Download Chronic Immune Reactivity Against Persisting Microbial Antigen in

Chronic Immune Reactivity Against Persisting Microbial
Antigen in the Vasculature Exacerbates Atherosclerotic
Lesion Formation
Philippe Krebs, Elke Scandella, Beatrice Bolinger, Daniel Engeler, Simone Miller, Burkhard Ludewig
Downloaded from http://atvb.ahajournals.org/ by guest on May 13, 2017
Objective—The purpose of this study was to examine the relative contribution of different immunopathological
mechanisms during murine cytomegalovirus (MCMV)-mediated acceleration of atheroma formation in apolipoprotein
E– deficient (apoE⫺/⫺) mice.
Methods and Results—To distinguish between the effects of systemic activation and cognate immune reactivity against
a pathogen-derived persisting antigen in the vasculature, we used hypercholesterolemic transgenic mice constitutively
expressing the ␤-galactosidase (␤-gal) transgene in the cardiovascular system (apoE⫺/⫺⫻SM-LacZ). After infection with
␤-gal–recombinant MCMV-LacZ, apoE⫺/⫺, and apoE⫺/⫺⫻SM-LacZ mice mounted comparable cellular immune
responses against the virus. ␤-gal–specific CD8⫹ T cells expanded rapidly and remained detectable for at least 100 days
in both mouse strains. However, compared with apoE⫺/⫺ mice, apoE⫺/⫺⫻SM-LacZ mice developed drastically
accelerated atherosclerosis. Moreover, atherosclerotic lesions in MCMV-LacZ–infected apoE⫺/⫺⫻SM-LacZ but not
apoE⫺/⫺ mice were associated with pronounced inflammatory infiltrates.
Conclusions—Taken together, our data indicate that chronic immune reactivity against pathogen-derived antigens
persisting in the vasculature significantly exacerbates atherogenesis. (Arterioscler Thromb Vasc Biol.
2007;27:2206-2213.)
Key Words: cytomegalovirus 䡲 atherosclerosis 䡲 inflammation 䡲 immunopathology 䡲 coronary heart disease
C
hronic inflammatory processes in the vascular wall are
crucial for initiation and perpetuation of atherosclerotic lesions.1 It appears that it is the “infectious burden”,
ie, the overall impact of repeated or chronic infections with
multiple pathogens,2 that determines the extent of atherosclerosis and clinical prognosis.3,4 Epidemiological and
experimental evidence indicates that herpesviruses represent important viral pathogens that elicit arterial inflammation and may thereby exacerbate atherosclerotic disease. Seroepidemiological studies have shown a link
between human cytomegalovirus (HCMV) infection and
atherosclerosis.5,6 Furthermore, detection of HCMV DNA
in atherosclerotic lesions of patients with coronary artery
disease7,8 suggests that HCMV infection may impair vascular functions. HCMV infection of cells in the vascular
wall may directly contribute to neointima formation
through the viral US28 gene product which functions as a
chemokine receptor and enhances the migration of smooth
muscle cells in response to inflammatory chemokines.9
Likewise, the chemokine receptor M33 of the murine CMV
(MCMV) is essential for MCMV-induced migration of
vascular smooth muscle cells10 indicating that vascular
integrity can be altered through virus-intrinsic factors.
In addition, various infection-associated immunopathological mechanisms impinge on the atherosclerotic process.11 Molecular similarities (“mimicry”) between microbial and host proteins, as found in the structurally related
human and chlamydial heat shock proteins (HSP60/65),
precipitate inflammatory reactions in atherosclerotic lesions.12 General immune activation with systemic (“bystander”) effects on the vascular wall can be triggered by
a MCMV infection-associated increase in IFN␥ serum
levels leading to the secretion of proinflammatory cytokines such as monocyte chemoattractant protein-1
(MCP-1) by endothelial cells.13 It is possible that such
processes foster the recruitment of monocytes/macrophages and T cells to atherosclerotic lesions.14 It has been
argued that the transient induction of bystander cytokines
during the first 2 weeks after MCMV infection of apoE⫺/⫺
mice may be crucial for MCMV-mediated acceleration of
atherosclerosis.15,16 However, systemic immune activation
by generalized herpesvirus simplex virus 1 infection seems
not to be sufficient to aggravate lesion formation in
hypercholesterolemic apoE⫺/⫺ mice.17 It appears that it is
rather the specific tropism of herpesviruses for cells of the
vascular wall that determines the enhancement of athero-
Original received August 21, 2006; final version accepted July 10, 2007.
From the Research Department, Kantonal Hospital St Gallen, St Gallen, Switzerland.
Correspondence to Burkhard Ludewig, Research Department, Kantonsspital St Gallen, Rorschacherstrasse 95, CH-9007 St Gallen, Switzerland. E-mail
[email protected]
© 2007 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol. is available at http://atvb.ahajournals.org
2206
DOI: 10.1161/ATVBAHA.107.141846
Krebs et al
Immunopathological Mechanisms in Atherogenesis
Downloaded from http://atvb.ahajournals.org/ by guest on May 13, 2017
genesis in apoE⫺/⫺ mice after herpesvirus infection.17,18
Therefore, an issue central to the role of murine and human
cytomegaloviruses in atherogenesis is the relative contribution of the different immunopathological mechanisms
(“bystander activation” versus “reactivity against persisting antigens”) during the development of atherosclerotic
lesions.
In the present study we used a well-defined mouse
model of cardiovascular immunopathology19 to distinguish
between MCMV infection-associated systemic immune
activation and specific immune reactivity directed against
a persisting viral antigen in the vasculature. In SM-LacZ
mice, the ␤-galactosidase (␤-gal) antigen is expressed in
arterial smooth muscle cells.20 The peripherally expressed
antigen is ignored by T cells unless the antigen is efficiently presented in secondary lymphoid organs.21 During
infection with ␤-gal recombinant MCMV (MCMV-LacZ)
the vascular ␤-gal transgene in SM-LacZ mice functions
therefore as a pathogen-derived antigen that persists in the
arterial wall. Infection of hypercholesterolemic apoE⫺/⫺⫻
SM-LacZ mice with MCMV-LacZ revealed that virusinduced T cell responses directed against the transgenic
␤-gal antigen within the vasculature favor the development
of an inflammatory environment that is important for the
acceleration of atherosclerotic lesion development.
