* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download NEM1 acts as a suppressor of apoptotic phenotypes in LSM4 yeast
Therapeutic gene modulation wikipedia , lookup
Gene therapy wikipedia , lookup
Epigenetics in stem-cell differentiation wikipedia , lookup
Point mutation wikipedia , lookup
Designer baby wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Mir-92 microRNA precursor family wikipedia , lookup
FEMS Yeast Research, 15, 2015, fov074 doi: 10.1093/femsyr/fov074 Advance Access Publication Date: 27 August 2015 Research article RESEARCH ARTICLE NEM1 acts as a suppressor of apoptotic phenotypes in LSM4 yeast mutants Vanessa Palermo, Mariarita Stirpe, Mirko Torella, Claudio Falcone and Cristina Mazzoni∗ Pasteur Institute-Cenci Bolognetti Foundation, Department of Biology and Biotechnology ‘Charles Darwin’, Sapienza University of Rome, Piazzale Aldo Moro 5, 00185-Rome, Italy ∗ Corresponding author: Pasteur Institute-Cenci Bolognetti Foundation, Department of Biology and Biotechnology ‘Charles Darwin’, Sapienza University of Rome, Piazzale Aldo Moro 5, 00185-Rome, Italy. Tel: +39 06 49912257; E-mail: [email protected] One sentence summary: The use of yeast molecular genetics is very powerful to unravel links between different pathways; here the authors suggest a new connection between mRNA degradation, phospholipids biosynthesis and the aging process. Editor: Jens Nielsen ABSTRACT Saccharomyces cerevisiae mutants in the essential gene LSM4, involved in messenger RNA decapping, and expressing a truncated form of the LSM4 gene of the yeast Kluyveromyces lactis (Kllsm41), show premature aging accompanied by the presence of typical markers of apoptosis and high sensitivity to oxidative stressing agents. We isolated multicopy extragenic suppressors of these defects, transforming the Kllsm41 mutant with a yeast DNA library and selecting clones showing resistance to acetic acid. Here we present one of these clones, carrying a DNA fragment containing the NEM1 gene (Nuclear Envelope Morphology protein 1), which encodes the catalytic subunit of the Nem1p–Spo7p phosphatase holoenzyme. Nem1p regulates nuclear growth by controlling phospholipid biosynthesis and it is required for normal nuclear envelope morphology and sporulation. The data presented here correlate the mRNA metabolism with the biosynthesis of phospholipids and with the functionality of the endoplasmic reticulum. Keywords: yeast; apoptosis; mRNA; phospholipids; endoplasmic reticulum INTRODUCTION More that 15 years ago, it has been reported that the budding yeast Saccharomyces cerevisiae could undergo apoptosis-like cell death (Madeo, Frohlich and Frohlich 1997). This provided the possibility to use yeast as a model organism to investigate this mode of programmed cell death (PCD), benefiting from the ease of handling of this microorganism. Numerous yeast orthologs of central metazoan apoptotic regulators have been isolated and both exogenous and endogenous triggers that can induce PCD in S. cerevisiae have been described (Carmona-Gutierrez et al. 2010). Thanks to these successes, yeast has been used to approach unresolved issues regarding human apoptosis and its deregula- tion in the context of cancer, neurodegenerative diseases and aging. In previous works, we demonstrated that S. cerevisiae mutants in decapping, one of the principal way of degrading mRNA in yeast, undergo premature aging and show apoptotic phenotypes (Mazzoni et al. 2003a,b). We focused on the essential gene LSM4, and we demonstrated that strains carrying the deletion of this gene and expressing a truncated form of KlLSM4, the orthologous gene from Kluyveromyces lactis (Kllsm41), restored normal viability, but showed short lifespan and apoptotic hallmarks (Mazzoni and Falcone 2001). The contemporary deletion of the yeast metacaspase YCA1 signifficantly reduced all the apoptotic phenotypes observed in Kllsm41 mutant strain (Mazzoni et al. Received: 1 April 2015; Accepted: 11 August 2015 C FEMS 2015. All rights reserved. For permissions, please e-mail: [email protected] 1 2 FEMS Yeast Research, 2015, Vol. 15, No. 7 2005a). The increased sensitivity of this mutant to apoptosisinducing agents, e.g. H2 O2 or acetic acid, makes this strain an interesting subject for the isolation of suppressor genes of PCD. As reported in Mazzoni et al. (2005b), we transformed the Kllsm41 mutant strain with a S. cerevisiae genomic library and we isolated a number of acetic acid-resistant clones. We previously described the characterization of two suppressors isolated with this approach: HIR1, encoding a corepressor of histones gene transcription, and PGK1, encoding the glycolitic enzyme phosphoglycerate kinase (Mazzoni et al. 2005b, 2009). The overexpression of these two genes suppressed the apoptotic phenotypes of the Kllsm41 mutant strain. In this paper, we focused our attention on NEM1, another gene isolated as a suppressor in the same screening. NEM1 encodes the homolog of the human Dullard protein, a specific phosphatase that catalyzes lipin Oγ -phosphoryl serines (pSer) hydrolysis and negatively regulates bone morphogenetic protein (BMP) signaling (Satow et al. 2006). Alignment of human Dullard and S. cerevisiae Nem1p HADSF domains (residues 235– 446) showed 44% sequence identity (Karanasios et al. 2013). Similarly to the mammalian protein, Nem1p acts on the yeast lipin homolog Pah1p. Yeast cells lacking active Nem1p phosphatase exhibit the characteristic phenotype of Pah1p knockout, with derepression of phospholipid synthesis genes and a strong expansion of the nuclear envelope and defects in the endoplasmic reticulum (ER) membrane (Santos-Rosa et al. 2005; Pascual, Soto-Cardalda and Carman 2013). Nem1p activity in yeast also depends on the presence the Spo7 protein, which binds Nem1p at the C-terminal catalytic domain. The deletion of Spo7p or Nem1p gene, both result in a nuclear membrane proliferation (Pascual and Carman 2013). Dullard and Nem1 proteins show similar domains and substrate preferences, and both localize to the nuclear envelope. Additionally, human Dullard can rescue the aberrant nuclear envelope morphology of nem1 yeast cells (Siniossoglou et al. 1998), suggesting that this protein has been conserved through evolution. Here we demonstrate that the overexpression of NEM1 suppresses the apoptotic phenotypes of the Kllsm41 mutant strain, including nuclear fragmentation, H2 O2 sensitivity and restores normal aging of cells. MATERIALS AND METHODS Strains and culture conditions MCY4 is a S. cerevisiae strain (Mat α, ade1–101, his3-D1, trp1– 289, ura3, LEU2-GAL1-SDB23) that harbors the endogenous LSM4/SDB23/USS1 gene under the control of Gal1–10 promoter (Cooper Johnston and Beggs 1995). We introduced into this strain the pRS313/Kllsm41 plasmid that carries a truncated form of the KlLSM4 gene of K. lactis to give MCY4/313Kllsm41 (Mazzoni and Falcone 2001; Mazzoni et al. 2003b, 2005a), which was used for the isolation of multicopy suppressors of the apoptotic phenotypes from a yeast genomic library constructed in the pFL44D episomal plasmid (Bonneaud et al. 1991). MCY4/313Kllsm41/LSM4 (1/LSM4) and MCY4/313Kllsm41/ NEM1 (1/NEM1) are two transformants carrying the LSM4 and the NEM1 genes of S. cerevisiae, respectively. As reference wildtype (WT) strains, we used the S. cerevisiae strain CML39-11A (Mat a, ade1–101, his3-D1, leu2, ura3, trp1–289) and BY4741 (MATa his31 leu20 met150 ura30) isogenic to MCY4 and Euroscarf NEM1 (YHR004C) disruption strain (Y06601), respectively (Brachmann et al. 1998; Mazzoni et al. 2005a). A strain containing Sec63-GFP genomic fusion (Life technologies cat. 95 700) was used to visualize ER. Cells were grown at 28◦ C in YP (1% yeast extract, 2% peptone) supplemented with 2% glucose (YPD) or 3% glycerol (YPY) or in SD (yeast nitrogen base w/o amino acids), with auxotrophic requirements added as needed. Solid media were supplemented with 2% Bactoagar (Difco, Detroit, MI, USA). Cell viability Cell suspensions (5 μL) containing approximately 6 × 106 cells mL−1 were poured on a thin layer of YPD agar on a