* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Chapter 12 DNA
Survey
Document related concepts
Transcript
DNA Also known as deoxyribonucleic acid History of DNA • In the mid 1900’s scientists started asking the question: – “How do genes work?” – Like many scientific stories, the discovery of DNA was an accident while a scientist was trying to find out something else Frederick Griffith • Griffith was working on what was causing the deadly disease pneumonia • Griffith isolated two separate strains: – A disease causing strain – A harmless strain Figure 12–2 Griffith’s Experiment Heat-killed, disease-causing bacteria (smooth colonies) Control Disease-causing Harmless bacteria Heat-killed, disease(no growth) bacteria (smooth (rough colonies) causing bacteria colonies) (smooth colonies) Dies of pneumonia Lives Lives Harmless bacteria (rough colonies) Dies of pneumonia Live, disease-causing bacteria (smooth colonies) Griffith’s Experiment • He found that mice injected with the disease-causing strain died of pneumonia • However, if he heated the diseasecausing strain and injected the mice with it they did not die at all • This suggested that the disease wasn’t caused by a chemical toxin released by the bacteria Griffith’s Experiment • When he injected mice with the heat killed diseasecausing bacteria they did not die – When he added the harmless bacteria to the heat killed bacteria they did develop pneumonia and die! Griffith’s Experiment • Somehow the heat killed bacteria passed on their ability to cause disease to the harmless strain!! • Griffith called this process transformation – one strain of bacteria changing into another Griffith’s Experiment • Griffith hypothesized that some “factor” was transferred from the heat-killed bacteria to the live, harmless bacteria • He hypothesized that this factor was a gene that the live bacteria obtained from the heat-killed bacteria Oswald Avery’s Experiment • In 1944 Avery repeated Griffith’s experiment – He changed it by creating an extraction of the “combined” bacteria and treating it with enzymes – These enzymes destroyed all of the proteins, fats, carbs, and RNA – Leaving only the DNA!! Oswald Avery’s Experiment • After he destroyed most of the organic components, transformation still occurred! • He performed it one more time: – This time he destroyed the DNA in the mixture – As he had guessed, the mice lived – He concluded that it was the DNA that was responsible for the disease Oswald Avery’s Experiment • Avery’s Conclusion: – DNA is the nucleic acid that stores and transmits genetic information from one generation of organism to the next Hershey-Chase Experiment • Alfred Hershey and Martha Chase wanted to explain Avery’s findings further – They worked with bacteriophages • “bacteria eater” • They attach to the outside of a bacterium and inject their DNA into the cell • The DNA instructs the cell to make copies of itself until the cell bursts with more bacteriophages Hershey-Chase Experiment • They put radioactive markers on the outside of the bacteriophage as well as on the DNA inside • These markers can be seen or followed during an experiment to determine which is left “inside” the bacterium to “infect” it Hershey-Chase Experiment Bacteriophage with phosphorus32 in DNA Phage infects bacterium Radioactivity inside bacterium Bacteriophage with sulfur-35 in protein coat Phage infects bacterium No radioactivity inside bacterium Hershey-Chase Experiment • Hershey and Chase concluded that the genetic material of the bacteriophage was DNA and not protein The Structure of DNA • DNA is a long molecule made up of nucleotides • Each nucleotide is made up of three parts: – A 5-carbon sugar called deoxyribose – A phosphate group – And a nitrogenous base The Nitrogenous Bases • There are 4 kinds of Nitrogenous Bases: – The Pyrimidines: • Cytosine • Thymine – The Purines: • Adenine • Guanine *the sugar phosphate forms the “backbone” of the molecule The Nucleotides Purines Pyrimidines Adenine Guanine Cytosine Thymine Phosphate group Deoxyribose 5-Carbon Sugar Chargaff’s Rules • According to Erwin Chargaff: – Adenine always pairs with Thymine – Cytosine