Download A Novel Human BTB-kelch Protein KLHL31, Strongly Expressed in

Mol. Cells OS, 443-453, November 30, 2008
Molecules
and
Cells
©2008 KSMCB
A Novel Human BTB-kelch Protein KLHL31,
Strongly Expressed in Muscle and Heart, Inhibits
Transcriptional Activities of TRE and SRE
Weishi Yu1,2,4, Yongqing Li1,4, Xijin Zhou1, Yun Deng1, Zequn Wang1, Wuzhou Yuan1, Dali Li2,
Chuanbing Zhu1, Xueying Zhao1, Xiaoyang Mo1, Wen Huang1, Na Luo1, Yan Yan1, Karen Ocorr1,3,
Rolf Bodmer1,3,*, Yuequn Wang1,*, and Xiushan Wu1,*
The Bric-a-brac, Tramtrack, Broad-complex (BTB) domain is a
protein-protein interaction domain that is found in many zinc
finger transcription factors. BTB containing proteins play
important roles in a variety of cellular functions including
regulation of transcription, regulation of the cytoskeleton,
protein ubiquitination, angiogenesis, and apoptosis. Here, we
report the cloning and characterization of a novel human
gene, hieiPN, from a human embryonic heart cDNA library.
The cDNA of hieiPN is 5743 bp long, encoding a protein
product of 634 amino acids containing a BTB domain. The
protein is highly conserved across different species. Western
blot analysis indicates that the KLHL31 protein is abundantly
expressed in both embryonic skeletal and heart tissue. In
COS-7 cells, KLHL31 proteins are localized to both the nucleus and the cytoplasm. In primary cultures of nascent
mouse cardiomyocytes, the majority of endogenous KLHL31
proteins are localized to the cytoplasm. KLHL31 acts as a
transcription repressor when fused to GAL4 DNA-binding
domain and deletion analysis indicates that the BTB domain
is the main region responsible for this repression. Overexpression of KLHL31 in COS-7 cells inhibits the transcriptional
activities of both the TPA-response element (TRE) and serum
response element (SRE). KLHL31 also significantly reduces
JNK activation leading to decreased phosphorylation and
protein levels of the JNK target c-Jun in both COS-7 and Hela
cells. These results suggest that KLHL31 protein may act as a
new transcriptional repressor in MAPK/JNK signaling pathway to regulate cellular functions.
INTRODUCTION
The Bric-a-brac, Tramtrack, Broad-complex (BTB) or POZ
(Poxvirus zinc finger) domain was originally identified as a motif
present in the aêçëçéÜáä~= ãÉä~åçÖ~ëíÉê Tramtrack (Ttk) and
Broad Complex (BR-C) zinc finger proteins (Couderc et al.,
2002; Zollman et al., 1994). In most BTB containing proteins,
the BTB domain acts as a protein-protein interaction module
that is able to both self-associate and interact with non-BTB
proteins (Geyer et alK, 2003). This evolutionarily conserved
protein-protein interaction motif is often found at the NH2terminus of developmentally regulated zinc-finger transcription
factors, as well as in some actin associated proteins bearing
the kelch motif. The kelch motif is an ancient and evolutionarilywidespread sequence motif of 44-56 amino acids. It occurs as
groups of five to seven repeats and has been identified in proteins of otherwise distinct molecular architecture, termed the
kelch-repeat superfamily (Prag et al., 2003). Recently, the
BACK domain (BTB and COOH-terminal kelch) has been described in several BTB-kelch proteins, however, its function is
unknown (Stogios et al., 2004). The BTB-kelch motif is a highly
evolutionarily conserved domain, the motif has been found in
an increasing number of proteins including poxvirus, `~ÉåçêJ
Ü~ÄÇáíáë=ÉäÉÖ~åë, wÉÄê~ÑáëÜ, and humans. It is generally found
at the NH2 terminus of either actin-binding or, more commonly,
nuclear transcriptional regulatory proteins (Li et al., 1999). Of
the full-length human genes that encode a BTB domain, approximately two-thirds also encode C2H2 zinc finger modules;
of the remaining one-third approximately 50% also contain the
kelch motif (Carim-Todd et al., 2001).