microscope slide. A cover slip was placed over the samples and, after 24 h, viable and unviable cells were scored on the basis of their ability to form microcolonies (Palermo, Falcone and Mazzoni 2007). Fluorescence microscopy The fluorochrome DAPI (diamidino-2-phenylindole) was used to investigate nuclear morphology. Exponentially growing cells were fixed with 70% (v/v) ethanol and stained with DAPI (1 μg mL−1 ) and observed with an Axioskop2 fluorescence microscope (Carl Zeiss, Jena, Germany) equipped with a digital camera (micro-CCD). For ROS detection, we used Dihydrorhodamine 123 (Sigma) as described (Madeo et al. 1999). In order to highlight the state of the endoplasmic reticulum, we incubate cells for 60 min with the fluorochrome ER-Tracker Blue-white DPX (Molecular Probes) at the concentration of 10 μM. The dye was previously filtered to remove any aggregates. All incubations were performed at room temperature. Samples were then observed with a fluorescence microscope (blue (ER staining), 748/560 nm). ER visualization in yeast strain expressing Sec63-GFP was performed on exponential growing cells observed with a fluorescence microscope. Real-time quantitative PCR analysis Cells were grown at 28◦ C in minimal media SD (yeast nitrogen base without amino acids and auxotrophic requirement as needed). Total RNA was isolated from the yeast cells at exponential phase using glass beads (Sartorious) and phenol method. Nucleic acid was quantified by measuring the absorbance at 260 nm using nanodrop technology (Thermo-Fisher Scientific) and 2 g of RNA was transcribed to cDNA using M-MuLV Reverse Transcriptase (BioLabs). Real-time PCR used to verify the expression of mRNA was performed using iCycler (BIORAD) and SensiMix SYBR & Fluorescein Kit (Bioline). The reaction conditions were 95◦ C for 10 min, 35 cycles of 95◦ C for 30 s, 65◦ C for 30 s and 72◦ C for 45 s, and 58◦ C for 15 s. Quantification was performed using a comparative CT method (CT = threshold cycle value). Briefly, the differences between the mean CT value of each sample and the CT value of the housekeeping gene (TDH3) were calculated: CTsample = CTsample − CTTDH3. Final result was determined as 2− CT, where CT = CTsample − CTcontrol. The primers used were shown in Table 1. Palermo et al. 3 Table 1. List of primers used in this study. Name Molecular Function Primer sequence TDH3 Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), isozyme 3 NEM1 Catalytic subunit of Nem1p-Spo7p phosphatase holoenzyme. F:CGGTAGATACGCTGGTGAAGTTTC R:TGGAAGATGGAGCAGTGATAACAAC F: GTACGACCACTCCTCAAGCC R: GTGCCCACAAAATTGACGCT RESULTS We previously reported the isolation from a S. cerevisiae genomic bank of multicopy suppressors of Kllsm41 strain that were able to recovered resistance to acetic acid, an inducer of apoptosis in yeast (Ludovico et al. 2001; Mazzoni et al. 2005b). One of these clones contained a DNA fragment corresponding to the S. cerevisiae NEM1 gene, encoding the catalytic subunit of the ER associated Nem1p–Spo7p phosphatase complex (Pascual and Carman 2013). Nem1p contains an N-terminal domain that has no homology with other known proteins, and a C-terminal domain highly conserved during evolution. We subcloned this gene from the DNA fragment and inserted it into the Escherichia coli–S. cerevisiae shuttle vector pFL44D (Bonneaud et al. 1991). Kllsm41 mutant was then transformed with this plasmid and tested for the ability to grow in the presence of 60 mM acetic acid. As shown in Fig. 1A, the overexpression of NEM1 gene restored viability of Kllsm41 mutant. We also transformed the WT strain CML39-11A with the same plasmid and we did not observe any difference in growth in the presence of the same concentration of acetic acid (Fig. 1B). Nevertheless, at higher concentrations of acetic acid (90 mM, Fig. 1B) the NEM1 overexpression conferred 1 log resistance to acetic acid, Figure 1. NEM1 over-expression confers resistance to acetic acid. The CML3911A and the mutant strain Kllsm41 were transformed with the control plasmid (WT and 