* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download 13.2 – Manipulating DNA
Survey
Document related concepts
Transcript
13.2 – Manipulating DNA Interest Grabber Section 13-2 The Smallest Scissors in the World Have you ever used your word processor’s Search function? You can specify a sequence of letters, whether it is a sentence, a word, or nonsense, and the program scrolls rapidly through your document, finding every occurrence of that sequence. How might such a function be helpful to a molecular biologist who needs to “search” DNA for the right place to divide it into pieces? Interest Grabber continued Section 13-2 1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find? Go to Section: Section Outline Section 13-2 13–2 Manipulating DNA A. The Tools of Molecular Biology 1. DNA Extraction 2. Cutting DNA 3. Separating DNA B. Using the DNA Sequence 1. Reading the Sequence 2. Cutting and Pasting 3. Making Copies Go to Section: The Tools of Molecular Biology Genetic engineering – making changes in the DNA code of a living organism DNA extraction – by a simple chemical procedure Cutting DNA – most DNA to large to be analyzed Can be cut precisely at restriction enzymes Separating DNA – gel electrophoresis Gel Electrophoresis DNA plus restriction enzyme Power source Longer fragments Shorter fragments Mixture of DNA fragments Gel The setup Restriction Enzymes Section 13-2 Recognition sequences DNA sequence Restriction enzyme EcoRI cuts the DNA into fragments. Go to Section: Sticky end Restriction Enzymes Section 13-2 Recognition sequences DNA sequence Restriction enzyme EcoRI cuts the DNA into fragments. Go to Section: Sticky end Using the DNA Sequence After the DNA is shortened up it can now be read, studied and even changed The function of different genes can now be discovered Reading the sequence http://www.dnai.org/b/index.html Small pieces of single-strand DNA are “tagged” with fluorescent dye Using gel-electrophoresis, the fragments are separated The pattern of the colored bands tells the exact sequence of bases in the DNA Cutting and Pasting DNA sequences can be changed in many ways Short sequences can be “synthesized” and joined with “natural” DNA and spliced together using enzymes The same enzymes can join a gene from one organism and attach it to the DNA of another Recombinant DNA- DNA molecules produced by combining DNA from different sources Knockout Genes Section 13-3 Recombinant DNA Flanking sequences match host Host Cell DNA Target gene Recombinant DNA replaces target gene Modified Host Cell DNA Go to Section: Making Copies What is PCR? Sometimes called "molecular photocopying," the polymerase chain reaction (PCR) is a fast and inexpensive technique used to "amplify" - copy - small segments of DNA. Because significant amounts of a sample of DNA are necessary for molecular and genetic analyses, studies of isolated pieces of DNA are nearly impossible without PCR amplification. Often heralded as one of the most important scientific advances in molecular biology, PCR revolutionized the study of DNA to such an extent that its creator, Kary B. Mullis, was awarded the Nobel Prize for Chemistry in 1993. What is PCR used for? Once amplified, the DNA produced by PCR can be used in many different laboratory procedures. For example, most mapping techniques in the Human Genome Project (HGP) rely on PCR. PCR is also valuable in a number of newly emerging laboratory and clinical techniques, including DNA fingerprinting, detection of bacteria or viruses (particularly AIDS), and diagnosis of genetic disorders Figure 13-8 PCR Section 13-2 DNA polymerase adds complementary strand DNA heated to separate strands DNA fragment to be copied http://www.dnai.org/b/index.html Go to Section: PCR cycles 1 2 3 4 5 etc. DNA copies 1 2 4 8 16 etc. Interest Grabber Section 13-3 Sneaking In You probably have heard of computer viruses. Once inside a computer, these programs follow their original instructions and override instructions already in the host computer. Scientists use small “packages” of DNA to sneak a new gene into a cell, much as a computer virus sneaks into a computer. Go to Section: Interest Grabber continued Section 13-3 1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory? 2. Why would a person download a virus program? 3. If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA? Go to Section: Section Outline Section 13-3 13–3 Cell Transformation A. Transforming Bacteria B. Transforming Plant Cells C. Transforming Animal Cells Go to Section: Cell Transformation During transformation, a cell takes in DNA from outside the cell This external DNA becomes part of the cell’s DNA Transforming Bacteria Use recombinant DNA Figure 13-9 Making Recombinant DNA Section 13-3 Recombinant DNA Gene for human growth hormone Gene for human growth hormone Human Cell Sticky ends DNA recombination DNA insertion Bacterial Cell Bacterial chromosome Plasmid http://www.dnai.org/b/index.html Go to Section: Bacterial cell for containing gene for human growth hormone Plant Transformation Agrobacterium tumefaciens – Causes plant tumors. Figure 13-10 Plant Cell Transformation Section 13-3 Tumor causing bacteria Agrobacterium tumefaciens Gene to be transferred Recombinant plasmid Cellular DNA Inside plant cell, Agrobacterium inserts part of its DNA into host cell chromosome Plant cell colonies Transformed bacteria introduce plasmids into plant cells Complete plant is generated from transformed cell http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120078/bio40.swf::The%20Ti%20Plasmid Go to Section: 13.4 – Applications of Genetic Engineering Interest Grabber Section 13-4 The Good With the Bad The manipulation of DNA allows scientists to do some interesting things. Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms. Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey. Go to Section: Interest Grabber continued Section 13-4 1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system? 2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild? Go to Section: Flowchart Section 13-4 Cloning A body cell is taken from a donor animal. An egg cell is taken from a donor animal. The nucleus is removed from the egg. The body cell and egg are fused by electric shock. The fused cell begins dividing, becoming an embryo. The embryo is implanted into the uterus of a foster mother. The embryo develops into a cloned animal. Go to Section: Figure 13-13 Cloning of the First Mammal Section 13-4 A donor cell is taken from a sheep’s udder. Donor Nucleus Egg Cell These two cells are fused using an electric shock. Fused Cell Cloned Lamb Go to Section: The nucleus of the egg cell is An egg cell The fused removed. is taken from cell begins an adult dividing female normally. sheep. Embryo The embryo The embryo is develops normally Foster into a lamb—Dolly Mother placed in the uterus of a foster mother. Transgenic Organisms Transgenic Organisms – contain genes from other organisms These are produced by genetic engineering Have helped bacteria produce things like insulin, growth hormone, and clotting factors that were once very expensive Allowed animals immune system to act more like humans which allows them to study effects of disease Can grow animals that are more lean Cloning Clone – member of a population of genetically identical cells produced from a single cell Bacteria can be cloned quite easily In 1997, a Scottish scientist (Ian Wilmut) announced he had cloned a sheep - Dolly Cloning of the First Mammal A donor cell is taken from a sheep’s udder. Donor Nucleus These two cells are fused using an . electric shock Fused Cell Egg Cell An egg cell is taken from an adult female sheep. The nucleus of the egg cell is removed. The fused cell begins dividing normally. Embryo Cloned Lamb The embryo develops normally into a lamb—Dolly Foster Mother The embryo is placed in the uterus of a foster mother. Injaz the Camel April 2009 in Dubai Carbon Copy Cat Cc surprised many when she was born and did not look or act exactly like the genetic mother Daisy the Cow Daisy in July of 1999 Dolly Snuppy Human Cloning In 2005 the UN approved a non-binding global ban on human cloning In US it is legal for non-embryonic stem cell research under certain regulations