Diverse cellular functions have been identified for a few BTB
containing proteins, including transcription regulation (Ahmad et
al., 2003; Melnick et al., 2000), cytoskeleton regulation (Kang et
al., 2004; Ziegelbauer et al., 2001), tetramerization and gating
of ion channels (Kreusch et al., 1998; Minor et al., 2000), protein ubiquitination/degradation (Kobayashi et al., 2004; Stogios
et al., 2005; Wilkins et al., 2004; Xu et al., 2003), tumorogenesis (Nakayama et al., 2006), and apoptosis (Qi et al., 2006).
The BTB protein PLZF is a growth suppressor that blocks proliferation and myeloid differentiation through silencing of target
genes, including cell cycle regulators (Shaknovich et al., 1998;
Yeyati et al., 1999). KLHL10, like other BTB/kelch proteins,
1
The Center for Heart Development, Key Lab of Ministry of Education for Development Biology and Protein Chemistry, College of Life Sciences, Hunan Normal
University, Changsha, 410081, Hunan, Peoples’ Republic of China, 2Institute of Biomedical Sciences and School of Life Sciences, East China Normal University,
500 Dongchuan Road, Shanghai 200241, China, 3Burnham Institute for Medical Research, CA 92037, USA, 4These authors contributed equally to the work.
*Correspondence: [email protected] (XW), [email protected] (YW), [email protected] (RB)
Received December 8, 2007; revised August 3, 2008; accepted August 20, 2008; published online August 22, 2008
Keywords: BTB domain, deletion analysis, JNK, overexpression, transcriptional repressor, TRE
444
Suppression of MAPK/JNK Pathway by KLHL31
interacts with CUL3 to form a CUL3-based ubiquitin E3 ligase
that functions specifically in the testis to mediate protein ubiquitination during spermiogenesis (Wang et al., 2006). KLHL6
plays an important role in BCR (B-cell antigen receptor) signal
transduction and formation of the full germina center response
(Kroll et al., 2005). The KRIP6 protein can directly regulate
native kainate receptors and provides the first evidence for
direct functional regulation by a BTB-kelch protein of a mammalian glutamate receptor (Laezza et al., 2007). Another BTBkelch protein KLEIP is a novel regulator of endothelial function
during angiogenesis that controls the VEGF-induced activation
of Rho GTPases (Tanju et al., 2007). However, the physiological and biochemical functions of numerous BTB-kelch proteins
remain uncharacterized.
With the aim of identifying genes with transcription regulatory
activity involved in human heart development and diseases, a
novel BTB-kelch gene hieiPN was cloned from an embryonic
cDNA heart library. KLHL31 encodes a predicted protein of 634
amino acids containing a BTB domain at the NH2-terminus, six
kelch repeats at the COOH-terminus, and a BACK domain
between the BTB and Kelch domains. Western blot analysis
shows that a 70 kDa transcript product is expressed in several
early human embryonic tissues, with an especially strong level
of expression in skeletal muscle and heart. We show that the
KLHL31 protein has strong transcriptional suppression activity
when fused to GAL4 DNA-binding domain in COS-7 cells.
Overexpression of KLHL31 in COS-7 inhibits the transcriptional
activities of TRE/AP-1 (TPA-response element) and SRE (serum response element) in a dose dependent fashion. We show
that the KLHL31 protein inhibits the transcriptional activity of
TRE in the presence of c-jun overexpression. Our data also
suggest that KLHL31 may play a role in mediating UV-induced
phosphorylation of JNK in the MAPK signal pathway.
