Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Activities of RNA Polymerase •sequence specific DNA binding -promoters •melts DNA to reveal the template strand •selects ribonucleotide (not deoxynucleotides) that anneals to template strand •polymerizes RNA strand •translocates on DNA template, during which it must: -unwind DNA in front of polymerase -unwinds RNA:DNA hybrid -rewinds DNA behind polymerase •recognize termination signals in the nascent transcript (or on the DNA template) •In addition, the polymerase must be processive (have a high probability of reaching the end of the gene) Modular Organization of Regulatory Information via Multiple Enhancers QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture. stripes of ftz and eve expression in a Drosophila embryo fragments of eve regulatory were inserted upstream of a -Gal reporter and inserted into flies. different regulatory elements gave distinct patterns of -Gal (dark staining) expression. Normal eve expression is shown in red. 1 Stages of Transcription Promoter binding [closed complex] Open complex formation [open complex] Abortive initiation Promoter clearance Elongation Robert Roeder today collecting sea urchin embryos 1968 Keys to Successful Protein Purification -an abundant source of material -a quantitative assay -must be able determine yield and purity -a strategy for separation -charge -size -hydrophobicity -stability -affinity reagents Roeder’s Assay, Incorporation of 32Plabeled UTP into RNA he could measure the amount of radioactivity incorporated into RNA (vs that that remained associated with the UTP) QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture. 32 note that the phosphate is incorporated into the RNA Three Different RNA Polymerases in Eukaryotes (Roeder and Rutter, 1969) functional group on column: QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. DEAE-Sephadex polymerase activity (32P incorporation into RNA) protein (measured by UV light absorbance in a spectrophotometer) [salt] (50mM KCl -400 mM) RNA Polymerases I, II, and III Exhibit Different Sensitivities % Maximum activity towards -Amanitin QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Amanita phalloides QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. -Amanitin (g/ml) Eukaryotic Nuclear RNA Polymerases Enzyme location relative activity -amanitin sensitivity Pol I nucleolus 50-70% not inhibited Pol II nucleoplasm 20-40% inhibited Pol III nucleoplasm ≈10% species-specific All three polymerase classes.... weigh >500,000 D contain 12-16 subunits - some conserved across evolution ’ - like (~200,000 D) - like (~140,000 D) - like (~40,000 D) - some shared among all 3 polymerases - some unique Three Classes of Transcription in Eukaryotes RNA polymerase I (pol I) ribosomal RNAs (5.8S, 18S, 28S rRNA) RNA polymerase II (pol II) mRNAs some small nuclear RNAs (snRNAs) non-coding RNAs (mostly of unknown function) RNA polymerase III (pol III) tRNAs 5S RNA some snRNAs small cytoplasmic RNAs (scRNAs) RNA Polymerase II Underlies the Central Dogma of Molecular Biology Pol I DNA Pol II Pol III 45S rRNA mRNA Ribosome tRNA 5S rRNA this explains our emphasis on the mechanisms of Pol II transcription Protein QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Roger Kornberg (1947) (With wife and sons, Stockholm Dec. 2006) Important things to know about Pol II • • • The general architecture of the polymerase, including the arrangement of nucleic acids in the active site That nucleotides likely enter through the “funnel” That the polymerase is a catalyst that specifically accelerates the rate at which the correctly paired ribonucleotide is added to a growing RNA chain (the exact details of the proposed reaction mechanism are not important to know) – Review, but don’t feel obligated to memorize the exact details of the role of the trigger loop in facilitating catalysis and substrate (I.e. nucleotide) selection • That the polymerase must be able to translocate on the DNA template after it has added a nucleotide to the RNA Crystal Structure of Yeast RNA Polymerase II at 2.8 Å Resolution (Cramer et al, 2001) QuickTime™ and a YUV420 codec decompressor are needed to see this picture. RNA Pol II (S. cerevisiae) RNAP (T. aquaticus) Rpb2 QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. ’ Rpb1 What is Required for Promoter Function? cis (DNA sequences) vs trans (proteins) identify cis elements by, conservation, mutagenesis and assays of transcription identify trans factors by biochemical (mainly) and genetic (occasionally) approaches Assays of Promoter Activity in vitro - use a specific promoter - mix with NTPs and extract or purified factors - measure RNA (directly, with 32P-labeled NTPs or indirect assays, see Weaver pp 106-111) in vivo - introduce gene of interest into cells transformation (yeast and bacteria) transfection (cultured cells) - fuse promoter to a reporter gene that can be differentiated from normal genes in the recipient cells “reporter gene” - can collect and measure RNA from cells - can measure activity of reporter gene beta-Gal, selectable markers Identifying Promoter Elements • • • Deletion mutations Linker scanning Point mutations lin k e r i n s e r t io n m u ta g e n e s is tx n del et io n mu tag en es is + tx n + + - + + - - p o in t m u ta tio n s + sca nn in g de let io n mu ta ge nes is X + X + X + X - + - Class II Promoters Several parts: – Core promoter – Upstream promoter elements – Enhancers, may be far from core promoters gene specific sequence elements found in many core promoters Core Promoter Elements • In addition to TATA box, core promoters are: – TFIIB recognition element (BRE) – Initiator (Inr) – Downstream promoter element (DPE) – note: the important thing to remember is the TATA box • At least one of the four core elements is missing in most promoters • TATA-less promoters tend to have DPEs • Promoters for highly specialized genes tend to have TATA boxes • Promoters for housekeeping genes tend to lack them Upstream Elements • Upstream promoter elements are usually found upstream of class II core promoters • Differ from core promoters in binding to relatively gene-specific transcription factors. examples: – GC boxes bind transcription factor Sp1 – CCAAT boxes bind CTF (CCAAT-binding transcription factor) • Enhancers, function in a position and orientation independent manner. (sometimes enhancers are considered to be a distinct type of element) A Typical RNA Pol II Promoter -2000 -1500 -1000 enhancers AP4 AP1 AP3 -200 -150 -100 -50 upstream elements +1 50 100 core promoter AP2 CCAGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCT T ATA-box Inr CAGAGCATATAAGGTGAGGTAGGATCAGTTGCTCCTCACCTT -30 -20 -10 +1 GC-box CAAT -box CGTAGAGCCACACCCTGGTAAGGGCCAATCTGCTCAC -100 -90 -80 -70 Identifying the General Transcription Machinery • establish robust in vitro assay with a strong core promoter – AdML adenovirus major late promoter • purify proteins required for transcription • goal is to identify a minimal set of purified proteins with which to reconstitute transcription QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Fork loop 2 What is Required for Promoter Function? Observation: RNA polymerase alone is not capable of accurately initiated, gene-specific transcription. cis (DNA sequences) vs trans (proteins) identify cis elements by, conservation, mutagenesis and assays of transcription -core promoter (esp. TATA box) -upstream elements -enhancers identify trans factors by biochemical (mainly) and genetic (occasionally) approaches -general transcription factors (GTFs) -accessory factors required at all genes transcribed by a polymerase Identifying the General Transcription Machinery • establish robust in vitro assay with a strong core promoter – AdML adenovirus major late promoter • purify proteins required for transcription • goal is to identify a minimal set of purified proteins with which to reconstitute transcription RNA Polymerase II Requires Additional Factors for Accurate Transcription Initiation at Promoters (Matsui et al, 1980) Phosphocellulose chromatography QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. Further Fractionation of S-100 Extract (Matsui et al, 1980) QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. RNA polymerase II Transcription Machinery Number of subunits Pol II 12 GTFs TFIID TFIIB TFIIE TFIIH TFIIF TFIIA* Mediator TBP TAFs * 1 12 1 2 9 2 3 22 Proposed Pathway of Initiation Pol II-TFIIF recruited by DNA-D/A/B complex QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. helicases