Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Supplementary Information (doc 120K)
Document related concepts
Transcript
HEDGEHOG/GLI-E2F1 axis modulates iASPP expression and function and regulates melanoma cell growth Silvia Pandolfi, Valentina Montagnani, Andrea Lapucci and Barbara Stecca SUPPLEMENTARY MATERIALS AND METHODS Lentiviral vectors Lentiviruses were produced in HEK-293T cells. Lentiviral vectors pLKO.1-puro-shE2F1-2 (LVshE2F1-2) (targeting sequence 5’-CGCTATGAGACCTCACTGAAT-3’, exon 3), pLKO.1-puroshGLI2-1 (LV-shGLI2-1) (targeting sequence 5’-CCGCTTCAGATGACAGATGTT-3’, exon 12), pLKO.1-puro-shGLI2-2 (LV-shGLI2-2) (targeting sequence 5’-GTTCCTGAACATGATGACCTA-3’, exon 12) and pLKO.1-puro-shiASPP (LV-shiASPP) (targeting sequence 5’- CCAACTACTCTATCGTGGATT-3’ exon 8), were from Open Biosystems (Lafayette, CO, USA). Western blot and cellular fractionation For cellular fractionation, cells were lysed in Buffer A (20mM HEPES pH 7.9, 10mM KCl, 1mM EDTA, 0.2% NP-40, 10% glycerol) added with protease and phosphatase inhibitors. After centrifugation the supernatant was collected as cytoplasmic extract, whereas the pellets were dissolved in Buffer B (20mM HEPES pH 7.9, 420mM NaCl, 20% Glycerol, 10mM KCl, 1mM EDTA) added with protease and phosphatase inhibitors. After freeze-and-thaw the lysate was centrifuged and the supernatant was collected as nuclear extract. The following antibodies were used for Western blot: goat anti-GAPDH (V-18) and goat anti-Fibrillarin (D-14) (Santa Cruz Biotechnology, Santa Cruz, CA, USA). Quantitative real-time PCR (qPCR) Primer sequences are the following (5’ to 3’): GLI2-F, 5’-CTCAGCCCCGCTGATGTGGC-3’; GLI2-R, 5’-TCAGCAGGTCCCCGTAGGGC-3’; E2F2-F, GGCCAAGAACAACATCCAGT; E2F2-R, TGTCCTCAGTCAGGTGCTTG; E2F3A-F, 5’- CACGGACCCTCCAGCAGAG-3’ and E2F3A-R, 5’- GCTTTCTCCTAGCTCCAGCC-3’; E2F4-F, GGAAGCCTCACGTCCAAATA; E2F4-R, TGAGCTCACCACTGTCCTTG. Chromatin Immunoprecipitation (ChIP) Primers used were: E2F1promB-F, 5’-ACGCGCCAAATCCTTTTTGCCG-3’ and E2F1promB-R, 5’AATAGGAACCGCCGCCGTTG-3. Flow cytometry analysis For cell cycle distribution analysis, cells were stained with a hypotonic propidium iodide (PI) solution (50g/ml PI, 0.1% Triton X-100, 0.1% sodium citrate). For proliferation index experiments, cells were labeled with 5M of CellTrace Violet (Life Technologies), seeded and allowed to proliferate for 72 and 96 hrs and analyzed using flow cytometry. CellTrace Violet data were normalized to controls arrested at the parent generation with 1g/ml mitomycin C (t=0 hrs) and proliferation index was calculated using ModFit LT software (Verity Software House, Topsham, ME, USA). Cytometric analysis was performed with FACS-Canto II (Becton Dickinson). Statistical analysis Pearson’s correlation and simple regression analysis using StatGraphics Centurion XV.I software (Statpoint Technologies, Warrenton, VA, USA) was performed to evaluate the correlation between GLI1 and E2F1 expression in our panel of melanoma cell lines and patient-derived melanoma cells. Self-renewal assay For self-renewal assay cells transduced with LV-c, LV-shPTCH1, LV-shE2F1 and LVshPTCH1/LV-shE2F1 lentiviruses were plated at 5 cells/ml in DMEM/F12 added with 20µg/ml insulin, 0.6% glucose, 1X N2, 10ng/ml bFGF, 10ng/ml EGF (Life Technologies). Primary melanoma spheres were dissociated and plated in 12-well plates at 1 cell/μl dilution. After 1 or 2 weeks, secondary spheres were counted (1,2). All the experiments were performed in triplicate and repeated at least three times. SUPPLEMENTARY REFERENCES 1. Santini R, Vinci MC, Pandolfi S, Penachioni JY, Montagnani V, Olivito B et al. Hedgehog-GLI signaling drives self-renewal and tumorigenicity of human melanoma-initiating cells. Stem Cells 2012; 30: 1808-1818. 