MATERIALS AND METHODS
Construction of cDNA library of human embryonic heart
Total RNA from 20-week human embryo heart was extracted
using standard methods as previously described (Ai et al.,
2007). Embryos were obtained with the consent of the patients
and according to the guidelines approved by Hunan Nomal
University of Ethics Committee, and with the approval of the
Changsha Women and Children’s Hospital, People’s Republic
of China. Isolated RNA was pretreated with DNase I (RNase
free) to eliminate DNA contamination. mRNA preparation and
reverse transcription reactions were performed using a cDNA
PCR Library Kit and cDNA Synthesis kit according to manufacturer’s protocol (TaKaRa Biotechnology, China). Briefly, 5 μg
mRNA was purified from 500 μg total RNA using Rapid
mRNA™ purification Kit (Amresco, Solon, USA). Reverse transcription reactions were performed with the purified embryonic
heart mRNA and oligo dT-RA primer according to the cDNA
Synthesis kit protocol. After Cassette Adaptor Ligation reactions
using cDNA PCR Library Kit, cDNA amplification reactions
were performed with RA (5′-CTGATCTAGACCTGCAGGCTC3′), CA primer (5′-CGTGGTACCATGGTCTAGAGT-3′), and Ex
Taq (TaKaRa Biotechnology, China).
Blast searching and bioinformatics analysis
The nucleotide sequence of human hieiPN (NCBI Gene ID:
401265) was obtained from the NCBI website (http://www.ncbi.
nlm.nih.gov). BLASTn program was used to search a human
EST database. The Blastn program was applied to identify the
cytological locus of genes and to look for exons and introns.
The homologs of KLHL31 were found with BLASTp, and the
sequence alignment and phylogenetic tree analysis were performed with MegAlign program (BGI Life Tech, China) (Cai et
al., 2006).
Cloning of KLHL31 and rapid amplification of 5′ cDNA
ends (5′RACE)
PCR was performed using a PCRSPRINT reactor (Thermo
Fisher Scientific Inc, Shanghai, China) with one pair of degenerate oligonucleotide primers P1 and P2 (Table 1) corresponding to the DNA sequence of KLHL31 ORF (open reading
frame) (Accession number: NM_001003760). Amplification was
carried out at 94°C, 4 min; 94°C, 30 s; 60°C, 30 s; and 72°C, 2
min for 35 cycles; then 72°C, 10 min. The amplification products were separated by agarose gel and the bands were cloned
into a pMD18-T vector (TaKaRa Biotechnology, China). Transformants were randomly chosen and sequenced with DNA
Sequencer (ABI PRISM 3730, USA) according to the manufacturer’s procedures.
5′-RACE was performed using a SMART™ RACE cDNA
Amplification Kit (TaKaRa Biotechnology, China). The primer
specific for the 5′ end of the cDNA was PR1, and the nested
primer was PR2 (Table 1). All the PCR products were then
cloned into pMD18-T-vector (TaKaRa Biotechnology, China)
and sequenced. Sequence analysis was performed using the
BLASTn program from NCBI. Finally, they were assembled into
contigs to complete the full-length cDNA.
Expression of GST fusion proteins and preparation of
KLHL31 polyclonal antibody
For GST fusion proteins expresion, the PCR products of
KLHL31 and KLHL31 (170-410 aa) were cloned into the
pGEX4T-1 vector at the EÅçRI sites, and the insertion was
confirmed by DNA sequencing. The primers for KLHL31 and
KLHL31 (170-410aa) were P2S, P2AS and PE2S, PE2AS,
respectively (Table 1). The recombinant fusion protein vector
was transformed and expressed in= bKÅçäá BL21 (Invitrogen,
Carlsbad, US). Bacteria were grown at 37°C until the culture
reached an OD600 of 0.4-0.6, and expression was induced by
adding 0.2 mM isopropyl-beta-a-thiogalactopyranoside (IPTG)
for 6 h at 26°C. After sonication for 15 min on ice, the bacteria
were centrifuged at 12,000 rpm= for 10 min at 4°C to obtain
supernatants containing the GST-KLHL31 and GST-KLHL31
(170-410 aa)=proteins. The soluble fusion protein was purified
on a glutathione-Sepharose column (Amersham Biosciences
UK, UK) and subjected to preparative scale SDS-PAGE. The
major band was excised and finally eluted with 10 mM glutathione in 50 mM Tris-HCl (pH 8.0). The GST-KLHL31 (170410 aa)=fusion protein was used to immunize rabbits for polyclonal antiserum production and the polyclonal antibody was
purified from the sera using 60% (NH4)2SO4 salt-out and NHSactivated Sepharose 4 Fast Flow (Amersham Biosciences UK,
UK). The antibody specificity was confirmed by Western blotting using recombinant KLHL31 protein expressed in bacterial
and eukaryotic cells.
