* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download CS273_SequenceSimilarity1
Interactome wikipedia , lookup
Magnesium transporter wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Gene expression wikipedia , lookup
Western blot wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Biosynthesis wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genetic code wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Point mutation wikipedia , lookup
Proteolysis wikipedia , lookup
Sequence Similarity Why sequence similarity structural similarity >25% sequence identity similar structure evolutionary relationship all proteins come from < 2000 (super)families related functional role similar structure similar function functional modules are often preserved Muscle cells and contraction Actin and myosin during muscle movement Actin structure Actin sequence • Actin is ancient and abundant Most abundant protein in cells 1-2 actin genes in bacteria, yeasts, amoebas Humans: 6 actin genes • -actin in muscles; -actin, -actin in non-muscle cells • ~4 amino acids different between each version MUSCLE ACTIN Amino Acid Sequence 1 61 121 181 241 301 361 EEEQTALVCD GILTLKYPIE MFETFNVPAM RDLTDYLMKI PDGQVITIGN TTMYPGIADR DESGPSIVHR NGSGLVKAGF HGIITNWDDM YVAIQAVLSL LTERGYSFVT ERFRGPETMF MQKEITALAP KCF AGDDAPRAVF EKIWHHTFYN YASGRTTGIV TAEREIVRDI QPSFIGMESS STMKIKIIAP PSIVRPRHQG ELRVAPEEHP LDSGDGVSHN KEKLCYVALD GVHETTYNSI PERKYSVWIG VMVGMGQKDS VLLTEAPLNP VPIYEGYALP FEQEMATAAS MKCDIDIRKD GSILASLSTF YVGDEAQSKR KANREKMTQI HAIMRLDLAG SSSLEKSYEL LYANNVLSGG QQMWITKQEY A related protein in bacteria Relation between sequence and structure A multiple alignment of actins Gene expression DNA CCTGAGCCAACTATTGATGAA transcription RNA CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE Biomolecules as Strings • Macromolecules are the chemical building blocks of cells Proteins • 20 amino acids Nucleic acids • 4 nucleotides {A, C, G, ,T} Polysaccharides The information is in the sequence • Sequence Structure Function • Sequence similarity Structural and/or Functional similarity • Nucleic acids and proteins are related by molecular evolution Orthologs: two proteins in animals X and Y that evolved from one protein in immediate ancestor animal Z Paralogs: two proteins that evolved from one protein through duplication in some ancestor Homologs: orthologs or paralogs that exhibit sequence similarity Protein Phylogenies • Proteins evolve by both duplication and species divergence duplication orthologs paralogs Evolution Evolution at the DNA level Deletion Mutation …ACGGTGCAGTTACCA… …AC - - - - CAGTCACCA… REARRANGEMENTS Inversion Translocation Duplication SEQUENCE EDITS Evolutionary Rates next generation OK OK OK Changes in non-functional sites are OK, so will be propagated X X Still OK? Most changes in functional sites are deleterious and will be rejected Sequence conservation implies function Proteins between humans and rodents are on average 85% identical Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Definition Given two strings x = x1x2...xM, y = y1y2…yN, an alignment is an assignment of gaps to positions 0,…, M in x, and 0,…, N in y, so as to line up each letter in one sequence with either a letter, or a gap in the other sequence What is a good alignment? Alignment: The “best” way to match the letters of one sequence with those of the other How do we define “best”? Alignment: A hypothesis that the two sequences come from a common ancestor through sequence edits Parsimonious explanation: Find the minimum number of edits that transform one sequence into the other Scoring Function • Sequence edits: AGGCCTC Mutations AGGACTC Insertions AGGGCCTC Deletions AGG–CTC Scoring Function: Match: +m Mismatch: –s Gap: –d Score F = (# matches) m – (# mismatches) s – (#gaps) d How do we compute the best alignment? AGTGCCCTGGAACCCTGACGGTGGGTCACAAAACTTCTGGA AGTGACCTGGGAAGACCCTGACCCTGGGTCACAAAACTC Too many possible alignments: O( 2M+N) Alignment is additive Observation: The score of aligning x1……xM y1……yN is additive Say that aligns to x1…xi y1…yj xi+1…xM yj+1…yN The two scores add up: F(x[1:M], y[1:N]) = F(x[1:i], y[1:j]) + F(x[i+1:M], y[j+1:N]) Key property: optimal solution to the entire problem is composed of optimal solutions to subproblems – Dynamic Programming Dynamic Programming Construct a DP matrix F: MxN: Suppose we wish to align x1……xM y1……yN Let F(i, j) = optimal score of aligning x1……xi y1……yj Dynamic Programming (cont’d) Notice three possible cases: 1. 2. 