2. Pandolfi S, Montagnani V, Penachioni JY, Vinci MC, Olivito B, Borgognoni L et al. WIP1 phosphatase modulates the Hedgehog signaling by enhancing GLI1 function. Oncogene 2013; 32: 4737-4747. SUPPLEMENTARY TABLES Supplementary Table 1. Melanoma cell lines used in this study. Sample Gender Age Patient-derived melanoma cells SSM1 M 55 SSM2c M 55 M3dx F 84 M26c F 79 M32 F 79 M33x F 66 M42 M 71 M51 F 36 Commercial melanoma cell lines A375 SK-Mel-2 SK-Mel-5 SK-Mel-28 501Mel MeWo a Typea Site Location Stage MM MM MM MM MM MM PM MM Skin Skin Lymph Node Lymph Node Skin Skin Trunk Trunk Groin Groin Leg Back Arm Armpit IIIB IIIB IIIC IV IIIC IIIC n.a. n.a. MM MM MM MM MM MM Skin Skin Lymph Node Skin Skin Lymph Node PM: Primary Melanoma; MM: Metastatic Melanoma; SSM1 and SSM2c were two different metastases from the same patient. In bold are indicated melanoma cells used for in vitro and in vivo functional experiments. SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Silencing of SMO or GLI2 reduces E2F1 levels in A375 cells. (a) Western blot analysis of GLI1, GLI2 and E2F1 in cells transduced with LV-c or LV-shSMO. -actin served as loading control. (b) Expression of GLI2, GLI1 and E2F1 in cells transduced with LV-c, LV-shGLI2-1 or LV-shGLI2-2 lentiviruses, measured by quantitative PCR. The y-axis represents expression ratio of gene/(EIF2+HPRT average). Data represent meanSEM of three independent experiments. *p<0.05. (c) Western blot analysis of GLI2 and E2F1 in cells transduced with LV-c or LV-shGLI2-1. -actin served as loading control. Supplementary Figure 2. Expression of GLI1, GLI2 and E2F1 in melanoma cells. (a) Western blot analysis of GLI1, GLI2 and E2F1 in a panel of six commercial and eight patient-derived melanoma cell lines (Supplementary Table 1). -actin served as loading control. (b) Quantitative PCR analysis of GLI1, GLI2 and E2F1 in a panel of six commercial and eight patient-derived melanoma cell lines. The y-axis represents expression ratio of gene/(EIF2+HPRT average). (c) Positive correlation between the levels of E2F1 and GLI1 in a panel of six commercial and eight patient-derived melanoma cell lines (R2=0.41866, p=0.016839). Supplementary Figure 3. GLI1 and GLI2 bind to E2F1 promoter in melanoma cells. (a-d) Chromatin immunoprecipitation (ChIP) assay showing that both endogenous GLI1 (a, c) and GLI2 (b, d) bind to PTCH1 and E2F1 promoters in SSM2c (a, b) and A375 (c, d) cells transduced with LV-c or LV-shPTCH1. The y-axis represents the relative promoter enrichment, normalized on input material. ACTIN promoter was used as negative control and set to 1. Supplementary Figure 4. E2F1 binds to its promoter in melanoma cells. (a) Sequence of E2F1 promoter and primers used for Chromatin immunoprecipitation (ChIP) analysis. (b) Chromatin immunoprecipitation (ChIP) assay of endogenous E2F1 in M26c, SSM2c and A375 cells transduced with LV-c or LV-shPTCH1. The y-axis represents the relative promoter enrichment, normalized on input material. ACTIN promoter was used as negative control and set to 1. Supplementary Figure 5. E2F1 silencing in melanoma cells. (a) Expression of E2F1 in SSM2c and M26c cells transduced with LV-c, LV-shE2F1-1 or LV-shE2F1-2 lentiviruses, measured by quantitative PCR. The y-axis represents expression ratio of gene/(EIF2+HPRT average). Data represent meanSEM of three independent experiments. *p<0.05. (b) Western blot analysis of E2F1 in SSM2c cells transduced with LV-c, LV-shE2F1-1 or LV-shE2F1-2 lentiviruses. HSP90 served as loading control. (c, d) Expression of E2F2, E2F3A and E2F4 in SSM2c (c) and M26c (d) cells transduced with LV-c, LV-shE2F1-1 or LV-shE2F1-2 lentiviruses, measured by quantitative PCR. The y-axis represents expression ratio of gene/(EIF2+HPRT average). Data