Materials and Methods
Isolation of Arterial Smooth Muscle Cells
Aortas from C57BL/6, SM-lacZ, and Fas-KO mice were cut into
small pieces and digested with collagenase type II (2 mg/mL,
dissolved in DMEM; Sigma). After incubation for 45 minutes at
37°C, single cell suspensions were prepared by passing through a
syringe with a 21G needle. Cells were washed twice with DMEM
10% FCS and plated onto 6-well plates (cell suspension from 1 aorta
into 2 wells). After 4-hour incubation at 37°C, nonadherent cells
were removed by washing with medium and the remaining cells were
cultured further for 10 days. More than 90% of the cells stained
positive for smooth muscle actin (not shown).
Immunohistology
Freshly removed organs were immersed in HBSS and snap-frozen
in liquid nitrogen (LN2). Frozen tissue sections were cut in a
cryostat and fixed in acetone for 10 minutes. Sections were
incubated with antibodies against ␤-gal (MP Biomedicals,), CD8
(clone YTS169.4.2), CD4 (YTS191.1.2), or F4/80 (Biomedicals
AG, clone BM8) followed by goat anti-rat Ig (Caltag Labs) and
alkaline phosphatase-labeled donkey anti-goat Ig (Jackson ImmunoResearch Labs). Alkaline phophatase was visualized by using
AS-BI phosphate/New Fuchsin, and sections were counterstained
with hemalum. For the quantitative evaluation of atherosclerotic
lesions, 5 to 10 serial cross-sections through the aortic origin,
beginning with the appearance of all 3 valve cusps, were stained
with Sudan Red, counterstained with hemalum, and measured by
using a Leica DM R microscope, Leica DC300 FX camera and
Leica IM1000 (version 1.20) computer-aided morphometry software. The average lesion size for each mouse was calculated.
For semiquantitative assessment of inflammatory alterations in
atherosclerotic lesions, sections were evaluated in a blinded
fashion by 2 observers using the following criteria: grade 0, no
infiltration; grade 1, confined minor infiltration (foci of ⬍20
cells) in the perivascular space; grade 2, confined major infiltration (foci of ⬎20 cells) in the perivascular space and/or within the
intimal lesion; grade 3, multiple clusters of inflammatory cells
(⬎100 cells) in the perivascular space; grade 4:, multiple clusters
of inflammatory cells (⬎100 cells) in the perivascular space and
2207
within the intimal lesion. Average severity has been calculated for
MCMV-LacZ–infected hypercholesterolemic mice. Infiltration
with CD8⫹ T cells was enumerated on 3 sections per mouse
covering the area of the coronary artery bifurcations.
For ␤-gal staining in whole tissue mounts, aortic arches were
prepared from C57BL/6 and SM-lacZ mice and immersed in PBS
2 mmol/L MgCl2. After fixation in PBS containing 0.5% glutaraldehyde and 2 mmol/L MgCL2 for 1 hour, tissues were rinsed in PBS.
␤-gal activity was revealed by incubation for 2 to 4 hour at 37°C in
X-Gal buffer (5 mmol/L potassium ferrocyanide, 5 mmol/L potassium ferricyanide, 2 mmol/L MgCl2 and 1 mg/mL X-Gal in PBS).
Please see supplemental materials, available online at http://
atvb.ahajournals.org, for additional Materials and Methods.
Results
ⴙ
CD8 T Cell Reactivity in the Course of
MCMV Infection
In a first set of experiments, we determined whether
MCMV-induced CTL can recognize ␤-gal epitopes presented by aortic SMC from SM-LacZ mice. SM-LacZ mice
constitutively express the ␤-gal transgene in aortic SMC
(Figure 1A). Interestingly, ␤-gal expressing SMC from
SM-LacZ could only be recognized and lysed by ␤-gal497–504
specific CTL after preincubation with IFN␥ (Figure 1B).
Recognition of SMC by MCMV-induced CTL could be
enhanced by exogenous pulsing with ␤-gal497–504 peptide.
Furthermore, SMC lacking the Fas death receptor and Fascompetent C57BL/6 SMC could only be lysed by perforincompetent CTL (Figure 1C). These data indicate that (1)
SMC expressing a protein shared by a cytomegalovirus can
be lysed by virus-specific CTL, and (2) that CTL-mediated
death of SMC is mainly mediated via perforin-dependent
lysis.
The adaptive immune response against MCMV is dominated by CD8⫹ T cells that are required for the termination
of the productive infection and the establishment of
latency.22 MCMV-specific memory CTL responses may
show differences in their expansion and contraction patterns, eg, a rapid expansion can be followed by a pronounced contraction phase or by the continuous increase of
IFN␥ producing memory CTL.23,24 We therefore tested in
a first set of experiments, the CTL responses directed
against the ␤-gal497–504 epitope and the immunodominant
MCMV M45985–993 epitope of MCMV. Analysis with MHC
class I tetramers on days 6, 50 and 100 post infection
revealed that both ␤-gal497–504- and M45985–993-specific
CD8⫹ T cells followed a similar pattern in normo- and
hypercholesterolemic mice with maximal expansion during the acute response, a pronounced contraction and
subsequent establishment of a stable long-term memory
cell population (Figure 2A).
Based on the finding that IFN␥ permits recognition of
aortic SMC by MCMV-induced CTL (Figure 1B) and
because IFN␥ accelerates atherosclerotic lesion development,25 we determined the ability of virus-specific CD8⫹ T
cells to produce IFN␥ using intracellular cytokine staining
(Figure 2B) and ELISPOT assays (Figure 2C and 2D). The
ELISPOT assays were used for measurement of IFN␥secreting cells in the memory phase because this assay
provides a better resolution and accuracy at lower T cell
frequencies. These analyses revealed that neither hyper-
2208
Arterioscler Thromb Vasc Biol.