1, respectively) and with the NEM1 (WT/NEM1, 1/NEM1) gene. 10-fold dilutions of cell suspensions were spotted onto solid rich medium containing acetic acid (Aa) at the indicated concentration and incubated at 28◦ C for 3 days. Growth of the same strains on YPD as control is also shown. compared to cells containing the vector. We previously reported that the Kllsm41 mutant shows rapid cell death during chronological aging, nuclei fragmentation, increased sensitivity to drugs and H2 O2 and the inability to grow on glycerol as carbon source (Mazzoni et al. 2003a). For this reason, we tested whether the overexpression of NEM1 in this mutant could suppress some of those phenotypes. As shown in Fig. 2A, cells overexpressing NEM1 recovered the early loss of viability at day 5 observed in the Kllsm41 mutant. In fact, the cells completely died after 10 days of growth, similarly to WT cells that lost viability after 11 days. As reported in the literature, H2 O2 treatment increases ROS production in the cell triggering apoptosis (Laun et al. 2001; Herker et al. 2004). For this reason, we checked the resistance of those strains to increasing concentration of H2 O2 . As reported in Fig. 2B, cells overexpressing NEM1 recovered the high sensitivity to oxidative stress observed in Kllsm41 mutant, showing a similar sensitivity of cells expressing the LSM4 WT gene. Kllsm41 cells showed a pleiotropic phenotype, including temperature sensitivity, inability to use respiratory carbon sources such as glycerol, and sensitivity to caffeine, a methylated derivative of purine analog; the latter phenotype has often been associated with many cellular processes, including defects in components of the mitogen-activated protein (MAP) kinase cascade, indicating a possible defect in cell wall synthesis and in nucleic acid metabolism. The overexpression of Nem1p fully recovered temperature sensitivity in glucose (YPD 37◦ C) and growth on non-fermentable carbon source both at 28◦ C and 37◦ C (Fig. 2C, YPY28◦ C and YPY 37◦ C). In contrast, little or no effect on growth was observed in the presence of caffeine, suggesting that NEM1 is not involved in the cell integrity pathway defects observed in Kllsm41 mutant cells. The overexpression of NEM1 in the WT did not change cell growth in the tested conditions (Fig. 2C). We next checked the ability of NEM1 overexpression to suppress apoptotic phenotypes observed in Kllsm1, such as nuclear fragmentation and intracellular ROS accumulation. Cells of Kllsm41 expressing NEM1 (1/NEM1) and the control plasmid pFL44 (1) were stained with the fluorescent dye DAPI, to visualize nuclei morphology, and with DHR123, to reveal intracellular ROS (Fig. 3A). The overexpression of Nem1p rescued the aberrant nuclear envelope phenotype in this mutant strain with a decrease in nuclear fragmentation from about 13–0.63% (see Fig. 3B for statistical quantization), a percentage similar to that showed by the CML39-11A (WT), the strain we used as a control. NEM1 overexpression also recovered the accumulation of intracellular ROS in the Kllsm41 mutants (Fig. 3C), suggesting that in the latter the observed apoptotic phenotypes can be counteracted by an increase of a serine/threonine phosphatase activity like Nem1p. We also checked the effect of NEM1 overexpression on chronological lifespan and oxidative stress sensitivity in the 4 FEMS Yeast Research, 2015, Vol. 15, No. 7 Figure 2. (A) Cellular viability of CML39-11A (WT) Kllsm41 (1) and Kllsm41 over-expressing NEM1 (1/NEM1) strains during chronological ageing. Viability, measured over time, is expressed as a percentage of colony forming units. (B) Cell viability of the same strains as in (A) was measured after exposure to H2 O2 at the indicated concentration for 4 h. In A and B average of three independent experiments and standard deviation is reported. P-values: ∗∗ P < 0,01 ∗∗∗ P < 0.001. (C) Effect of Nem1p over-expression on the Kllsm41 pleiotropic phenotype. CML39-11A (WT), Kllsm41 (1) and the same strains over-expressing NEM1 (WT/NEM1 and 