Tissue protein extraction
Human tissues from therapeutically aborted fetuses (16 weeks)
were obtained under the approval of Changsha Women and
Children’s Hospital, People’s Republic of China, with the consent of the patients, and with the approval of Hunan Nomal
University of Ethics Committee. The following fetal tissues were
used: brain, kidney, heart, liver, lung, muscle, stomach and
small intestine. Protein extracts were prepared from frozen
human tissues (0.2 g) pulverized in liquid nitrogen to fine powders. Extraction buffer [1 ml: 7 M Urea, 2 M Thiourea, 60 mM
Weishi Yu et al.
Table 1. Sets of specific oligonuleotide primers
Primer Orientation Nucleotide sequence
P1
Sense
P2
Anitsense 5′ TCTACCTGGGCTCAGATACTGA 3′
5′ AACAGTGTATTTGCCAACATGG 3′
PR1
Antisense 5′ TTCTCAACACTCATCTCCCGTAT 3′
PR2
Antisense 5′ CTGAAGATAAACAGCAGCAGAAAT 3′
P2S
Sense
5′ TGAATTCGCCAACATGGCACCCAAA 3′
P2AS Antisense 5′ CGGAATTCGATCTACCTGGGCTCAGATACT 3′
PE2S Sense
5′ GTGAATTCCTGATACGGGAGATGAGTG 3′
PE2AS Antisense 5′ ATGAATTCGCTCAGGCTGAAGTGC 3′
P3
Antisense 5′ TAGTCGACCGCAGATACTGACTGGCACAG 3′
P4
Antisense 5′ GGAATTCGTCAAGGGAGTATGTTTCAGCA 3′
P5
Sense
5′ GGGAATTCAGTCCTCGTCACTGTTGG 3′
DTT, 4% CHAPS, 2% pharmalyte 3-10, 1.4 mg/ml PMSF] was
added to the powdered tissue and the mixture was incubated
on ice for 30 min with repeated shaking and vortex-mixing
every 10 min. Mixtures were centrifuged at 14,000 rpm at 4°C
for 30 min. The supernatants containing the tissue extracts
were collected and stored at -80°C until use. Sample protein
content was estimated using the Thermo Scientific Pierce BCA
Protein Assay (Thermo Scientific, USA).
Plasmid construction
To generate a fusion protein between KLHL31 and enhanced
green fluorescent protein (EGFP), the KLHL31 ORF was amplified by PCR (primer P2S, P3) (Table 1) and then subcloned
into the bÅçRI and p~äI sites of the pEGFP-N2 vector with the
TGC codon replacing the TGA stop codon in the KLHL31 coding sequence. To generate a fusion protein of KLHL31 with
GAL4 or FLAG tag, the KLHL31 ORF was amplified by PCR
with primer P2S, P2AS (Table 1) and then subcloned in-frame
to the bÅçRI site of the pCMV-BD and pCMV-Tag2B, respectively. To identify which domain(s) of KLHL31 contribute to its
transcriptional activity, we generated three GAL4-BD fusion
proteins corresponding to the different functional domains of
KLHL31 for our deletion analysis. The BACK fragment was
cleaved from pGEX4T-1-KLHL31 (170-410aa) with bÅçRI and
inserted into the pCMV-BD vector producing GAL4-BD-BACK.