October 2007
mice, and there was no indication that the ␤-gal transgene in
the vasculature had an influence on MCMV-induced CTL
responses (Figure 2C and 2D). Taken together, the presented
transgenic model provides the means to quantify and to
phenotypically characterize virus-specific CD8⫹ T cells
which recognize a persisting vascular antigen both under
normo- and hypercholesterolemic conditions.
Virus Replication and Lipid Metabolism
Downloaded from http://atvb.ahajournals.org/ by guest on May 13, 2017
It has been described previously that hypercholesterolemia
may negatively influence immune reactivity and consequently alters the host-pathogen interaction with delayed
clearance of viruses,26 bacteria,27 or fungi.28 We therefore
assessed whether hypercholesterolemia in apoE⫺/⫺ and
apoE⫺/⫺⫻SM-LacZ mice influences initial replication and
distribution of MCMV in comparison to normocholesterolemic C57BL/6 and SM-LacZ mice. Polymerase chain
reaction (PCR)-based quantification of MCMV genome
equivalents revealed that spleens and salivary glands were
equally well infected in the four mouse strains (Figure 3A).
Furthermore and in contrast to previous studies in mice,29
we could not observe a modulation of cholesterol levels in
the course of MCMV infection in normo- or hypercholesterolemic mice (Figure 3B). Of particular importance for
this study is that apoE⫺/⫺ and apoE⫺/⫺⫻SM-LacZ mice are
only distinguishable by constitutive ␤-gal expression in the
cardiovascular system, all other MCMV infectionassociated parameters such as T cell responses, viral
distribution, and total cholesterol values were comparable.
Accelerated Atherogenesis in MCMV-Infected
ApoEⴚ/ⴚⴛSM-LacZ Mice
Figure 1. Recognition of aortic ␤-galactosidase transgene by
virus-induced CTL. A, X-Gal staining of aortas from C57BL/6
(left) and SM-LacZ (right) mice. B and C, Lysis of arterial SMC
from SM-LacZ by MCMV-LacZ specific CTL. Effector CTL were
generated from MCMV-LacZ infected C57BL/6 and perforindeficient (PKO) mice using in vitro restimulation with irradiated
␤-gal497–504 peptide pulsed C57BL/6 splenocytes for 5 days.
B, Arterial SMC from C57BL/6 or SM-LacZ were incubated for
24 hours in the absence (left panel) or presence (right panel) of
IFN␥ before analysis in a standard chromium release assay.
C, In vitro restimulated ␤-gal497–504-specific CTL were used as
effectors in a standard chromium release assay using arterial
SMC from C57BL/6 or Fas-deficient (Fas-KO) mice pulsed with
␤-gal497–504 peptide. Data from SMC not treated with IFN␥ are
shown; IFN␥ pretreatment resulted in only slightly enhanced killing of peptide-pulsed SMC by C57BL/6 CTL.
cholesterolemia nor the presence of the ␤-gal-transgene
had a significant impact on the peak expansion of ␤-gal497–504and M45985–993-specific IFN␥-secreting CD8⫹ T cells (Figure
2B). Furthermore, both ␤-gal497–504- and M45985–993-specific
memory CTL were able to secrete IFN␥ following in vitro
restimulation (Figure 2C and 2D). Again, the activity of
anti-MCMV CD8⫹ T cells was not significantly different
between hypercholesterolemic and normocholesterolemic
The impact of infection with ␤-gal recombinant MCMVLacZ on atherosclerotic lesion development was assessed
in the aortic sinus. The most striking observation was the
nearly 200% increase of atherosclerotic lesion formation in
apoE⫺/⫺⫻SM-LacZ versus apoE⫺/⫺ control mice on day 50
after infection (Figure 4A and 4B). The acceleration of
atherogenesis attributable to chronic virus-driven immune
reactivity against the vascular ␤-gal antigen was less
pronounced on day 100 after infection (Figure 4A and 4B).
However, in accordance with a previous report from
Epstein and colleagues,30 we found only a mild enhancement of atherosclerosis through infection of apoE⫺/⫺ mice
with MCMV on day 100 after infection (Figure 4B). These
data indicate that it is mainly the chronic immune reactivity against the persisting MCMV antigen in the vasculature
that exacerbates atherosclerotic lesion formation.
In addition to the accelerated lesion formation, MCMVLacZ–infected apoE⫺/⫺⫻SM-LacZ mice showed significant mononuclear infiltrations both in the neointima (Figure 4A, asterisks) and in the perivascular tissue underlying
the atherosclerotic lesions (Figure 4A, arrow heads). Immunohistological characterization of the vascular inflammatory infiltrates revealed the presence of macrophages
and T cells, with a predominance of CD8⫹ T cells (Figure
5). Semiquantitative in situ analysis revealed that MCMVLacZ–infected apoE⫺/⫺⫻SM-LacZ showed significantly
stronger inflammatory infiltration compared with apoE⫺/⫺
Krebs et al
Immunopathological Mechanisms in Atherogenesis
2209
Downloaded from http://atvb.ahajournals.org/ by guest on May 13, 2017
Figure 2. Kinetics of MCMV-induced CD8⫹ T cell responses. A, Female C57BL/6, apoE⫺/⫺, and apoE⫺/⫺⫻SM-LacZ mice were infected
i.v. with MCMV-LacZ, and tetramer analysis was performed at the indicated days after infection. Mean percentages of tetramer-positive
cells in the CD8 compartment are indicated (⫾SEM; n⫽3). Representative data from 1 of 2 independent experiments are shown. B,
Female mice were infected with MCMV-LacZ and intracellular cytokine staining for IFN␥ was performed on splenocytes on day 6 after
infection using the indicate peptides. Mean percentages of IFN␥⫹CD8⫹ cells are indicated (⫾SEM; nⱖ3). C, For ELISPOT analysis,
5⫻104 MACS-purified CD8⫹ splenocytes were incubated with unpulsed, ␤-gal–, or M45-peptide pulsed dendritic cells, respectively, and
numbers of IFN␥ secreting cells were determined. Representative ELISPOT filters are shown; nd, not done. D, Total numbers of ␤-galor M45-specific IFN␥-producing CD8⫹ splenocytes as determined by ELISPOT assay at the indicated time points after MCMV-LacZ
infection (⫾SEM; nⱖ3); nd, not done. CTL reactivity measured as tetramer-reactivity and intracellular IFN␥ secretion against both ␤-gal
and M45 epitopes, was not detectable in naive normo- or hypercholesterolemic mice (not shown). Statistical analysis using the nonparametric Kruskal–Wallis test indicated no significant difference between the 4 mouse strains (P⬎0.05).