1/NEM1) cells were grown in YPD to saturation and 5 μl aliquots of 10-fold dilutions were spotted onto solid rich medium containing 2% glucose (YPD), 2% glycerol (YPY) and YPD plates with 0.25% caffeine and incubated at 28◦ C or 37◦ C for 4 days. WT strain CML39-11A. As shown in Fig. 4, the overexpression of NEM1 determined an extension of viability during CLS (Fig. 4A) and conferred higher resistance toward H2 O2 treatments (Fig. 4B). In Fig. 4C are shown the levels of NEM1 gene transcription in both CML39-11A (WT) and Kllsm41 (1). In both cases, it is clear that NEM1 was overexpressed compared to cells expressing the pFL44 control plasmid (empty vector). The metazoan NEM1 homolog, Dullard protein, is a serine/threonine phosphatase that negatively regulates BMP signaling (Satow et al. 2006) and it has been reported that Dullard mutant nephrons show apoptotic cell death (Sakaguchi et al. 2013). Although cells lacking NEM1 are viable, they show a drastic alteration of the nuclear morphology with long protrusions that penetrate the membrane into the cytoplasm (Siniossoglou et al. 1998). This result suggested a role of NEM1 gene in the process of cell death and aging. We analyzed a yeast strain lacking the NEM1 gene and, as showed in Fig. 5A, on the second day the deleted strain already showed 37% of cell viability and, at day 4, no more living cells were present. In contrast, the viability of WT strain shows a gradual reduction and the death of the whole cell population occurred at day 6. Strains lacking NEM1 also showed increased sensitivity to hydrogen peroxide treatments. As shown in Fig. 5B, nem1 cells showed after 4 h in 1,2 mM H2 O2 30% of the viability showed by the WT and, after a 4 h treatment with 3 mM H2 O2 all cells were dead, while WT cells retained about 5% of viability. Finally, we determined the percentage of cells showing nuclear fragmentation and we found that nem1 mutant presents a small number of cells containing fragmented nuclei (Fig. 5C and D). Although the number of cells showing fragmented nuclei was slightly higher compared to the WT, it is unlikely that such increase may account for the premature loss of viability shown by this mutant during chronological aging. The ER is a dynamic membrane system that mediates the assembly of proteins, the secretion, calcium homeostasis, lipid metabolism and the partitioning of the nucleus (Chen, Novick and Ferro-Novick 2013). It is known that Nem1p–Spo7p protein phosphatase complex is localized in the nuclear/ER membrane and that the absence of Nem1 causes aberrant nuclear morphology (Siniossoglou et al. 1998). Moreover, dephosphorylation of Pah1p by the Nem1p– Spo7p complex enables the amphipathic helix to anchor Pah1p onto the nuclear/ER membrane allowing the production of diacylglycerol for lipid biosynthesis (Karanasios et al. 2010). Finally, in both flies and the worm Caenorhabditis elegans, Dullard protein and lipin have a role in controlling ER morphology (Golden, Liu and Cohen-Fix 2009; Liu et al. 2011). To verify if the absence as well the overexpression of the NEM1 gene could affect the ER status in yeast, we used the vital dye ER-tracker Blue-White DPX (Invitrogen), which colors specifically the ER membranes. This dye, used successfully in the case of mammalian cells, flies and in the filamentous fungus Pisolithus tinctorius (Cole et al. 2000), was never used in yeast before now. We compared the morphology of the ER in WT, nem1, Kllsm41and Kllsm41/NEM1 strains. In WT strains (Fig. 6, panels A and D), as expected, the ER appears as a filamentous structure just beneath the plasma membrane (cortical ER), and as a ring surrounding the nucleus, with several tubules crossing the cytoplasm to connect these two main structures. In the absence of NEM1 gene (Fig. 6, panel E), Palermo et al. 5 Figure 3. (A) DAPI and (C) Dihydrorhodamine 123 (DHR123) staining of the CML39-11A (WT) Kllsm41 (1) and Kllsm41 over-expressing NEM1 (1/NEM1) cells. PC: phase contrast relative to DHR123 staining. Panels (B) and (D) represent the percentage