The BTB and Kelch-repeat fragments were amplified by PCR
with primers P2S, P4 and P5, P2AS (Table 1) for the GAL4BD-BTB and GAL4-BD-Kelch constructs, respectively, and
then subcloned inframe into the bÅçRI site of the pCMV-BD
expression vector.
Cell culture, transient transfection, and subcellular
localization analysis
COS-7 and Hela cells were maintained and passaged according to standard methods in Dulbecco’s Modified Eagle Medium
(DMEM, Gibco BRL, US) supplemented with 10% fetal calf
serum (FCS) in an humidified atmosphere of 95% air and 5%
CO2. Neonatal mouse cardiomyocytes were cultured as described previously with minor modifications (Fu et alK, 2005).
Briefly, left ventricles were isolated in ice-cold ADS buffer and
cultured by a series of digestions with a mixture of pancreatin
(0.5 mg/mL) and collagenase (0.6 mg/ml) at 37°C. Non myocyte contamination was minimized by preplating cells onto tissue culture dishes (Falcon) at 37°C for 30 min. The cells were
plated at a density of 6 million per 10 cm primeria plate. The
cardiomyocytes were re-suspended in 5% myocyte media con-
445
taining BrdU (0.1 mM).
COS-7 Cells were transfected with pEGFP-N2-KLHL31 using LipofectAMINE (Invitrogen, USA) according to the method
described previously (Cai et al., 2006). The 24 h after transfection, cells were fixed with 4% paraformaldehyde for 15 min and
washed with PBS three times and nuclei were stained with 4′,
6′-diamidino-2-phenylindole hydrochloride (DAPI, Roche, Basel,
Switzerland). Subcellular localization of the EGFP-KLHL31
fusion protein was detected using an inverted fluorescence
microscopy (E400, Nikon).
Since KLHL31 is highly conserved between mouse and human (identity 92%), affinity purified rabbit polyclonal anti-human
KLHL31 (1:100) was applied as the primary antibody to explore
distribution of endogenous KLHL31 protein in primary nenonatal mouse cardiomyocytes. F(ab’)2-PE-Cy3, goat anti-rabbit IgG
(Santa Cruz Biotechnology Inc., USA) was used as secondary
antibody. Immunostaining was performed as previously described (Kim et al., 2003). Briefly, cells cultured 48 hours were
fixed with cold methanol and were then blocked for 20 min in
PBS, 1% bovine serum albumin, 10% goat serum, and 0.05%
Triton X-100. Next, the cells were incubated in primary antibody
diluted in PBS, 5% goat serum, and 0.2% Triton X-100 for 1.5 h
followed by secondary antibodies for 1 h. Cells were stained
with Hoechst 33258 (Molecular Probes, USA) to visualize nuclei and mounted with Prolong mounting medium (Invitrogen,
USA), and examined using a fluorescence microscope.
Transient expression reporter gene assay
The pL8G5-Luc and pLexA-VP16 constructs were used for
mammalian cell transfection in the luciferase reporter assay
(Cai et al., 2006). To examine the potential transcriptional activity of KLHL31, the pCMV-BD-KLHL31, pCMV-BD-BTB, pCMVBD-BACK, pCMV-BD-Kelch, and pCMV-BD were transiently cotransfected into COS-7 cells along with the pL8G5-Luc reporter
and pLexA-VP16 using LipofectAMINE as described above (Cao
et al., 2005). In order to test the transcriptional regulation of
KLHL31 in the MAPK signaling pathway, the PathDetect AP-1
cis-Reporting System (pTRE-Luc) and the PathDetect SRE cisReporting System (pSRE-Luc) from Stratagene were used.
pFA2-cJun or pFA2-cfos was co-transfected with pTRE-Luc or
pSRE-Luc as shown in Fig. 5. The luciferase activity assay was
performed according to the protocols of Stratagene (Cao et al.,
2005). The luciferase activity was normalized for transfection
efficiency by co-transfection with pCMV-lacZ. The data presented
are the mean of three individually transfected wells. The experiments were performed in triplicate.
