Download Full Paper - Biotechniques.org

Expression of Pdlim7 in cancer cells
Yanxi Jiang
Department of Biological Science
Fordham University, Bronx, New York
Abstract
PDZ and LIM domain protein 7(Pdlim7), also known as Enigma, is a member of
the LIM family of proteins and is composed of an N-terminal PDZ domain, and three
C-terminal LIM domains. Pdlim7 acts as a scaffold protein that assembles signaling
complexes. Pdlim7 plays a role in tumorigenesis by promoting cancer cell invasion
and metastasis. In this study, we used RT-PCR to study the differences of expression
of Pdlim7 in 5 breast cancer cell lines and HeLa cell line. The results showed that the
Pdlim7 gene produces a splice variant with unique terminal exon that was only
expressed in HeLa cells, but not in breast cancer cells.
Introduction
Biological processes rely on proper cellular signaling. Incorrect signaling
processes can result in severe developmental defects and a vast variety of
pathologies, such as tumor.
One of the key requisites for accurate signal transduction is the correct
formation of signaling complexes. The spatial and temporal assembly of these
multi-protein complexes is regulated by scaffold proteins, which usually contain
more than one interaction domain. One of the many examples for these interaction
domains is Pdlim7, which contains the PDZ domain and LIM domain.
Pdlim7 is a protein that in humans is encoded by the Pdlim7 gene, which
locates on Chromosome 5. It is made of an N-terminal PDZ domain and three
C-terminal LIM domains. The PDZ domain interacts with actin-binding proteins.
Its LIM domains bind to proteins involved in mitogenic or insulin signaling such as
receptor tyrosine kinases (Fig.1).
Figure 1. Domains of Pdlim7.
When PDZ-LIM proteins do not function well, they can promote tumor growth and
malignant transformation. In one study, Pdlim7 played a role in tumorigenesis in a
mechanism by triggering mitosis and decreasing p53 antiproliferative activity .
Kaplan-Meier survival analysis showed that the expression level of Pdlim7 is related
to the survival rate of breast cancer patients (Fig. 2). Also, PDZ domain could
interact with human papillomaviruses, which is related to cervical cancer.
HPV-induced cancer cells often have viral sequences integrated into the cellular
DNA.
Figure 2. Comparison of survival outcome between
Enigma expression in high RET expressing breast
cancers.
doi:10.1371/journal.pone.0087116.g005
According to statistics from CDC in 2010, breast cancer is the most common
cancer in women, no matter your race or ethnicity and the most common cause of
death from cancer among Hispanic women. It is the second most common cause of
death from cancer among white, black, Asian/Pacific Islander, and American
Indian/Alaska Native women. 206,966 women and 2,039 men in the United States
were diagnosed with breast cancer. 40,996 women and 439 men in the United
States died from breast cancer.
Pdlim7 gene produces a splice variant. NM_213636.2 has a unique terminal
exon that is not possessed by other variants. (Fig. 3)
Figure 3. Pdlim7 gene produces a splice variant.
Material andmethods
Cancer cell RNAs
Six cancer cell RNAs were used in the study:
Breast cancer cells:
estrogen receptor α (+): MCF-7,T47-D;
estrogen receptor α (-): MDA-MB-231, MDA-MB-435, and MDA-MB-468
Cervical cancer cells: HeLa
All RNAs were provided by Dr. QZ Wei.