mice, both on day 50 (1.8⫾0.5 versus 0.6⫾0.2; P⬍0.05)
and on day 100 (2.1⫾0.3 versus 1.1⫾0.3; P⬍0.05) after
infection. Furthermore, enumeration of CD8 T cells infiltrating neointima and perivascular space revealed that
MCMV-LacZ infection of apoE⫺/⫺⫻SM-LacZ mice elicited a more pronounced recruitment of these cells compared with infected apoE⫺/⫺ mice; both on day 50 (CD8 T
cells per slide: 20.9⫾8.1 (n⫽13) versus 6.4⫾1.6 (n⫽9);
2210
Arterioscler Thromb Vasc Biol.
October 2007
Figure 3. Early virus distribution and serum
cholesterol levels. A, Amount of virus DNA as
determined by real-time PCR on day 3 after i.v.
infection with 2⫻106 pfu MCMV-LacZ. Statistical analysis using the nonparametric Kruskal–
Wallis test indicated no significant difference
between the different mouse strains (n⫽4,
P⬎0.05). B, Serum cholesterol values in uninfected and MCMV infected apoE⫺/⫺ (hatched
bars) and apoE⫺/⫺⫻SM-LacZ (gray bars) mice
at the indicated time points after infection.
Statistical analysis using the nonparametric
Kruskal–Wallis test indicated no significant difference between the different mouse strains
(P⬎0.05, number of mice per group is indicated; groups were of mixed gender with 50%
females).
Downloaded from http://atvb.ahajournals.org/ by guest on May 13, 2017
P⬍0.05) and on day 100 (40.1⫾6.6 (n⫽8) versus
12.9⫾4.7 (n⫽11); P⬍0.01) after infection. It is thus
conceivable that the abundant CD8⫹ T cells in and around
the atherosclerotic lesions in apoE⫺/⫺⫻SM-LacZ mice
were recruited to this location as a consequence of the
ongoing immune activation during the persistent MCMV
infection.
Discussion
The inflammatory nature of atherosclerosis is mediated by
various factors. The major pathological mechanisms underlying the onset and perpetuation of the chronic immune
activation within the vascular wall include hemodynamic
shear stress leading to the expression of proinflammatory
genes,31 accumulation of dendritic cells at predisposed
sites,32 and systemic immune activation via toll-like receptor (TLR) ligands.33 Understanding and ranking the contribution of the different immunopathological mechanisms
mediating disease initiation and progression is thus essential for the development and evaluation of treatment
strategies. General immune activation in the course of
systemic virus infection may elicit high levels of cytokines
in the circulation. In the context of cytomegalovirus
infection, IFN␥ can be produced by virus-specific NK and
Th cells.34 It is possible that IFN␥ that is generated in the
course of virus infection, either systemically or locally
within the inflamed tissue, could promote CTL-mediated
SMC lysis by virus-specific CTL through upregulation of
MHC I molecules. In human SMC, for example, cytomegalovirus infection can lead to an increased MHC class I
expression in smooth muscle cells, hence modulating their
immunogenicity.35 Nevertheless, the results of this investigation demonstrate that chronic immune reactivity
against a persisting microbial antigen in the arterial wall is
a dominant immunopathological factor during MCMVaccelerated atherosclerosis in hypercholesterolemic apoE⫺/⫺
mice.
Evidence from experimental and natural infections with
herpesviruses supports the notion that general immune
activation by a viral infection is less important for the
inflammatory processes in the vascular wall. For example,
␥-herpesvirus infection of large arteries is associated with
an acute lymphoid panarteritis and chronic obliterating
arteriosclerosis in chicken36 and cattle.37 Furthermore,
murine ␥-herpesvirus 68 (␥HV68) exhibits a prominent
tropism for medial smooth muscle cells of great elastic
arteries38 and, consequently, enhances atherogenesis in
apoE⫺/⫺ mice.17,18 In MCMV infection, viral antigens have
been reported to be expressed in endothelial and smooth
muscle cells of the aorta.29 However, the presence of
MCMV in the aorta is limited to a few weeks after
infection15; a condition under which MCMV only mildly
aggravates atherosclerosis in apoE⫺/⫺ mice. Thus, accumulation of inflammatory cells in the perivascular space and
increased development of atherosclerotic lesions heavily
infiltrated with inflammatory cells, depends probably on
prolonged antigen presentation within the vessel wall, as it
is the case in apoE⫺/⫺⫻SM-LacZ mice. Likewise, factors
that favor MCMV persistence in the vasculature lead to
increased vascular inflammation39 and atherosclerosis.29
Activated T cells are a major fraction of the cellular
components in human atherosclerotic plaques.40 Immunohistological analysis revealed that in advanced plaques of
apoE⫺/⫺ mice, CD4⫹ T cells are prominent in the fibrous
cap and subendothelially, whereas CD8⫹ T cells are
sparse.41 The importance of CD4⫹ T cells in the amplification of atherogenesis has been demonstrated in adoptive
transfer studies where CD4⫹ T cells from apoE⫺/⫺ transferred to immunodeficient apoE⫺/⫺⫻scid/scid mice accelerated lesion formation.42 CD4 T cells are activated during
MCMV infection and help to maintain long-term control of
MCMV in certain cell types within salivary gland tissues.43
It is likely that not only CD8⫹ but also CD4⫹ MCMVspecific T cells have contributed to the observed amplification of atherosclerotic lesions in apoE⫺/⫺⫻SM-LacZ
mice. Furthermore, it may well be that the recently
described dendritic cell network present in atherosclerosis-prone sites of the aorta32 locally presents viral antigens
to both CD4⫹ and CD8⫹ T cells.