Western blotting analysis
The expression pattern of KLHL31 was analyzed using Western blotting analysis. The 50 μg protein of each tissue sample
extract was separated by 10% SDS polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride (PVDF)
membrane. After blocking with 5% skimmed milk in TBS-T [150
mM NaCl, 10 mM Tris-HCl (pH 7.5) and 0.1% tween 20], the
membrane was incubated with the first antibody, anti-KLHL31
prepared in this study or with anti-β-actin antibodies from Santa
Cruz (Cell Signaling Technology Inc., USA). The secondary
antibody was a horseradish peroxidase-conjugated (HRP) goat
anti-rabbit IgG antibody (Chemicon International Inc., USA),
and detection was performed using the DAB and H2O2. For cell
total protein western analysis, COS-7 and Hela cells transfected with pCMV-Tag2B or pCMV-Tag2B-KLHL31 were lyzed
in RIPA-lysis buffer (20 mM Tris-HCl (pH 8.0), 150 mM NaCl,
50 mM NaF，2 mM EDTA, 1 mM Na3VO4, 1% NP-40, 1 μg/ml
Leupeptin，1 μg/ml Pepstatin，1 mM PMSF). PVDF mem-
446
Suppression of MAPK/JNK Pathway by KLHL31
brane was incubated with the first antibody of anti-Flag or antic-Jun antibodies from Cell Signaling Technology (Cell Signaling
Technology Inc., USA).
UV irradiation and starvation treatment
UV irradiation was performed as described previously (Rozek et
al., 1993). The 24 h after transfection, cells were transferred to
DMEM without serum and immediately treated with 100 J/m2 of
UV irradiation using a calibrated UV light source (General Electric, UVP UVGL-25). After treatment with the aforementioned
agents, the cells were incubated for 40 min at 37°C for JNK/cJun phosphorylation assays. PVDF membrane was incubated
with the first antibody: c-Jun, c-fos, or phospho-c-Jun (Ser73),
and SAPK/JNK or phospho-SAPK/JNK (Thr183/Tyr185) antibodies from Cell Signaling Technology (CST, US). The secondary antibody was an HRP goat anti-rabbit IgG antibody
(Chemicon International Inc., Canada), and detection was performed using the Amersham ECL Plus Western Blotting Detection System (GE Healthcare, UK).
RESULTS
Molecular characterization and evolutionary conservation
of the KLHL31 gene
We screened the human EST database with the partial nucleotide sequence of the human hieiPN gene. To confirm the
cDNA sequences identified from the database, one pair of
primers (P1 and P2, Table 1) based on the mRNA sequences
(NM_001003760) was used to carry out standard PCR using
the human embryonic heart cDNA library as template. A single
1905 bp fragment was obtained under standard PCR conditions and subcloned into a T-vector. Sequence analysis indicated that the PCR product included the partial hieiPN cDNA
sequence.
To obtain the full-length cDNA of hieiPN, 5′RACE was performed using 5′-gene specific nested primers: 5′ TTCTCAACACTCATCTCCCGTAT 3′ and 5′CTGAAGATAAACAGCAGCAGAAAT 3′ (Supplementary Fig. 1). These procedures yielded
approximately a 600-bp DNA for 5′ RACE fragment, the product was then cloned and sequenced. An analysis of the fragment suggested that it was a cDNA fragment from the human
gene hieiPN. A sequence of 5743 bp constituting the fulllength gene was assembled, and the nucleotide sequence
reported here is available in GenBank with accession number
EF633513.
The complete sequence of the hieiPN cDNA is 5743-bp in
length and contains a putative open-reading frame of 1905
nucleotides. There is a Kozak sequence, AACATGG, in the
translational start site and there is a potential polyadenylation
signal, AATAAA, in the 3′ untranslated region (UTR). The protein predicted from the open-reading frame contains 634 amino
acids and has a calculated relative molecular mass of 70.2 kDa.