of fragmented nuclei and ROS positive cells, respectively, in three independent experiments. P-values < 0,01. Figure 4. (A) Cellular viability of CML39-11A containing the pFL44 empty plasmid (WT+vector) and over-expressing NEM1 (WT+NEM1) strains during chronological ageing. Viability, measured over time, is expressed as a percentage of colony forming units. (B) Cell viability of the same strains as in (A) was measured after exposure to H2 O2 at the indicated concentration for 4 h. In A and B average of three independent experiments and standard deviation is reported. P-values: (A) P < 0,001 from day 3 on. (B) ∗∗ P < 0,01 ∗∗∗ P < 0.001 (C) Total RNA was isolated from CML39-11A and Kllsm41 cells expressing the empty plasmid (WT+vector, 1+vector) or NEM1 gene (WT+NEM1, 1+NEM1) and reverse-transcribed to cDNA. Real time PCR was used to analyze the expression levels of NEM1, using the specific primers indicated in materials and methods. The expression of the TDH1 gene was used as an internal control for normalization of the real time PCR data and mRNA relative quantity are expressed vs the strain expressing only the chromosomal copy of NEM1 gene set to 1. Data represent the mean of three independent experiments. the perinuclear ER membranes show, instead of filamentous, a punctuated structure, with one or two spots per cell. Also in the case of Kllsm41 mutant cells (Fig. 6, panel B), ER membranes appear fragmented, although the number of spots is higher compared to the nem1 cells. The NEM1 overexpression in the Kllsm41 mutant restored the correct ER membrane distribution, suggesting that one of the NEM1 suppression mechanisms could be related to its role in the maintenance of a proper ER structure. The ER-tracker Blue-White DPX (Invitrogen) has never been used in yeast; for this reason, as a control, we looked at the ER distribution in a yeast strain expressing the Sec63-GFP fusion. As shown in Fig. 6F, the structures highlighted in Sec63-GFP expressing strains were very similar to those shown after ER-tracker Blue-White DPX staining, providing good evidences that these structures correspond to the ER. 6 FEMS Yeast Research, 2015, Vol. 15, No. 7 Figure 5. (A) Cellular viability of nem1 and wild type (BY4741) strains during chronological ageing. Viability, measured over time, expressed as a percentage of colony forming units. (B) Cell viability of wild type (BY4741, black bars) and nem1 (gray bars) was measured after exposure to H2 O2 at the indicated concentration for 4 h. (C) DAPI staining of the wild type (BY4741) and nem1 cells (D) Percentage of fragmented nuclei in the same strains. Average of three independent experiments and standard deviation is reported. P-values: ∗ P < 0.05, ∗∗ P < 0.01, ∗∗∗ P < 0.001. Figure 6. Endoplasmic reticulum (ER) staining with the vital dye ER-Tracker Blue-White DPX. CML39-11A and BY4741 are the reference wild type strains (panel A and D) for Kllsm41 (panel B) and nem1 (panel E), respectively. Panel C: Kllsm41 expressing NEM1. As a control, in panel F is shown the ER staining of a wild type strain expressing Sec63-GFP. DISCUSSION We previously reported that the decapping mutant Kllsm41 of the yeast S. cerevisiae shows premature aging and undergo apoptosis-like cell death. A genetic screening identified two genes, HIR1, a negative regulator of histone transcription involved in heterochromatic gene silencing, and PGK1, a key enzyme in glycolysis and gluconeogenesis, able to prevent premature aging and all the hallmarks of apoptosis observed in this mutant. These results suggest a connection between defects in degrading mRNA, aging, cell death, chromatin structure, Palermo et al. metabolism and protein quality control/degradation (Mazzoni and Falcone 2011) and Palermo et al. submitted). In this paper, we focused our attention on NEM1, another gene isolated in the same multicopy suppressor genes screening. The overexpression of the NEM1, which encodes for the catalytic subunit of Nem1p-Spo7p phosphatase holoenzyme, suppressed most of the phenotypes