in TFIIH catalyze open complex formation initiation and escape Mechanism of Initiation of RNA Polymerase II Transcription Factor Pol Pol H H F TBP BN Role BBCCTBP TBP Promoter recognition; configures DNA to the pol II surface TFIIB Promoter recognition; pol II recruitment; directs DNA path, stabilizes early transcribing complex; coupling of RNA synthesis to promoter clearance TFIIE Recognizes closed complex, recruits TFIIH TFIIF Captures nontemplate strand upon melting TFIIH Untwisting of promoter DNA (helicase), CTD phosphorylation (kinase) Transcription Elongation ...is slow compared to DNA replication 20-40 nucleotides / second Typical 1° transcript is ≈20,000 nts., corresponds to ≈10 minutes / transcript. Long transcripts can take hours to complete … is regulated TFIIF suppresses pausing TFIIS rescues arrested complexes others …. polymerases stalled at the 5’ ends of genes appear to be common ...may involve proof-reading (observed in vitro) ...is coupled to DNA repair Activating domains can be replaced by randomly selected sequences (Ma and Ptashne, 1986) beta-gal activity Q. what are the essential features of activation domains? Approach: random e. coli sequences cloned downstream of Gal4 DBD and expressed in yeast containing a -gal reporter with Gal4 sites in its promoter activator -gal +gal Gal4 111 1895 Gal4DBD <1 <1 none <1 <1 B17 415 794 B42 542 756 B6 429 588 B9 21 9.3 B15 90 73 16 Activating domains can be replaced by randomly selected sequences (Ma and Ptashne, 1986) 1. random e. coli sequences cloned downstream of the Gal4 DBD and expressed in a yeast strain containing a -gal reporter with Gal4 sites in its promoter 2. ~1% of all the clones activated transcription 3. activating sequences did not resemble known proteins, no catalytic domains etc. -activation domains unlikely to have enzymatic activity 4. negatively charged residues common 17 Overexpression of Gal4 from the strong ADH promoter inhibits promoters that lack Gal4 binding sites (Gill and Ptashne, 1988) HIS3 +1 core +12 UASH/core -Gal QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. UASG= GAL enhancer (binds Gal4) UASH= HIS3 enhancer UASC= CYC1 enhancer decreased expression of reporter genes lacking Gal4 binding sites when Gal4 levels are high 18 Activator Interference or ‘Squelching’ activator B activator A UAS TATA box 19 Activator Interference or ‘Squelching’ activator B activator A UAS TATA box hypothesis? 20 What is the Limiting Target of Activators? 1. Eukaryotic activators do not bind to RNA pol II polymerase and therefore do not directly recruit polymerase to promoters. 2. Activators may, however, indirectly recruit RNA polymerase by recruiting factors (often called co-activators) that serve as a physical bridge between activator and polymerase. ‘TFIID hypothesis’ ‘Holoenzyme hypothesis’ 21 ChIP (Chromatin Immunoprecipitation) TBP Formaldehyde crosslink QuickTime™ and a TIFF (LZW) decompress or are needed to s ee this pic ture. Shear chromatin by sonication Immunoprecipitation TBP TBP TBP Reverse crosslinks, PCR input control: reverse crosslinks and analyze sample prior to IP 22 Extent of TBP binding correlates with promoter activity (Li et al, 1999) TBP crosslinks to active promoters QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. 23 RNA Polymerase II Transcription Machinery Number of subunits Pol II 12 GTFs TFIID TFIIB TFIIE TFIIH TFIIF TFIIA* Mediator TBP TAFs * 1 12 1 2 9 2 3 22 24 The ‘TFIID Hypothesis’ QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. 1. TAFs provide surfaces for the interaction of TFIID with activators. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. QuickTime™ and a TIFF (LZW) decompressor are needed to see this picture. 2. TFIID recruits polymerase in vitro assays suggest specific activator-TAF contacts predictions? 25 Activated Transcription in the Absence of TAFIIs Oelgeschlager et al., 1998 western blot demonstrating depletion of TAFIIs see p97 of Weaver or p769 of Watson for a description of the Western blot technique in vitro transcription shows that - transcription is abolished in the TFIID depleted extract - TBP is sufficient to restore activated transction - 4 different activators were tested no transcription after depletion of TFIID and TAFs 26