Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
METHODS Plasmid construction To generate the expression plasmids pHL2574, pHL2575, and pHL2578 we amplified the hermes transposase from pGal-hermes-native (pHL2569, N. Craig) and with primers HL1357, HL1389 added an upstream XhoI and a downstream XmaI site. The fragment was ligated into the XhoI and XmaI sites in the polylinker of the vectors Rep3X, Rep41X, and Rep81X (FORSBURG 1993). To construct plasmids pHL2623, pHL2624, and pHL2625 a PCR product encoding the transposase with the T317A mutation was generated using primers HL1477 and HL1478. The resulting product was cut with EcoRI, which cuts within primer HL1478, and BglII, which cuts immediately downstream of primer HL1477. The resulting fragment was cloned into the EcoRI and BglII sites of pGal-hermes-native (pHL2569, N. Craig). These plasmids were digested with SalI and BglII and inserted into vectors pHL2574, pHL2575, and pHL2578 at the same sites to form vectors pHL2623, pHL2624, and pHL2625, which contain the T317A mutation in the transposase. The donor plasmid pHL2577 was built by fusion PCR. Hermes right, kanMX6, and hermes left were amplified separately using as template pHL2572 for the hermes TIRs and pHL2205 for kanMX6. The three components were combined by fusion PCR to yield the full-length fragment. Restriction sites EagI and XhoI were added via outside primers HL1364 and HL1392. Terminal A’s were added to the 2887 bp fragment and it was inserted into pCR2.1 (invitrogen) making pHL2576. The new construct was digested with EagI and XhoI and the fragment containing hermes right, kanMX6, and hermes left was cloned into pHL390 using EagI and XhoI of the polylinker. To construct pHL2641, PCR primers HL1503 and HL1504 were used to produce an 850 bp PCR product containing the p15A origin of replication (ori) from pACYC184 (ROSE 1988). The ori was inserted into the NdeI and XmaI sites of pHL2576. The new element containing the ori was excised with EagI and XhoI and cloned into the same sites of pHL2577, generating vector pHL2641. To generate plasmid pHL2651, the BglII , PmeI fragment of NatR from pCR2.1Nat (SATO et al. 2005) (pHL2621) was inserted into the same sites in the kanMX6 gene in pHL2577. Media Edinburgh minimal liquid (EMM) with 2 g/L of dropout mix (all amino acids in equal weights plus adenine in 2.5 time more weight) was used when selecting for auxotrophs {Moreno, 1991 #1429}. 10uM thiamine was added to repress the expression of the nmt1 promoter when necessary. 5-Fluoroorotic acid (5-FOA) was added at 1 mg/mL for counter-selection of URA3 (BOEKE et al. 1987). The complete media (YES) included 30 g/L dextrose, 5 g/L yeast extract, and 2 g/L of complete dropout mix, a combination of all amino acids, uracil, and adenine. To select for insertions, G418 at a concentration of 500 µg/mL was added along with 5-FOA to YES plate media. To select for insertions of hermes-nat, 100 µg/mL of nourseothricin (WERNER BioAgents) was added to YES. Yeast extract media (YE) was used to screen for ade- colonies and is identical to YES but lacking the complete dropout mix. Transposition assay Cells were initially grown as patches on EMM-ura-leu+B1 for 2 days. Plates were replica printed to EMM-ura-leu-B1 and grown for 2 days to induce transcription of hermes transposase. Plates were then replica printed to EMM-leu+FOA+B1 and grown for 2 days to remove the donor plasmid. Finally, plates were replica printed to YES+FOA+G418 and grown for 40 hours to obtain patches of cells containing insertions of the transposon. Mapping insertion sites Following the transposition