represent meanSEM of three independent experiments. *p<0.05. Supplementary Figure 6. Expression of GLI1 and E2F1 in melanoma cells. Expression of GLI1 and E2F1 in M26c cells transduced as indicated, measured by quantitative PCR. The y-axis represents expression ratio of gene/(EIF2+HPRT average). Data represent meanSEM of three independent experiments. *p<0.05. Supplementary Figure 7. Proliferation index and cell cycle analysis in melanoma cells. (a, c) Proliferation index of M26c (a) and SSM2c (c) cells transduced with the indicated lentiviruses. The data represent meanSEM of three independent experiments. *p<0.05. (b, d, e) Cell cycle distribution of M26c (b), SSM2c (d) and A375 (e) cells transduced with the indicated lentiviruses. The data represent meanSEM of three independent experiments. *p<0.05. Note that SSM2c cells have an higher fraction of cells in S-phase, which could account for the higher apoptotic sensitivity (Figure 3c). Supplementary Figure 8. Expression p53 pro-apoptotic target genes PIG3 and p53AIP1 in melanoma cells. Quantitative PCR analysis of endogenous PIG3 and p53AIP1 expression in SSM2c and A375 cells transduced with the indicated lentiviruses. The y-axis represents expression ratio of gene/(EIF2+HPRT average). Data represent meanSEM of three independent experiments. *p<0.05. Supplementary Figure 9. Validation of anti-iASPP antibodies and iASPP protein expression in melanoma cells. (a) Western blot analysis of iASPP in M26c cells transduced with LV-c or LVshiASPP using C-terminal or N-terminal antibodies. Note that the C-terminal antibody recognizes three specific bands which are markedly decreased by iASPP silencing, whereas the N-terminal antibody detects only one specific band, at the same molecular weight of the main band of the Cterminal antibody. HSP90 served as loading control. M, marker. (b) Western blot analysis of iASPP in M26c cells treated/transduced as indicated. -actin served as loading control. (c) Western blot analysis of iASPP in nuclear (N) and cytoplasmic (C) fractions in M26c cells. Fibrillarin and GAPDH served, respectively, as nuclear and cytoplasmic loading controls. (d) Western blot analysis of iASPP and CyclinB1 in a panel of six commercial and eight patient-derived melanoma cell lines (Supplementary Table 1). -actin served as loading control. Supplementary Figure 10. E2F1 binds to iASPP promoter in melanoma cells. (a) Sequence of iASPP promoter and primers used for Chromatin immunoprecipitation (ChIP) analysis. (b) ChIP assay of endogenous E2F1 in A375 cells transduced with LV-c or LV-shPTCH1. The y-axis represents the relative promoter enrichment, normalized on input material. ACTIN promoter was used as negative control and set to 1. Supplementary Figure 11. Expression of iASPP in SSM2c and A375 cells transduced as indicated, measured by quantitative PCR. The y-axis represents expression ratio of gene/(EIF2+HPRT average). Data represent meanSEM of three independent experiments. *p<0.05. Supplementary Figure 12. E2F1 binds to CDK1 promoter in melanoma cells. (a) Sequence of CDK1 promoter and primers used for Chromatin immunoprecipitation (ChIP) analysis. (b) ChIP assay of endogenous E2F1 in A375 cells transduced with LV-c or LV-shPTCH1. The y-axis represents the relative promoter enrichment, normalized on input material. ACTIN promoter was used as negative control and set to 1. Supplementary Figure 13. E2F1 silencing does not abolish the effects of HH pathway activation in melanoma cancer stem cell self-renewal. (a,b) Self-renewal assay (secondary sphere formation) in M26c (a) and SSM2c (b) melanoma spheres transduced as indicated. Data represent meanSEM of three independent experiments. *p<0.05. (c) Representative melanoma spheres of (a). Bar=100m.