Krebs et al
Immunopathological Mechanisms in Atherogenesis
2211
Downloaded from http://atvb.ahajournals.org/ by guest on May 13, 2017
Figure 4. Acceleration of atherosclerosis in
apoE⫺/⫺⫻SM-LacZ mice. A, Aortic sections
were stained with Sudan Red to visualize lipid
deposition on days 50 and 100 post infection.
Average lesion size in apoE⫺/⫺ and apoE⫺/⫺⫻
SM-LacZ is indicated (␮m2⫻103 ⫾SEM).
Asterisks indicate neointimal and arrow heads
indicate perivascular mononuclear cell accumulations. Sections of female mice are shown.
B, Atherosclerotic lesion size in uninfected
apoE⫺/⫺ (3 males and 9 females on day 50; 6
males on day 100) and apoE⫺/⫺⫻SM-LacZ
(1 male, 4 females on day 50; 6 males on day
100) mice or MCMV-LacZ–infected apoE⫺/⫺
(6 males, 8 females on day 50; 2 males and 6
females on day 100) and apoE⫺/⫺⫻SM-LacZ
(3 males, 6 females on day 50; 3 males, 10
females on day 100) mice.
Infections are an important risk factor in atherosclerosis-related diseases such as coronary artery disease or
stroke. It is striking that in particular those infectious
agents which possess a pronounced tropism for cells of the
vascular wall (HCMV or Chlamydia pneumoniae) are the
most prominent in the list of infectious agents that contribute to the “infectious burden”.4,44,45 Taken together
with the data presented in this study, it is most likely that
long-lasting immune reactivity against antigens of
vascular-tropic infectious agents significantly amplifies
Figure 5. Cellular composition of inflammatory lesions in MCMV-LacZ–infected female apoE⫺/⫺ and apoE⫺/⫺⫻SM-LacZ mice. Aortic
sections were stained on day 100 after infection for lipid deposition (Sudan Red), T cells (CD4 and CD8), and macrophages (F4/80).
Representative data from 4 mice per group are shown.
2212
Arterioscler Thromb Vasc Biol.
October 2007
inflammatory reactions within atherosclerotic lesions.
Thus, treatment strategies against atherosclerosis should
aim at reducing exaggerated immune reactivity within the
atherosclerotic lesion without impairing general immune
defense mechanisms against the persisting pathogen.
Acknowledgments
We thank Silvia Behnke and Andre Fitsche for help with
immunohistochemistry.
Sources of Funding
The project received support from the Swiss National Science
Foundation, the Fritz Thyssen Stiftung, the Novartis Foundation for
Biomedical Research and the Jubiläumsstiftung Rentenanstalt.
Disclosures
None.
References
Downloaded from http://atvb.ahajournals.org/ by guest on May 13, 2017
1. Wick G, Knoflach M, Xu Q. Autoimmune and inflammatory mechanisms
in atherosclerosis. Annu Rev Immunol. 2004;22:361– 403.
2. Epstein SE, Zhu J, Burnett MS, Zhou YF, Vercellotti G, Hajjar D.
Infection and atherosclerosis: potential roles of pathogen burden and
molecular mimicry. Arterioscler Thromb Vasc Biol. 2000;20:
1417–1420.
3. Espinola-Klein C, Rupprecht HJ, Blankenberg S, Bickel C, Kopp H,
Victor A, Hafner G, Prellwitz W, Schlumberger W, Meyer J. Impact of
infectious burden on progression of carotid atherosclerosis. Stroke. 2002;
33:2581–2586.
4. Espinola-Klein C, Rupprecht HJ, Blankenberg S, Bickel C, Kopp H,
Rippin G, Victor A, Hafner G, Schlumberger W, Meyer J. Impact of
infectious burden on extent and long-term prognosis of atherosclerosis.
Circulation. 2002;105:15–21.
5. Zhou YF, Leon MB, Waclawiw MA, Popma JJ, Yu ZX, Finkel T,
Epstein SE. Association between prior cytomegalovirus infection and
the risk of restenosis after coronary atherectomy. N Engl J Med.
1996;335:624 – 630.
6. Gattone M, Iacoviello L, Colombo M, Castelnuovo AD, Soffiantino F,
Gramoni A, Picco D, Benedetta M, Giannuzzi P. Chlamydia pneumoniae and cytomegalovirus seropositivity, inflammatory markers,
and the risk of myocardial infarction at a young age. Am Heart J.
2001;142:633– 640.
7. Hendrix MG, Salimans MM, van Boven CP, Bruggeman CA. High
prevalence of latently present cytomegalovirus in arterial walls of
patients suffering from grade III atherosclerosis. Am J Pathol. 1990;
136:23–28.
8. Chiu B, Viira E, Tucker W, Fong IW. Chlamydia pneumoniae, cytomegalovirus, and herpes simplex virus in atherosclerosis of the carotid artery.
Circulation. 1997;96:2144 –2148.
9. Streblow DN, Soderberg-Naucler C, Vieira J, Smith P, Wakabayashi E,
Ruchti F, Mattison K, Altschuler Y, Nelson JA. The human cytomegalovirus chemokine receptor US28 mediates vascular smooth muscle cell
migration. Cell. 1999;99:511–520.
10. Melnychuk RM, Smith P, Kreklywich CN, Ruchti F, Vomaske J, Hall L,
Loh L, Nelson JA, Orloff SL, Streblow DN. Mouse cytomegalovirus M33
is necessary and sufficient in virus-induced vascular smooth muscle cell
migration. J Virol. 2005;79:10788 –10795.