assay, plasmids were removed from the cells by expanding single colonies on YES plates. Inverse PCR was performed by digesting 2 µg of prepared genomic DNA (see DNA blotting) overnight with 40 units of EcoRI (NEB). The resulting digestion was phenol extracted, and diluted to 1 ng/µl. The dilution was religated with 1 U/µl T4 DNA Ligase at 18 °C overnight. The resulting material was ethanol precipitated and 100 ng of circularized DNA was amplified using primers pHL1430 and pHL1431. The PCR products were inserted into pCR2.1 (Invitrogen) and sequenced. The target site duplication was verified using a primer in hermes left (HL1893) and one in the flanking genomic DNA as identified by the inverse PCR. The sequence composition of the target site duplications was displayed as a sequence logo using weblogo.berkeley.edu. DNA blotting Fifty mL cultures were grown to a final OD of 8.0 at 600 nm and pelleted. Cells were resuspended in solution Sp1 (1.2 M sorbitol, 50 mM citric acid monohydrate, and 50 mM Na2HPO4*7H2O, 40 mM EDTA, pH 5.6) containing 15 mg Zymolyase. Spheroblasted cells were resuspended in 7.5 mL 5X TE + 1% SDS and incubated for one hour to lyse cells. Following centrifugation and resuspension, 2.5 mL of 5M KOAc was added and incubated for 30 minutes. Cellular debris was removed via centrifugation and the nucleic acids were precipitated by adding 2.5 volumes of cold 2-propanol. RNase A digestion was performed for one hour at a concentration of 100 µg/mL. Overnight digestion with Proteinase K (50 µg/mL) was followed by three phenol, chloroform isoamyl alcohol extractions. Finally, DNA was precipitated in 0.1 volume of 5M NaCl and 2.5 volumes of ethanol, and then resuspended in 40 uL of 1x TE. DNA blotting was performed by digesting two µg of prepared genomic DNA overnight with 40 units of EcoRI. Following electrophoresis and transfer, the membrane was hybridized using a radiolabeled fragment of kan sequence. Immunoblot Analysis of Hermes Transposase A whole cell protein extract was obtained using a standard bead-beater protocol. Cells were grown to a final OD of 1.0 and 40 OD units of cells were pelleted. The cells were washed first with water and then with extraction buffer consisting of 15 mM KCl, 10 mM HEPES-KOH (pH 7.8), and 5 mM dithiothreitol. The cells were then resuspended in 0.2 ml of extraction buffer plus 5.0 mM dithiothreitol, 2.0 mM phenylmethylsulfonyl fluoride and a mixture of protease inhibitors including a protease inhibitor cocktail (1 tablet in 50 ml, Roche), as well as 0.7 g/ml pepstatin, 0.5 g/ml leupeptin and 1 g/ml aproteinin. 100 l of acid-washed glass beads were added, and the samples were put into the mini-beadbeater 8 (Biospec products Inc., Bartlesville, OK) for 3 cycles of 30 seconds to break the cells. Twelve µg of protein was then subjected to electrophoresis on a 10-20% Tris-Glycine (Invitrogen) gel and transferred to a membrane. The membrane was probed overnight at room temperature with an anti-transposase antibody added at a concentration of 1:1000. The antibody was polyclonal and was raised in rabbit (X. Li, and N. Craig, unpublished). Table S1: Plasmids* Plasmid pHL390 pHL423 Rep3X Markers amp, URA3 amp, LEU2 pHL2205 amp, LEU2 amp, LEU2 amp, LEU2 amp pHL2569 amp pHL2572 amp, LEU2 Tet, cat Rep41X Rep81X pACYC184 pHL2574 pHL2575 pHL2576 pHL2578 pHL2621 amp, LEU2 amp, LEU2 Amp, kan amp, LEU2 amp, kan pHL2623 amp, LEU2 pHL2624 amp, LEU2 pHL2625 amp, LEU2 pHL2577 Amp, Description pSP2 lacking hermes TIR’s Rep3 nmt1 promoter, control plasmid lacking hermes transposase nmt1 promoter, high expression nmt1 promoter, medium