RT-PCR
Primers 5’-3’
Pdlim7 ( Designed by Yanxi Jiang)
1.Forward GCATCGATGGCGAGAATG
Reverse CATAGCGCTCGGCAAAC
2.Forward GGCTGATGGAGAACACAGAG
Reverse CAGTACCACAGGGCAAAGAG
3.Forward GTTTGTGTGTAGCCAGTGTG
Reverse CAGTACCACAGGGCAAAGAG
Reverse CATAGCGCTCGGCAAAC
GAPDH
Forward CCACTCCTCCACCTTTGAC
Reverse ACCCTGTTGCTGTAGCCA
RT-PCR was performed using QIAGEN® One-Step RT-PCR Kit following the
instructions. GAPDH was used as the loading control. 10ng of RNA were amplified in
-PCR programs were set up: Reverse
transcription of 50°C for 30 min, HotStarTaq DNA Polymerase activation of 95°C for
15 min, 40 cycles of 94°C for 30 sec, 57°C for 30 sec, and 72°C for 60 sec, then a final
extension of 72°C for 10 min followed by holding at 4°C.
Gel Electrophoresis
-
products
bromide). The voltage of electrophoresis is 160 V. Gels were visualized in BioRad UV
trans-illuminator and pictures were taken.
PCR product purification, gel extraction and sequencing
Pdlim7 amplified by primer group1, 2 and GAPDH PCR products were purified
using QIAquick® PCR Purification Kit following the manufactures instructions and
Pdlim7 amplified by primer group 3 were cut from gel and purified using
QIAquick® Gel Extraction Kit following the manufacturer’s instructions. Purified
PCR products were sent out for sequencing by GENEWIZ® and were confirmed by
BLAST.
Results
Primer Group 1
First group of primers were designed as shown (Fig. 4A). Gel electrophoresis
results show that all cell lines expressed Pdlim7. MDA-MB 435 and MDA-MB 231
had a very light band below the dark bands. Those were possibly another variant but
too light to sequence so further studies are needed to identify the results (Fig. 4B).
Sequencing result of the top band was NM_005451.4 (Fig. 4C).
A
B
C
Figure 4. (A) Primer designed as shown. (B) RT-PCR results of
the amplification of the transcript with the above primer pair.
L->R: MDA-MB-435, MDA-MB-468, T47-D, HeLa cells, MCF-7,
MDA-MB-231 and Negative template control. GAPDH was used
as a loading control. *: Variants identified by sequencing
( Similarity 99%). (C) Sequencing result of bands marked as * or
**.
Primer Group 2
Second group of primers were designed as shown (Fig. 5A). Gel electrophoresis
results show that only HeLa cell lines expressed the variant with a unique terminal
exon of Pdlim7. Breast cancer cell almost did not express this variant (Fig. 5B).
Sequencing result of the band was NM_213636.2 and XM_006714941.1 (Fig. 5C).
A
B
C
Figure 5. (A) Primer designed as shown. (B) RT-PCR results of
the amplification of the transcript with the above primer pair.
L->R: MDA-MB-435, MDA-MB-468, T47-D, HeLa cells, MCF-7,
MDA-MB-231 and Negative template control. GAPDH was used
as a loading control. *: Variants identified by sequencing
( Similarity 99%). (C) Sequencing result of bands marked as * or
**.
Primer Group 3
To confirm the results in Fig. 5 were not due to technical bias, primer group 3
were designed to amplify all variants as shown (Fig. 6A). Gel electrophoresis results
showed that again only HeLa cell lines expressed the variant with a unique terminal
exon of Pdlim7 while Breast cancer cell almost did not. The band indicating variants
with the unique terminal exon was on the top. All cell lines had variants of full length
(Fig. 6B). Sequencing result of the top band was NM_213636.2 and XM_006714941.1;
lower band was NM_005451.4 (Fig. 6C).
A
B
C
Figure 6. (A) Primer designed as shown. (B) RT-PCR results of the amplification of the transcript with the
above primer pair. L->R: MDA-MB-435, MDA-MB-468, T47-D, HeLa cells, MCF-7, MDA-MB-231 and
Negative template control. GAPDH was used as a loading control. *or **: Variants identified by sequencing
( Similarity 99%). (C) Sequencing result of bands marked as * or **.
Discussion
This study demonstrated that the Pdlim7 gene produces a splice variant with
the unique terminal exon that only expressed in HeLa cells, but not in breast cancer
cells.