11. Ludewig B, Krebs P, Scandella E. Immunopathogenesis of atherosclerosis. J Leukoc Biol. 2004;76:300 –306.
12. George J, Afek A, Gilburd B, Shoenfeld Y, Harats D. Cellular and
humoral immune responses to heat shock protein 65 are both involved in
promoting fatty-streak formation in LDL-receptor deficient mice. J Am
Coll Cardiol. 2001;38:900 –905.
13. Rott D, Zhu J, Burnett MS, Zhou YF, Wasserman A, Walker J, Epstein
SE. Serum of cytomegalovirus-infected mice induces monocyte chemoattractant protein-1 expression by endothelial cells. J Infect Dis. 2001;184:
1109 –1113.
14. Froberg MK, Adams A, Seacotte N, Parker-Thornburg J, Kolattukudy P.
Cytomegalovirus infection accelerates inflammation in vascular tissue
overexpressing monocyte chemoattractant protein-1. Circ Res. 2001;89:
1224 –1230.
15. Vliegen I, Duijvestijn A, Grauls G, Herngreen S, Bruggeman C, Stassen
F. Cytomegalovirus infection aggravates atherogenesis in apoE knockout
mice by both local and systemic immune activation. Microbes Infect.
2004;6:17–24.
16. Vliegen I, Herngreen SB, Grauls GE, Bruggeman CA, Stassen FR. Mouse
cytomegalovirus antigenic immune stimulation is sufficient to aggravate
atherosclerosis in hypercholesterolemic mice. Atherosclerosis. 2005;181:
39 – 44.
17. Alber DG, Vallance P, Powell KL. Enhanced atherogenesis is not an
obligatory response to systemic herpesvirus infection in the apoEdeficient mouse: comparison of murine gamma-herpesvirus-68 and
herpes simplex virus-1. Arterioscler Thromb Vasc Biol. 2002;22:
793–798.
18. Alber DG, Powell KL, Vallance P, Goodwin DA, Grahame-Clarke C.
Herpesvirus infection accelerates atherosclerosis in the apolipoprotein
E-deficient mouse. Circulation. 2000;102:779 –785.
19. Ludewig B, Freigang S, Jaggi M, Kurrer MO, Pei YC, Vlk L, Odermatt
B, Zinkernagel RM, Hengartner H. Linking immune-mediated arterial
inflammation and cholesterol-induced atherosclerosis in a transgenic
mouse model. Proc Natl Acad Sci U S A. 2000;97:12752–12757.
20. Moessler H, Mericskay M, Li Z, Nagl S, Paulin D, Small JV. The SM 22
promotor directs tissue-specific expression in arterial but not in venous or
visceral smooth muscle cells in transgenic mice. Development. 1996;122:
2415–2425.
21. Ludewig B, Ochsenbein AF, Odermatt B, Paulin D, Hengartner H,
Zinkernagel RM. Immunotherapy with dendritic cells directed against
tumor antigens shared with normal host cells results in severe autoimmune disease. J Exp Med. 2000;191:795– 804.
22. Reddehase MJ. Antigens and immunoevasins: opponents in cytomegalovirus immune surveillance. Nat Rev Immunol. 2002;2:831– 844.
23. Karrer U, Sierro S, Wagner M, Oxenius A, Hengel H, Koszinowski UH,
Phillips RE, Klenerman P. Memory inflation: continuous accumulation of
antiviral CD8⫹ T cells over time. J Immunol. 2003;170:2022–2029.
24. Munks MW, Cho KS, Pinto AK, Sierro S, Klenerman P, Hill AB. Four
distinct patterns of memory CD8 T cell responses to chronic murine
cytomegalovirus infection. J Immunol. 2006;177:450 – 458.
25. Gupta S, Pablo AM, Jiang Xc, Wang N, Tall AR, Schindler C.
IFN-gamma potentiates atherosclerosis in ApoE knock-out mice. J Clin
Invest. 1997;99:2752–2761.
26. Ludewig B, Jaggi M, Dumrese T, Brduscha-Riem K, Odermatt B,
Hengartner H, Zinkernagel RM. Hypercholesterolemia exacerbates
virus-induced immunopathologic liver disease via suppression of
antiviral cytotoxic T cell responses. J Immunol. 2001;166:3369 –3376.
27. Roselaar SE, Daugherty A. Apolipoprotein E-deficient mice have
impaired innate immune responses to Listeria monocytogenes in vivo.
J Lipid Res. 1998;39:1740 –1743.
28. Netea MG, Demacker PN, de Bont N, Boerman OC, Stalenhoef AF,
van der Meer JW, Kullberg BJ. Hyperlipoproteinemia enhances susceptibility to acute disseminated Candida albicans infection in lowdensity-lipoprotein-receptor-deficient mice. Infect Immun. 1997;65:
2663–2667.
29. Berencsi K, Endresz V, Klurfeld D, Kari L, Kritchevsky D, Gonczol E.
Early atherosclerotic plaques in the aorta following cytomegalovirus
infection of mice. Cell Adhes Commun. 1998;5:39 – 47.
30. Hsich E, Zhou YF, Paigen B, Johnson TM, Burnett MS, Epstein SE.
Cytomegalovirus infection increases development of atherosclerosis in
Apolipoprotein-E knockout mice. Atherosclerosis. 2001;156:23–28.
31. Hajra L, Evans AI, Chen M, Hyduk SJ, Collins T, Cybulsky MI. The
NF-kappa B signal transduction pathway in aortic endothelial cells is
primed for activation in regions predisposed to atherosclerotic lesion
formation. Proc Natl Acad Sci U S A. 2000;97:9052–9057.
32. Jongstra-Bilen J, Haidari M, Zhu SN, Chen M, Guha D, Cybulsky MI.
Low-grade chronic inflammation in regions of the normal mouse arterial
intima predisposed to atherosclerosis. J Exp Med. 2006.
33. Mullick AE, Tobias PS, Curtiss LK. Modulation of atherosclerosis in
mice by Toll-like receptor 2. J Clin Invest. 2005;115:3149 –3156.