expression nmt1 promoter, low expression pFA6a-kanMX6 hermes transposase driven by GAL promoter of S. cerevisiae. hermes left/right flanking LEU2 of S. cerevisiae. cloning vector with p15A origin of replication Rep3X nmt1 promoter expressing wt hermes transposase Rep41X nmt1 promoter expressing wt hermes transposase hermes TIR’s flanking kanMX6 in cloning plasmid pCR2.1 rep81X nmt1 promoter expressing wt hermes transposase nat resistance gene in cloning plasmid pCR2.1 Rep3X nmt1 promoter expressing mutant hermes transposase (T317A) Rep41X nmt1 promoter expressing mutant hermes transposase (T317A) Rep81X nmt1 promoter expressing mutant hermes transposase (T317A) hermes TIR’s flanking kanMX6 Ref. (COTTAREL et al. 1993) (MAUNDRELL 1993) (FORSBURG 1993) (FORSBURG 1993) (FORSBURG 1993) (BAHLER et al. 1998) N. Craig N. Craig (ROSE 1988) this study this study This study this study (SATO et al. 2005) this study this study this study this study pHL2641 pHL2651 URA3 Amp, URA3 Amp, URA3 hermes TIR’s flanking kanMX6 with bacterial origin of replication p15A hermes TIR’s flanking nat with bacterial origin of replication p15A *The genes URA3 and LEU2 came from S. cerevisiae. this study this study Table S2. Oligonucleotides Oligonucl eotide HL1364 HL1376 Sequence (5’ to 3’) AGTAACAAAGGAACCTAGAGGG HL1430 TTAATTAACCCGGGGATCCGCCG AAGT CGGTGATGCTGTCGCCG CGGCGACAGCATCACCGACTTCG GCGGATCCCCGGGTTAATTAA CCGAGAATTAAAAACTGTTTCAG GGGAATTCGAGCTCGTTTAAAC GTTTAAACGAGCTCGAATTCCCCT GAAACAGTTTTTAATTCTCGG TTAACAATAACGGGCGGCCGCAG AGAACAACAACAAGTGGC AACAGGAAAGACCTCCTCGAGCA TATGCAGAAAATGGACAATTTGG AAGTG CACATTACACTTCCCGGGTTATAT ATCTAATTTACAAAAATTTTTG GCCTCGACATCATCTGCCC HL1431 CTCTAGCGGTGATCTTAACATC HL1477 GTCGGCCTTTTTCGGCCGTCTCTG HL1478 GTGGAATTCCACCGTGCAGGGCA CTCAC HL1503 GCATCGTACAGGTACATATGGAA GTGCTTCATGTGGCAGG ACCACAGTGCAGCTCCCGGGGGC TGACTTCAGGTGCTACATT ACCCGAGTGTCGATGAATCAATG AA HL1379 HL1367 HL1368 HL1392 HL1389 HL1357 HL1504 HL1893 REFERENCES Use 5’ Primer to amplify Hermes right in the fusion PCR product 3’ Primer to amplify Hermes right in the fusion PCR product 5’ Primer to amplify KanMX-6 for the fusion PCR 3’ Primer to amplify pFA6KanMX-6 the fusion PCR 5’ Primer to amplify Hermes left in the fusion PCR product 3’ Primer to amplify Hermes left in the fusion PCR product 5’ Primer to PCR Hermes Transposase 3’ Primer to PCR Hermes Transposase 5’ Primer in pFA6-KanMX-6 for inverse PCR 3’ Primer in Hermes Right for inverse PCR 5’ Primer to amplify BglII / EcoRI fragment containing T317A 3’ Primer to amplify BglII / EcoRI fragment containing T317A 5’ Primer to amplify p15A origin of replication 3’ Primer to amplify p15A origin of replication In hermes-left to PCR amplify junction with genomic DNA BAHLER, J., J. Q. WU, M. S. LONGTINE, N. G. SHAH, A. MCKENZIE et al., 1998 Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14: 943-951. BOEKE, J. D., J. TRUEHEART, G. NATSOULIS and G. R. FINK, 1987 5-Fluoro-orotic acid as a selective agent in yeast molecular genetics. Meth Enzymol 154: 164-175. COTTAREL, G., D. BEACH and U. DEUSCHLE, 1993 Two new multi-purpose multicopy Schizosaccharomyces pombe shuttle vectors, pSP1 and pSP2. Curr Genet 23: 547-548. FORSBURG, S. L., 1993 Comparison of Schizosaccharomyces-Pombe Expression Systems. Nucleic Acids Research 21: 2955-2956. MAUNDRELL, K., 1993 Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene 123: 127-130. ROSE, R. E., 1988 The Nucleotide-Sequence of Pacyc184. Nucleic Acids Research 16: 355-355. SATO, M., S. DHUT and T. TODA, 2005 New drug-resistant cassettes for gene disruption and epitope tagging in Schizosaccharomyces pombe. Yeast 22: 583-591.