always pairs with Guanine The Double Helix • James Watson and Francis Crick – Using the X-ray taken by Rosalind Franklin – And compiling data and research over many years – Watson and Crick “unlocked” the secret structure of DNA in 1953 • The building blocks of ALL life The Double Helix Nucleotide Hydrogen bonds Sugarphosphate backbone Key Adenine (A) Thymine (T) Cytosine(C) Guanine (G) • base pairing- hydrogen bonds forming only between certain “base pairs” Chromosomes and DNA Replication • DNA is the genetic material for the cell and the organism • It is found in the nucleus of Eukaryotic cells – If Prokaryote cells don’t have a nucleus, then where is the DNA stored? Chromosomes and DNA Replication • This E. coli bacterium has DNA but, it is compacted into the cytoplasm of the cell • Most bacteria have a single, circular DNA molecule – E. coli has 4,639,221 base pairs!!! Chromosome E. coli bacterium Bases on the chromosome Eukaryotic DNA • Eukaryotic DNA has as many as 1000 times more base pairs as Prokaryotic DNA – It exists in the nucleus of the cell in the form of chromosomes – How many chromosomes make up a diploid human cell? Eukaryotic DNA • How does the nucleus of a cell contain more than 1 meter of DNA? • Eukaryotic chromosomes contain DNA and protein in a substance called chromatin Eukaryotic DNA • Chromatin – DNA tightly coiled around proteins called histones • Nucleosome – DNA and histones forming a beadlike structure Chromosome Nucleosome DNA double Supercoils Coils Histones helix DNA Replication • The way that DNA is constructed allows for exact duplication • When DNA is separated one side can be “copied” because of base pairing DNA Replication • If you had a strand of DNA, but only one half of the strand, how would you create a complimentary strand? – Suppose you had the base pairs: • ATGCCCGTAATGTAACCGTTGAA • What would be the complimentary strand? DNA Replication • Replication – process by which DNA duplicates or “copies” itself – during replication the strand of DNA separates into two strands – While this is happening two new strands are being formed simultaneously – This occurs at the replication fork DNA Replication • DNA is “unzipped” by a special enzyme called DNA polymerase – The polymerase adds new nucleotides to pair with the “old” strand – It also proofreads it before it finishes to make sure there are no mistakes DNA Replication Original strand New strand DNA polymerase DNA polymerase Replication fork Replication fork Nitrogenous bases New strand Original strand Chapter 12 – 3 RNA and Protein Synthesis • At this point we all know that DNA provides the genetic code for all life on the planet • So, “how does it work?” • The key is it’s relationship with RNA – Ribonucleic acid RNA and Protein Synthesis • DNA is like a “library” of information in every cell of an organism • RNA would be the “person” reading the individual ‘books’ in the library – The manufacture of proteins is ESSENTIAL for the life of the organism! Structure of RNA • RNA is much like DNA in that it is a long chain of nucleotides There are THREE main differences: > the sugar in RNA is ribose > RNA is single stranded > RNA has Uracil in place of Thymine Three Types of RNA RNA can be Messenger RNA also called mRNA which functions to Carry instructions from DNA Ribosomal RNA also called rRNA to Ribosome which functions to Combine with proteins to make up Ribosomes Transfer RNA also called which functions to tRNA Bring amino acids to ribosome Transcription • Transcription is the process of “making” RNA molecules by creating a complimentary strand to a section of DNA • The enzyme responsible for “reading” the DNA code is RNA polymerase Transcription • During transcription, RNA polymerase attaches to the DNA and separates the strands • The RNA polymerase then uses one strand of DNA as a template to make complimentary nucleotides into a strand of mRNA Transcription Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) RNA polymerase RNA DNA Transcription • Promoters – specific sites where the RNA Polymerase binds to the strand of DNA to begin transcription RNA Editing • The “finished” mRNA strand has been