34. Hengel H, Koszinowski UH, Conzelmann KK. Viruses know it all: new
insights into IFN networks. Trends Immunol. 2005;26:396 – 401.
35. Hosenpud JD, Chou SW, Wagner CR. Cytomegalovirus-induced regulation of major histocompatibility complex class I antigen expression
in human aortic smooth muscle cells. Transplantation. 1991;52:
896 –903.
36. Fabricant CG, Fabricant J, Litrenta MM, Minick CR. Virus-induced
atherosclerosis. J Exp Med. 1978;148:335–340.
Krebs et al
Immunopathological Mechanisms in Atherogenesis
37. O’Toole D, Li H, Roberts S, Rovnak J, DeMartini J, Cavender J,
Williams B, Crawford T. Chronic generalized obliterative arteriopathy in
cattle: a sequel to sheep-associated malignant catarrhal fever. J Vet Diagn
Invest. 1995;7:108 –121.
38. Dal Canto AJ, Swanson PE, O’Guin AK, Speck SH, Virgin HW.
IFN-gamma action in the media of the great elastic arteries, a novel
immunoprivileged site. J Clin Invest. 2001;107:R15–R22.
39. Presti RM, Pollock JL, Dal Canto AJ, O’Guin AK, Virgin HW4.
Interferon gamma regulates acute and latent murine cytomegalovirus
infection and chronic disease of the great vessels. J Exp Med. 1998;188:
577–588.
40. Hansson GK, Holm J, Jonasson L. Detection of activated T lymphocytes
in the human atherosclerotic plaque. Am J Pathol. 1989;135:169 –175.
41. Zhou X, Stemme S, Hansson G. Evidence for a local immune response in
atherosclerosis. CD4⫹ T cells infiltrate lesions of apolipoprotein-Edeficient mice. Am J Pathol. 1996;149:359 –366.
2213
42. Zhou X, Nicoletti A, Elhage R, Hansson GK. Transfer of CD4(⫹) T cells
aggravates atherosclerosis in immunodeficient apolipoprotein E knockout
mice. Circulation. 2000;102:2919 –2922.
43. Jonjic S, Mutter W, Weiland F, Reddehase MJ, Koszinowski UH.
Site-restricted persistent cytomegalovirus infection after selective
long-term depletion of CD4⫹ T lymphocytes. J Exp Med. 1989;169:
1199 –1212.
44. Blankenberg S, Rupprecht HJ, Bickel C, Espinola-Klein C, Rippin G,
Hafner G, Ossendorf M, Steinhagen K, Meyer J. Cytomegalovirus
infection with interleukin-6 response predicts cardiac mortality in
patients with coronary artery disease. Circulation. 2001;103:
2915–2921.
45. Corrado E, Rizzo M, Tantillo R, Muratori I, Bonura F, Vitale G, Novo S.
Markers of inflammation and infection influence the outcome of patients
with baseline asymptomatic carotid lesions: a 5-year follow-up study.
Stroke. 2006;37:482– 486.
Downloaded from http://atvb.ahajournals.org/ by guest on May 13, 2017
Downloaded from http://atvb.ahajournals.org/ by guest on May 13, 2017
Chronic Immune Reactivity Against Persisting Microbial Antigen in the Vasculature
Exacerbates Atherosclerotic Lesion Formation
Philippe Krebs, Elke Scandella, Beatrice Bolinger, Daniel Engeler, Simone Miller and Burkhard
Ludewig
Arterioscler Thromb Vasc Biol. 2007;27:2206-2213; originally published online July 26, 2007;
doi: 10.1161/ATVBAHA.107.141846
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2007 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/27/10/2206
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2007/09/20/ATVBAHA.107.141846.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
Materials and Methods
Mice
SM-LacZ, perforin-deficient (PKO), and Fas-deficient (Fas-KO) mice were obtained from the
Institut für Labortierkunde (University of Zurich, Switzerland) and C57BL/6 were from
Charles River (Sulzfeld, Germany). ApoE-/- mice were obtained from the Jackson
Laboratories (Bar Harbor; ME) and maintained locally. ApoE-/-×SM-LacZ mice were
generated by crossing SM-LacZ mice to ApoE-/- background. The presence of the βgal
transgene was determined by PCR from genomic DNA; ApoE-deficiency was determined by
measuring cholesterol values in serum. All animals were kept under SPF conditions and fed
with normal chow diet. Experiments were carried out with age (6-8 weeks) and sex-matched
animals. Experiments were performed in accordance with Swiss kantonal and federal
legislations.
Viruses and peptides
Recombinant MCMV expressing the βgal protein under the transcriptional control of the
human CMV ie1/ie2 promoter-enhancer (MCMV-LacZ RM427 1) was kindly provided by
Prof. E. S. Mocarski (Stanford University, San Francisco). MCMV-LacZ was propagated and
titrated on NIH 3T3 cells (ECACC, UK) and injected intravenously at a dose of 2×106 pfu.
Both βgal497–504 (ICPMYARV)
2
and MCMV M45985-993 (HGIRNASFI)
3
peptides were
purchased from Neosystem (Strasbourg, France).
Antibodies
Anti-CD8-FITC and anti-IFNγ-PE were obtained from BD PharMingen (Basel, Switzerland).
For PBL samples, erythrocytes were lysed with FACS Lysing Solution (BD PharMingen).
Cells were analyzed with a FACScalibur flow cytometer using the CellQuest software (BD
Biosciences). The cells were analyzed by flow cytometry gating on viable leukocytes using 7aminoactinomycin D (Sigma).
Construction of tetrameric MHC class I-peptide complexes and flow cytometry
MHC class I monomers complexed with βgal (H-2Kb) or M45 peptides (H-2Db) were
produced as previously described
4
and tetramerized by addition of streptavidin-PE
(Molecular Probes, Eugene, OR). At the indicated time points following infection, animals
were bled and single cell suspensions were prepared from spleens. Aliquots of 5×105 cells or
3 drops of blood were stained using 50 µl of a solution containing tetrameric class I-peptide
complexes at 37°C for 10 min followed by staining with anti-CD8-FITC (BD Pharmingen) at
4°C for 20 min. Absolute cell counts were determined by counting leukocytes in an improved
Neubauer chamber.