showed by the decapping mutant Kllsm41 of the yeast S. cerevisiae. Nem1p overexpression recovered growth in acetic acid, glycerol and at 37◦ C of the Kllsm41 mutant. It could not recover, as also in the case of HIR1 overexpression and in contrast to PGK1, the increased sensitivity to the purine analog caffeine, a phenotype often associated with defects in the protein kinase C-MAP kinase pathway, indicating that NEM1 is not involved in this specific phenotype observed in the Kllsm41 mutant. NEM1 is a gene ortholog to the Dullard gene of mammal cells and is involved in regulating nuclear growth and controlling phospholipid biosynthesis. Although the mechanism of suppression of the apoptotic phenotypes by NEM1 is still unknown, as NEM1 is involved in the phosphorylation of the yeast lipin ortholog Smp2 (Santos-Rosa et al. 2005; Kim et al. 2007), an interesting hypothesis could be the link between cell progression and membrane morphogenesis. We previously reported that delaying S-phase entry progression by hydroxyurea can recover Kllsm41 phenotypes (cell cycle 2010). Since Smp2 phosphorylation is linked to G1-S progression (Santos-Rosa et al. 2005), NEM1 overexpression could partially inactivate this activity and provoke a delay in cell cycle progression. The absence of the Duillard protein in mice provokes a massive apoptosis of nephrons and leads to death quickly after birth (Sakaguchi et al. 2013). Moreover, disturbance in cellular lipid homeostasis often culminate in lipotoxic cell death (Austriaco 2012; Eisenberg and Buttner 2014). In this paper, we show that mutations in yeast NEM1 gene cause a premature aging, but cells do not present the typical hallmarks of apoptosis, suggesting that the observed cell death could occur via different mechanisms. An interesting result was that in the absence of Nem1p, the ER membranes show an altered distribution, suggesting an involvement of ER functions in the observed defects. Nevertheless, it has been reported that nem1 strains show aberrant nuclear/ER membranes and that these defects can be suppressed by the overexpression of Smp2, the yeast homolog of mammalian lipin (Santos-Rosa et al. 2005). At this purpose, it has been recently reported that Nem1p is involved in stationary phase lipophagy, a process in which lipid droplets emerging from the ER are transferred to the vacuole, using the autophagy machinery (Wang, Miao and Chang 2014). A deeper investigation of the factors regulating Nem1p– Spo7p function and their impact on cellular lifespan will further expand our understanding of lipid homeostasis and, as a consequence, of pathways at the basis of lipid diseases, a field not enough explored yet. Conflict of interest. None declared. REFERENCES Austriaco N. Endoplasmic reticulum involvement in yeast cell death. Front Oncol 2012;2:87. Bonneaud N, Ozier-Kalogeropoulos O, Li GY, et al. A family of low and high copy replicative, integrative and single-stranded S. cerevisiae/E. coli shuttle vectors. Yeast 1991;7:609–15. Brachmann C, Davies A, Cost G, et al. Designer deletion strains 7 derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 1998;14:115–32. Carmona-Gutierrez D, Eisenberg T, Buttner S, et al. Apoptosis in yeast: triggers, pathways, subroutines. Cell Death Differ 2010;17:763–73. Chen S, Novick P, Ferro-Novick S. ER structure and function. Curr Opin Cell Biol 2013;25:428–33. Cole L, Davies D, Hyde G, et al. ER-Tracker dye and BODIPYbrefeldin A differentiate the endoplasmic reticulum and golgi bodies from the tubular-vacuole system in living hyphae of Pisolithus tinctorius. J Microsc 2000;197(Pt 3):239–49. Cooper M, Johnston L, Beggs J. Identification and characterization of Uss1p (Sdb23p): a novel U6 snRNA-associated protein with significant similarity to core proteins of small nuclear ribonucleoproteins. EMBO J 1995;14:2066–75. Eisenberg T, Buttner S. Lipids and cell death in yeast. FEMS Yeast Res 2014;14:179–97. Golden A, Liu J, Cohen-Fix O. Inactivation of the C. elegans lipin homolog leads to ER disorganization and to defects