* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Slide 1
Endogenous retrovirus wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Non-coding DNA wikipedia , lookup
Proteolysis wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Metalloprotein wikipedia , lookup
Biochemistry wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Biosynthesis wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Point mutation wikipedia , lookup
Genetic code wikipedia , lookup
Multiple Sequence Alignment An alignment of heads Sequence Alignment • A way of arranging the primary sequences of DNA, RNA and amino acid to identify the regions of similarity that may be a consequence of functional, structural or evolutionary relationship between the sequences. Goals • To establish an hypothesis of positional homology between bases/amino acids. • To generate a concise, information-rich summary of sequence data. • Sometimes used to illustrate the dissimilarity between a group of sequences. • Alignments can be treated as models that can be used to test hypotheses. Sequence Alignment • Aligned sequences of nucleotide or amino acid residues are typically represented as rows within a matrix. • Gaps (symbol “-”) are inserted between the residues so that residues with identical or similar characters are aligned. Taxon A GGGAATCTAGGACTATACCGGATCTA Taxon B GGGAATCTA--ACTATA--GGATCTA Taxon C GGG--TCTAGGACTATACCGGAT--A Alignment can be easy or difficult GCGGCCCA GCGGCCCA GCGTTCCA GCGTCCCA GCGGCGCA ******** TCAGGTAGTT TCAGGTAGTT TCAGCTGGTT TCAGCTAGTT TTAGCTAGTT ********** GGTGG GGTGG GGTGG GGTGG GGTGA ***** TTGACATG TTGACATG TTGACATG TTGACATG TTGACATC ******** CCGGGG---A CCGGTG--GT -CTAGG---A -CTAGGGAAC -CTCTG---A ?????????? AACCG AAGCC ACGCG ACGCG ACGCG ***** Easy Difficult due to insertions or deletions (indels) Protein Alignment may be guided by Tertiary Structure Interactions Escherichia coli DjlA protein Homo sapiens DjlA protein Multiple Sequence AlignmentApproaches 3 main approaches of alignment: - Manual - Automatic - Combined Manual Alignment Might be carried out because: - Alignment is easy. - There is some extraneous information (structural). - Automated alignment methods have encountered the local minimum problem. - An automated alignment method can be “improved”. Automatic Alignment: Progressive Approach • Devised by Feng and Doolittle in 1987. • Essentially a heuristic method and as such is not guaranteed to find the ‘optimal’ alignment. • Requires n-1+n-2+n-3...n-n+1 pairwise alignments as a starting point. • Most successful implementation is CLUSTAL. Overview of ClustalW Procedure Hbb_Human Hbb_Horse Hba_Human Hba_Horse Myg_Whale 1 2 3 4 5 .17 .59 .59 .77 ClustalW .60 .59 .77 .13 .75 Hbb_Human .75 - 2 3 Quick pairwise alignment: calculate distance matrix 4 Hbb_Horse Hba_Human 1 Neighbor-joining tree (guide tree) Hba_Horse Myg_Whale alpha-helices 1 2 3 4 5 PEEKSAVTALWGKVN--VDEVGG GEEKAAVLALWDKVN--EEEVGG PADKTNVKAAWGKVGAHAGEYGA AADKTNVKAAWSKVGGHAGEYGA EHEWQLVLHVWAKVEADVAGHGQ 2 1 3 4 Progressive alignment following guide tree