3. xi aligns to yj x1……xi-1 xi y1……yj-1 yj F(i, j) = F(i-1, j-1) + m, if xi = yj -s, if not xi aligns to a gap x1……xi-1 xi y1……yj - F(i, j) = F(i-1, j) – d yj aligns to a gap x1……xi y1……yj-1 yj F(i, j) = F(i, j-1) – d Dynamic Programming (cont’d) • How do we know which case is correct? Inductive assumption: F(i, j – 1), F(i – 1, j), F(i – 1, j – 1) are optimal Then, F(i, j) = max Where F(i – 1, j – 1) + s(xi, yj) F(i – 1, j) – d F(i, j – 1) – d s(xi, yj) = m, if xi = yj; -s, if not Example x = AGTA y = ATA F(i,j) m= 1 s = -1 d = -1 i=0 0 j=0 1 2 3 4 A G T A -1 -2 -3 -4 1 A -1 1 0 -1 -2 2 T -2 0 0 1 0 3 A -3 -1 -1 0 2 Optimal Alignment: F(4, 3) = 2 AGTA A - TA The Needleman-Wunsch Algorithm 1. 2. Initialization. a. b. c. F(0, 0) F(0, j) F(i, 0) = 0 =-jd =-id Main Iteration. Filling-in partial alignments a. For each For each i = 1……M j = 1……N F(i, j) Ptr(i,j) 3. = max = F(i-1,j-1) + s(xi, yj) F(i-1, j) – d F(i, j-1) – d DIAG, LEFT, UP, Termination. F(M, N) is the optimal score, and from Ptr(M, N) can trace back optimal alignment if [case 1] if [case 2] if [case 3] [case 1] [case 2] [case 3] Performance • Time: O(NM) • Space: O(NM) • Possible to reduce space to O(N+M) using Hirschberg’s divide & conquer algorithm Substitutions of Amino Acids Mutation rates between amino acids have dramatic differences! How can we quantify the differences in rates by which one amino acid replaces another across related proteins? Substitution Matrices BLOSUM matrices: 1. 2. 3. Start from BLOCKS database (curated, gap-free alignments) Cluster sequences according to > X% identity Calculate Aab: # of aligned a-b in distinct clusters, correcting by 1/mn, where m, n are the two cluster sizes 4. Estimate P(a) = (b Aab)/(c≤d Acd); P(a, b) = Aab/(c≤d Acd) Gaps are not inserted uniformly A state model for alignment M (+1,+1) Alignments correspond 1-to-1 with sequences of states M, I, J I (+1, 0) J (0, +1) -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--TAG-CTATCAC--GACCGC-GGTCGATTTGCCCGACC IMMJMMMMMMMJJMMMMMMJMMMMMMMIIMMMMMIII Let’s score the transitions s(xi, yj) M (+1,+1) s(xi, yj) Alignments correspond 1-to-1 with sequences of states M, I, J -d -e I (+1, 0) s(xi, yj) -d J (0, +1) -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--TAG-CTATCAC--GACCGC-GGTCGATTTGCCCGACC IMMJMMMMMMMJJMMMMMMJMMMMMMMIIMMMMMIII -e A probabilistic model for alignment Assign probabilities to every transition (arrow), and emission (pair of letters or gaps) • Probabilities of mutation reflect amino acid similarities • Different probabilities for opening and extending gap M (+1,+1) I (+1, 0) J (0, +1) -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--TAG-CTATCAC--GACCGC-GGTCGATTTGCCCGACC IMMJMMMMMMMJJMMMMMMJMMMMMMMIIMMMMMIII A Pair HMM for alignments log(1 – 2) M log(1 – ) P(xi, yj) log log I P(xi) log Prob(xi, yj) log(1 – ) log log J P(yj) Highest scoring path corresponds to the most likely alignment! How do we find the highest scoring path? • Compute the following matrices (DP) M(i, j): I(i, j): J(i, j): most likely alignment of x1…xi with y1…yj ending in state M most likely alignment of x1…xi with y1…yj ending in state I most likely alignment of x1…xi with y1…yj ending in state J log(1 – 2) M(i, j) = log( Prob(xi, yj) ) + max{ M(i-1, j-1) + log(1-2), I(i-1, j) + log(1-), J(i, j-1) + log(1-) } log(1 – ) log I(i, j) = max{ M(i-1, j) + log , I(i-1, j) + log } M P(xi, yj) log(1 – ) log I P(xi) log Prob(xi, yj) log J P(yj) log The Viterbi algorithm for alignment • For each i = 1, …, M For each j = 1, …, N M(i, j) = log( Prob(xi, yj) ) + max { M(i-1, j-1) + log(1-2), I(i-1, j) + log(1-), J(i, j-1) + log(1-) } I(i, j) = max { M(i-1, j) + log , I(i-1, j) + log } J(i, j) = max { M(i-1, j) + log , I(i-1, j) + log } When matrices are filled, we can trace back from (M, N) the likeliest alignment One way to view the state paths – State M y1 x1 …… xm …… yn State I y1 x1 …… xm …… yn State J y1 x1 …… xm …… yn Putting it all together States I(i, j) are connected with states J and M (i-1, j) x1 States J(i, j) are connected with states I and M (i-1, j) …… States M(i, j) are connected with states J and I (i-1, j-1) xm y1 …… yn Putting it all together States I(i, j) are connected with states J and M (i-1, j) x1 States J(i, j) are connected with states I and M (i-1, j) …… States M(i, j) are connected with states J and I (i-1, j-1) Optimal solution is the best scoring path from top-left to bottom-right corner xm This gives the likeliest alignment according to our HMM y1 …… yn Yet another way to represent this model Ix BEGIN Iy Ix Iy Mx1 END Mxm Sequence X We are aligning, or threading, sequence Y through sequence X Every time yj lands in state xi, we get substitution score s(xi, yj) Every time yj is gapped, or some xi is skipped, we pay gap penalty