in the breakdown and reassembly of the nuclear envelope. J Cell Sci 2009;122(Pt 12):1970–8. Herker E, Jungwirth H, Lehmann K, et al. Chronological aging leads to apoptosis in yeast. J Cell Biol 2004;164:501–7. Karanasios E, Barbosa A, Sembongi H, et al. Regulation of lipid droplet and membrane biogenesis by the acidic tail of the phosphatidate phosphatase Pah1p. Mol Biol Cell 2013;24:2124–33. Karanasios E, Han G, Xu Z, et al. A phosphorylation-regulated amphipathic helix controls the membrane translocation and function of the yeast phosphatidate phosphatase. P Natl Acad Sci USA 2010;107:17539–44. Kim Y, Gentry M, Harris T, et al. A conserved phosphatase cascade that regulates nuclear membrane biogenesis. P Natl Acad Sci USA 2007;104:6596–601. Laun P, Pichova A, Madeo F, et al. Aged mother cells of Saccharomyces cerevisiae show markers of oxidative stress and apoptosis. Mol Microbiol 2001;39:1166–73. Liu Z, Matsuoka S, Enoki A, et al. Negative modulation of bone morphogenetic protein signaling by Dullard during wing vein formation in Drosophila. Dev Growth Differ 2011;53:822–41. Ludovico P, Sousa M, Silva M, et al. Saccharomyces cerevisiae commits to a programmed cell death process in response to acetic acid. Microbiology 2001;147:2409–15. Madeo F, Frohlich E, Frohlich KU. A yeast mutant showing diagnostic markers of early and late apoptosis. J Cell Biol 1997;139:729–34. Madeo F, Frohlich E, Ligr M, et al. Oxygen stress: a regulator of apoptosis in yeast. J Cell Biol 1999;145:757–67. Mazzoni C, Falcone C. Isolation and study of KlLSM4, a Kluyveromyces lactis gene homologous to the essential gene LSM4 of Saccharomyces cerevisiae. Yeast 2001;18:1249–56. Mazzoni C, Falcone C. mRNA stability and control of cell proliferation. Biochem Soc Trans 2011;39:1461–5. Mazzoni C, Herker E, Palermo V, et al. Yeast caspase 1 links messenger RNA stability to apoptosis in yeast. EMBO Rep 2005a;6:1076–81. Mazzoni C, Mancini P, Madeo F, et al. A Kluyveromyces lactis mutant in the essential gene KlLSM4 shows phenotypic markers of apoptosis. FEMS Yeast Res 2003a;4:29–35. Mazzoni C, Mancini P, Verdone L, et al. A truncated form of KlLsm4p and the absence of factors involved in mRNA decapping trigger apoptosis in yeast. Mol Biol Cell 2003b;14: 721–9. 8 FEMS Yeast Research, 2015, Vol. 15, No. 7 Mazzoni C, Palermo V, Torella M, et al. HIR1, the co-repressor of histone gene transcription of Saccharomyces cerevisiae, acts as a multicopy suppressor of the apoptotic phenotypes of the LSM4 mRNA degradation mutant. FEMS Yeast Res 2005b;5:1229–35. Mazzoni C, Torella M, Petrera A, et al. PGK1, the gene encoding the glycolitic enzyme phosphoglycerate kinase, acts as a multicopy suppressor of apoptotic phenotypes in S. cerevisiae. Yeast 2009;26:31–7. Palermo V, Falcone C, Mazzoni C. Apoptosis and aging in mitochondrial morphology mutants of S. cerevisiae. Folia Microbiol 2007;52:479–83. Pascual F, Carman G. Phosphatidate phosphatase, a key regulator of lipid homeostasis. Biochim Biophys Acta 2013;1831: 514–22. Pascual F, Soto-Cardalda A, Carman G. PAH1-encoded phosphatidate phosphatase plays a role in the growth phase- and inositol-mediated regulation of lipid synthesis in Saccharomyces cerevisiae. J Biol Chem 2013;288: 35781–92. Sakaguchi M, Sharmin S, Taguchi A, et al. The phosphatase Dullard negatively regulates BMP signalling and is essential for nephron maintenance after birth. Nat Commun 2013;4:1398. Santos-Rosa H, Leung J, Grimsey N, et al. The yeast lipin Smp2 couples phospholipid biosynthesis to nuclear membrane growth. EMBO J 2005;24:1931–41. Satow R, Kurisaki A, Chan T, et al. Dullard promotes degradation and dephosphorylation of BMP receptors and is required for neural induction. Dev Cell 2006;11:763–74. Siniossoglou S, Santos-Rosa H, Rappsilber J, et al. A novel complex of membrane proteins required for formation of a spherical nucleus. EMBO J 1998;17:6449–64. Wang C, Miao Y, Chang Y. A sterol-enriched vacuolar microdomain mediates stationary phase lipophagy in budding yeast. J Cell Biol 2014;206:357–66.