Chromium release assay
Arterial smooth muscle cells which were treated with 1000 U IFNγ (Serotec, Düsseldorf,
Germany) for 24 h or left untreated, were used as target cells in a standard 51Cr release assay.
Cells were labeled with 200 µCi 51Cr (EGT Chemie, Tägerig, Switzerland) for 1 h at 37°C. A
total of 104 target cells/well were incubated for 4 h in 96-well round bottom plates with 3-fold
serial dilutions of effector cells, starting at an effector:target ratio of 90:1. Total splenocytes
from MCMV-LacZ infected C57BL/6 or PKO mice were restimulated with βgal497–504
(ICPMYARV) 2 peptide-labeled, irradiated (30 Gy) C57BL/6 splenocytes for 5 days in vitro.
Following this restimulation period, 5 - 10% of the CD8 T cells stained positive for the
βgal497–504 tetramer (not shown). EL-4 cells with and without peptide served as controls (not
shown).
Intracellular cytokine staining and ELISPOT
Specific ex vivo production of IFNγ was determined by intracellular cytokine staining or
ELISPOT assay. Organs were removed at the indicated time points following infection with
MCMV-LacZ. For intracellular cytokine staining, single cell suspensions of 1×106
splenocytes were incubated for 5 h at 37°C in 96-well round-bottom plates in 200 µl culture
medium containing 25 U/ml IL-2 and 5 µg/ml Brefeldin A (Sigma). Cells were stimulated
with phorbolmyristateacetate (PMA, 50 ng/ml) and ionomycin (500 ng/ml) (both purchased
from Sigma, Buchs, Switzerland) as positive control or left untreated as a negative control.
For analysis of peptide-specific responses, cells were stimulated with 10-6 M βgal or M45
peptide and surface stained with anti-CD8-FITC (clone 53.6.72.4). Following the surface
staining, cells were fixed and permeabilized with Cytofix/CytopermTM (Becton Dickinson) in
accordance with the manufacturer's protocol. Cells were stained intracellularly with antiIFNγ-PE (clone AN18) in permeabilization buffer. The percentage of CD8+ T cells producing
IFNγ was determined using a FACScalibur flow cytometer. For ELISPOT analysis, CD8+ T
cells were positively selected from splenocytes using anti-CD8 magnetic beads (Miltenyi,
Bergisch-Gladbach, Germany). 5×104 MACS-purified responder CD8+ T cells and 2×104
autologous bone marrow-derived stimulator dendritic cells were incubated in the presence or
absence of βgal or M45 peptides in 96-well ELISPOT filter plates (Millipore) coated with an
affinity purified anti-IFNγ capture antibody (clone AN18). Purified CD8+ T cells stimulated
with PMA (2.5×10-7 M) and ionomycin (1.25 µg/ml) served as positive control. After
overnight incubation, IFNγ secretion was revealed using a biotin-conjugated anti-IFNγ
detection antibody (BD Biosciences) and streptavidin-conjugated alkaline phosphatase
(Dianova, Hamburg, Germany). Reactive spots were visualized with 5-bromo-4-chloro-3indol-phosphate-toluidin
(BCIP,
AppliChem,
Darmstadt,
Germany)
and
nitroblue-
tetrazoliumchlorid (NBT, AppliChem, Darmstadt, Germany). Spots were counted with an
ELISPOT reader and analyzed with the software ELISPOT 3.1SR (AID, Strassberg,
Germany).
Extraction and quantification of MCMV genome copy numbers in tissue
Tissues were homogenized using a MagNA Lyser instrument (Roche Diagnostics). Whole
DNA was isolated using the High Pure PCR Template Preparation Kit (Roche Diagnostics).
Real-time quantitative PCR was performed using a LightCycler (Roche Diagnostics) and the
LightCycler FastStart DNA MasterPLUS HybProbe reaction mix (Roche Diagnostics)
according to the manufacturer's protocol. Data analysis was performed with LightCycler
Software 3 (Roche Diagnostics). Oligonucleotides were purchased from Microsynth (Balgach,
Switzerland). The following oligonucleotides from MCMV glycoprotein B sequences were
used as primers for real-time quantitative PCR: 5'-AGGGCTTGGAGAGGACCTACA-3' and
5'-GCCCGTCGGCAGTCTAGTC-3'. The following oligonucleotides were used as probes: 5'
GCTCTATTGATACTCCGCGCGTTA
3'
and
5'
AACAGCTAGACGACAGCCAACGCACCG 3'.
Evaluation of serum cholesterol
Serum cholesterol was determined by enzymatic methods at the Institute for Clinical
Chemistry and Hematology of the Kantonal Hospital St. Gallen with a Hitachi 917 analyzer.
Statistical data analysis
Statistical data analysis was performed using GraphPad Prism version 4.03 for Windows
(GraphPad Software Inc., San Diego California USA).
References
1. Manning WC, Mocarski ES. Insertional mutagenesis of the murine cytomegalovirus
genome: one prominent alpha gene (ie2) is dispensable for growth. Virology.
1988;167:477-484.
2. Oukka M, Cohen-Tannoudji M, Tanaka Y, Babinet C, Kosmatopoulos K. Medullary
thymic epithelial cells induce tolerance to intracellular proteins. J Immunol.
1996;156:968-975.
3. Gold MC, Munks MW, Wagner M, Koszinowski UH, Hill AB, Fling SP. The murine
cytomegalovirus immunomodulatory gene m152 prevents recognition of infected cells
by M45-specific CTL but does not alter the immunodominance of the M45-specific
CD8 T cell response in vivo. J Immunol. 2002;169:359-365.
4. Altman JD, Moss PAH, Goulder PJR, Barouch DH, McHeyzer-Williams MG, Bell JI,
McMichael AJ, Davis MM. Phenotypic analysis of antigen-specific T lymphocytes.
Science. 1996;274:94-96.