9456-9461.
[10] Goyenvalle,A., Vulin,A., Fougerousse,F., Leturcq,F., Kaplan,J.C., Garcia,L., & Danos,O. (2004).
Rescue of dystrophic muscle through U7 snRNA-mediated exon skipping. Science 306, 17961799.
[11] Liu,S., Asparuhova,M., Brondani,V., Ziekau,I., Klimkait,T., & Schümperli,D. (2004). Inhibition of
HIV-1 multiplication by antisense U7 snRNAs and siRNAs targeting cyclophilin A. Nucl. Acids
Res. 32, 3752-3759.
[12] Asparuhova,M.B., Marti,G., Liu,S., Serhan,F., Trono,D., & Schümperli,D. (2007). Inhibition of
HIV-1 multiplication by a modified U7 snRNA inducing Tat and Rev exon skipping. J Gene
Med. 9, 323-334.
[13] Madocsai,C., Lim,S.R., Geib,T., Lam,B.J., & Hertel,K.J. (2005). Correction of SMN2 pre-mRNA
splicing by antisense U7 small nuclear RNAs. Molecular Therapy 12, 1013-1022.
[14] Marquis,J., Meyer,K., Angehrn,L., Kämpfer,S.S., Rothen-Rutishauser,B., & Schümperli,D. (2007).
Spinal muscular atrophy: SMN2 pre-mRNA splicing corrected by a U7 snRNA derivative
carrying a splicing enhancer sequence. Mol. Ther. 15, 1479-1486.
[15] Meyer,K., Marquis,J., Trub,J., Nlend Nlend,R., Verp,S., Ruepp,M.D., Imboden,H., Barde,I.,
Trono,D., & Schumperli,D. (2009). Rescue of a severe mouse model for spinal muscular
atrophy by U7 snRNA-mediated splicing modulation. Hum. Mol. Genet. 18, 546-555.
[16] Uchikawa,H., Fujii,K., Kohno,Y., Katsumata,N., Nagao,K., Yamada,M., & Miyashita,T. (2007). U7
snRNA-mediated correction of aberrant splicing caused by activation of cryptic splice sites. J
Hum. Genet. 52, 891-897.
[17] Goyenvalle,A., Babbs,A., van Ommen,G.J., Garcia,L., & Davies,K.E. (2009). Enhanced exonskipping induced by U7 snRNA carrying a splicing silencer sequence: Promising tool for DMD
therapy. Mol. Ther. 17, 1234-1240.
17
[18] Zavolan,M. & van Nimwegen,E. (2006). The types and prevalence of alternative splice forms.
Curr. Opin. Struct. Biol. 16, 362-367.
[19] Wiznerowicz,M. & Trono,D. (2005). Harnessing HIV for therapy, basic research and
biotechnology. Trends in Biotechnology 23, 42-47.
[20] Pfeifer,A. (2004). Lentiviral transgenesis. Transgenic Research 13, 513-522.
[21] Buning,H., Perabo,L., Coutelle,O., Quadt-Humme,S., & Hallek,M. (2008). Recent developments
in adeno-associated virus vector technology. J Gene Med. 10, 717-733.
[22] Cockrell,A.S. & Kafri,T. (2007). Gene delivery by lentivirus vectors. Mol. Biotechnol. 36, 184-204.
[23] Egloff,S., O'Reilly,D., & Murphy,S. (2008). Expression of human snRNA genes from beginning to
end. Biochem Soc. Trans. 36, 590-594.
[24] Wiznerowicz,M. & Trono,D. (2003). Conditional suppression of cellular genes: lentivirus vectormediated drug-inducible RNA interference. J. Virol. 77, 8957-8961.
[25] Marquis,J., Kämpfer,S.S., Angehrn,L., & Schümperli,D. (2008). Doxycycline-controlled splicing
modulation by regulated antisense U7 snRNA expression cassettes. Gene Ther. 16, 70-77.
[26] Grimm,C., Stefanovic,B., & Schümperli,D. (1993). The low abundance of U7 snRNA is partly
determined by its Sm binding site. EMBO J. 12, 1229-1238.
[27] Dominski,Z. & Marzluff,W.F. (2007). Formation of the 3' end of histone mRNA: Getting closer to
the end. Gene 396, 373-390.
8.
Abbreviations
AAV (adenovirus associated virus)
CMV (human cytomegaly virus)
DAM (DNA adenine methylase)
dam- (mutant for DNA adenine methylase)
DMSO (dimethyl sulfoxide)
ESE (exonic splicing enhancer)
GFP (green fluorescence protein)
hnRNP (heterogeneous nuclear ribonucleoprotein)
PCR (polymerase chain reaction)
SMA (Spinal Muscular Atrophy)
SMN (survival of motoneuron)
snRNA (small nuclear RNA)
snRNP (small nuclear ribonucleoprotein)
SR protein (serine and arginine-rich protein)
ss (splice site)
18