edited before it goes to work • The pieces that are kept are called exons • The pieces that are “cut” are called introns The Genetic Code • Proteins are assembled in polypeptides – These are long chains of amino acids – There are 20 different types of amino acids – The properties of proteins are determined by which order these amino acids are joined The Genetic Code • mRNA is the key to the genetic code and it provides for the manufacture of all proteins in the body • A strand of mRNA is read three base pairs at a time – UCGAAGCUUACA would be ….. – UCG-AAG-CUU-ACA The Genetic Code •Each of these amino acids that mRNA “codes” for recognizes the three base pair sequence •A codon consists of three consecutive nucleotides that specify a single amino acid The Genetic Code •Along with the twenty amino acids there are “special” base pair sequences that “code for” start and stop codons •Stop codons are like the “period at the end of a sentence”. – They signify the end of a polypeptide The Genetic Code Translation • The decoding of a strand of mRNA into a protein is known as translation • At this point we have taken a strand of DNA and created a strand of mRNA by the process of transcription – DNA mRNA polypeptide chain – Polypeptide chain Protein • The next step is to make proteins!! Figure 12–18 Translation Messenger RNA : Messenger RNA is transcribed in the nucleus. Phenylalanine Methionine Nucleus Lysine tRNA mRNA Transfer RNA Ribosome mRNA Start codon Translation • As a strand of DNA is read during transcription a complimentary strand of RNA is made –TACAAGTTT (DNA) –AUGUUCAAA (RNA) Translation • That strand of RNA is known as mRNA and leaves the cell nucleus where it attaches to a ribosome • AUGUUCAAA (mRNA) Ribosome mRNA Start codon Translation • Each strand of mRNA is separated into three base pairs called codons •AUG —- UUC --- AAA (mRNA) •This is where transfer RNA comes in (tRNA) Translation • tRNA is responsible for getting the right anticodon with each of the mRNA codons • An amino acid is attached to each anticodon Lysine tRNA Ribosome mRNA Figure 12–18 Translation The Polypeptide “Assembly Line” The ribosome joins the two amino acids & breaks the bond between the tRNA & it’s amino acid Lysine Growing polypeptide chain Ribosome tRNA tRNA mRNA mRNA Ribosome Translation direction Completing the Polypeptide The process continues until the ribosome reaches one of the three stop codons. The result is a growing polypeptide chain. Translation • The ribosome acts like an assembly line worker and attaches each amino acid to the next one. • The ribosome also detaches the amino acid from it’s tRNA • This happens until a stop codon is reached and there is a long chain of amino acids (a polypeptide) Mutations • Mutations are changes in the DNA sequence that affect genetic information • Genetic mutations result from changes in a single gene • Chromosomal mutations involve changes in whole chromosomes Mutations • Mutations that only affect one nucleotide are called point mutations – Point mutations generally only affect one amino acid in the sequence THE DOG BIT THE CAT THE DOG BIT THE CAR Normal: AUG-AAG-GGC-UAA Protein: Met - Lys - Gly - Stop Normal: AUG-AAG-AGC-UAA Protein: Met - Lys - Ser - Stop Mutations • Frameshift mutations are much more dangerous to the genetic code! • They occur when a nucleotide is added (inserted) or deleted • This “shifts” the reading frame of the gene THE DOG BIT THE CAT ** What happens if you remove the “G” in DOG THE DOB ITT HEC AT **The same would happen if you added a letter Gene Mutations: Substitution, Insertion, and Deletion Substitution Insertion Deletion Mutations can be very dangerous and VERY SCARY!! Mutations • Chromosomal mutations involves the change in the number or structure of chromosomes • There are Four Types: – Deletion – the loss of all or part of a chromosome – Duplication – when a segment of a chromosome is repeated – Inversion – When part of a chromosome becomes oriented in the reverse direction – Translocation – when part of a chromosome breaks off and attaches to another Chromosomal Mutations Deletion Duplication Inversion Translocation THE END