Download Nucleic Acids & Protein Synthesis

Unit4 – Lecture3
DNA
 DNA = De-oxy-ribo-nucleic Acid
 “blueprint” for traits
 double helix shape
 composition:


polymer of nucleotide monomers
nucleotide [3 parts]:
 sugar [deoxyribose]
 phosphate
 nitrogen base
Nitrogen Bases
 Nitrogen Bases:
 are complementary:




adenine [A] bonds with
thymine [T]
cytosine [C] bonds with
guanine [G]
Nitrogen Bases – cont’d
 Nitrogen Bases:
 amount of A = amount of T
 amount of C = amount of G
 purines: A & G
 pyrimidines: C & T
Discuss
 With what you just learned, find the answer to the
following math problem:
If your cells contained 12% adenine,
how much of each of the other
nitrogen bases do your cells contain?
Discuss
If your cells contained 12% adenine, how much
of each of the other nitrogen bases do your cells contain?
if A = 12% then T = 12%
total = 24% A&T
100% - 24% = amount of C&G
76% = amount of C&G
76 / 2 = amount of C or amount of G
C = 38%, G = 38%
DNA – cont’d
 Watson & Crick [1953]
 proposed the structure of DNA
 stole the work of Rosalind Franklin

X-Ray Crystallography
DNA Replication
 happens in the cell nucleus
 occurs during interphase
DNA Replication – cont’d
 enzyme unzips DNA double strand by breaking the
hydrogen bonds between bases
 free-floating bases bond to open DNA
DNA Replication – cont’d
 continues…
 end result = 2 strands, ½ new & ½ old DNA
 repeat.
RNA
 RNA – Ribo-nucleic Acid
 sugar = ribose [instead of deoxyribose]
 single stranded
 has nitrogen base Uracil instead of Thymine


A bonds with U
C bonds with G
Discuss
 Restate to your partner what the
three differences are between RNA and DNA.
RNA – cont’d
 [RNA]
 three types:

mRNA – messenger
 complementary to DNA
 ferries DNA’s message out of the nucleus
 contains codons
 codon – segment of three bases in mRNA
 1 codon = 1 amino acid or “start” or “stop”
 20-some of them exist
Codon Chart
RNA – cont’d
 [RNA]
 [three types:]


tRNA – transfer
 ferries amino acids to ribosome
 contains “anticodons”
 complementary to mRNA
rRNA – ribosomal
 makes up the ribosomes
RNA – cont’d
 [RNA]
 [three types:]

rRNA – ribosomal
 makes up the
ribosomes
Discuss
 Name and explain the
three types of rna to your partner.
Protein Synthesis
 transCription
 DNA  mRNA
 occurs in the nucleus
 process begins at
“promoter”
 promoter tells
where to start
copying DNA
sequence
Protein Synthesis
 transCription
 enzyme unzips DNA
but RNA bases pair
instead of DNA bases
 complementary
bases are added
Protein Synthesis
 transCription
 continue adding bases
until a “termination
sequence” is located.
 mRNA carries message
outside of the nucleus
through nuclear pores
into the cytoplasm
Protein Synthesis
 transLation
 mRNA  protein
 ribosomes read mRNA
and use tRNA to make
proteins
 steps:
Protein Synthesis
 transLation
 ribosomes clamp onto
mRNA strand
 finds “start” codon
[AUG]
 tRNA molecule
containing matching
anti-codon moves to
ribosome
 tRNA enters ribosome;
attaches to strand
Protein Synthesis
 transLation
 another tRNA enters
ribosome
 ribosome bonds amino
acids [peptide bond]
 first tRNA leaves,
another enters
 repeat until “stop”
codon is reached
Write this down!
Any nitrogen bases that are
BEFORE the “start”
or
AFTER the “stop”
are NOT translated
into amino acids.
Protein Synthesis
 transLation
 result – chain of amino
acids linked by peptide
bonds
 = polypeptide
 = protein
 polypeptide
processed and
shipped using ER &
Golgi.
Let’s Try It
CCATACGGTGTCTCCGATATTTTA
 is this DNA or RNA? how do you know?
 transcribe the DNA into mRNA
 CC AT ACGGTGTCT CCGAT ATTTT A
 GGUAUGCCACAGAGGCUAUAAAAU
 find the start codon [AUG]
 GGUAUGCCACAGAGGCUAUAAAAU
Let’s Try It
 GGUAUGCCACAGAGGCUAUAAAAU
 beginning with AUG, separate your
mRNA into codons.
 AUG/CCA/CAG/AGG/CUA/UAA/AAU
 beginning with your AUG, translate
your mRNA into amino acids
 keep translating until “stop” codon is reached
Codon Chart
Let’s Try It
 AUG/CCA/CAG/AGG/CUA/UAA/AAU
 MET / PRO / GLN / ARG / LEU / (stop)