The expression level of Pdlim7 is negatively related to the survival rate of breast
cancer patients. There are studies showing that Pdlim7 could interact with BRCA1 or
P53 respectively. In this study, Breast cancer cells selectively expressed some
variants of Pdlim7. This could indicate that Pdlim7 proteins coded by these variants
contained specific domains needed by breast cancer progression. On the other hand,
only HeLa cells, which were the cervical cancer cell line, expressed the unique
terminal exon, omitted by breast cancer cells. This difference might be related to the
differences of cancer cell type and characteristics between breast cancer and
cervical cancer cells. Breast cancer is adenocarcinoma while cervical cancer is
squamous cell cervical carcinoma. Different types of cancer might need specific
Pdlim7 as scaffolding protein to facilitate different signaling complexes. The unique
terminal exon is neither part of PDZ domain nor Lim domain. The specific function
of it remains enigmatic and further studies are required.
Acknowledgment
I would like to thank Dr. Wei for providing the RNA of tested cell lines. I would
like to thank my classmates for helping me. I would like to thank Kate Reid and
Catharina Grubaugh for going above and beyond their duties as Teaching Assistants
and for their never-ending patience and support throughout this project. I would
like to thank Dr. Rubin for his guidance and for making this project possible.
References
Aartjan J.W. te Velthuis AJ, Bagowski CP. 2007. PDZ and LIM domain-encoding genes:
molecular interactions and their role in development. Scientific- WorldJournal 7:
1470–92.
Sheng M, Sala C. 2001. PDZ domains and the organization of supramo- lecular
complexes. Annu Rev Neurosci 24: 1–29.
Fanning AS, Anderson JM. 1999. PDZ domains: fundamental building blocks in the
organization of protein complexes at the plasma membrane. J Clin Invest 103: 767–
72.
Jelen F, Oleksy A, Smietana K, et al. 2003. PDZ domains – Common players in the cell
signaling. Acta Biochim Pol 50: 985–1017.
Kazunori Nagasaka, Kei Kawana et al. 2013. PDZ Domains and Viral Infection:
Versatile Potentials of HPV-PDZ Interactions in relation to Malignancy. BioMed
Research International Volume 2013: 9.
Bach I. 2000. The LIM domain: regulation by association. Mech Dev 91: 5–17.
Kadrmas JL, Beckerle MC. 2004. The LIM domain: from the cytoskeleton to the
nucleus. Nat Rev Mol Cell Biol 5: 920–31
Wu R, Durick K, Songyang Z, et al. 1996. Specificity of LIM domain interactions with
receptor tyrosine kinases. J Biol Chem 271: 15934–41.
Durick K, Wu RY, Gill GN, et al. 1996. Mitogenic signaling by Ret/ptc2 requires
association with enigma via a LIM domain. J Biol Chem 271:12691–4.
Kuroda S, Tokunaga C, Kiyohara Y, et al. 1996. Protein-protein interaction of zinc
finger LIM domains with protein kinase C. J Biol Chem 271: 31029–32.
Kleiber K, Strebhardt K, Martin BT et al. Anticancer Res. 27, 55–61.2007.
Bagheri-Yarmand R, Mazumdar A, Sahin AA, et al. 2006. LIM kinase 1 increases
tumor metastasis of human breast cancer cells via regulation of the urokinase-type
plasminogen activator system. Int J Cancer 118: 2703– 10.
Cho-Rok Jung, Jung Hwa Lim et al. 2010. Enigma negatively regulates p53 through
MDM2 and promotes tumor cell survival in mice. Clinical Inv J. vol 120: 4493-4506
Stephen C. Kales, Marion M. Nau et al. 2014. Enigma Prevents Cbl-c-Mediated
Ubiquitination and Degradation of RETMEN2A. PLOS ONE.Vol 9:1-11.
http://www.cdc.gov/cancer/cervical/basic_info/
http://www.cdc.gov/cancer/breast/basic_info/