Furthermore, analysis of the KLHL31 using the SMART
program indicated the presence of a BTB domain at the NH2terminus and six-kelch motifs in the COOH-terminus of KLHL31
protein (Fig. 1A). Comparison of the KLHL31 sequence with the
genomic sequence shows that KLHL31 maps to chromosome
region 6p12.1 and spans approximately 18 kb on the genome.
The KLHL31 gene consists of three exons and two introns, and
all exon-intron junctions contain the gt/ag consensus splice site
(Table 2).
BLAST searches using the KLHL31 sequence identified
closely related sequences in `K=ÉäÉÖ~åë, aêçëçéÜáä~, zebrafish,
uK=íêçéáÅ~äáë, chicken, and mouse. Sequence comparison of the
BTB motif among its orthologs indicates that the degree of
Table 2. Genomic structure of the hieiPN gene
Intron
Exon
Number Size
Intron
Size
I
108
AAGGAGGgtaaggagc 10290
tctttttagCAAGCTC
II
1205
TCTGCAGgtacttgatct
catttccagATACGAT
III
4430
1765
Genomic organization of the KLHL31 gene from 6p12.1. Exon and intron
sizes are given in base pairs. Intronic and exonic sequences are shown
in lower-case and upper-case characters, respectively. The acceptorsplice site ~Ö and the donor-splice site Öí are shown in bold.
conservation in this domain is quite high among the different
family members, especially in vertebrates (Fig. 1B-a). We then
aligned the sequence containing the BACK and Kelch-repeats
with their orthologues. This comparison shows that BACK and
Kelch domains are also conserved during evolution from `K=ÉäÉJ
Ö~åë to aêçëçéÜáä~, and mouse to human (Figs. 1B-b and 1B-c).
A phylogenetic tree analysis using DNAstar software suggests
that KLHL31 is an evolutionarily conserved gene (Fig. 1C).
Preparation and identification of anti-KLHL31 antibody
In order to examine the expression of the KLHL31 gene, we
generated antibodies using the GST-KLHL31-(170-410aa) fusion
protein, which encodes a segment (aa 170-410) between the
BTB domain and kelch motifs of KLHL31. After induction with
IPTG, we found GST-KLHL31 (170-410aa) was expressed in
bacteria BL21, and we subsequently purified the GST fusion
protein (Supplementary Fig. 2).
To characterize the anti-KLHL31 antiserum, Western blotting
was performed using recombinant protein and áå=îáíêç=translated
KLHL31, and nuclear extracts prepared from COS-7= cells (Fig.
2A). The results show that affinity-purified anti-KLHL31 antibodies
specifically recognized the translated KLHL31 in COS-7 cells and
the recombinant protein GST-KLHL31 (lanes 3 and 4); no bands
were resolved in the control reaction using rabbit pre-immune
serum and empty vector as template (lanes 1 and 2).
Expression of KLHL31 protein in human embryos
In an effort to understand the expression pattern of the KLHL31
in early human embryogenesis, we used the polyclonal antibody of KLHL31 as a probe to examine expression in multiple
tissues during human embryo development. As shown in Fig.
2B, Western blotting analysis detected a 70 kDa protein product in a few embryonic tissues, with strong expression levels in
skeletal muscle and heart. KLHL31 was also expressed in brain,
liver, and kidney, although at much lower levels. Previously,
KLHL31 has been reported to be expressed only in adult skeletal and cardiac muscles (Wu et al., 2004). The expression pattern suggests that KLHL31 might be involved in human embryonic development.
KLHL31 is a nuclear and cytoplasmic protein
To examine the subcellular location of KLHL31, the pEGFP-N2KLHL31 was transfected into COS-7 cells, and 24 h after the
transfection, the cells were visualized with epifluorescence
microscope after labeling with the nuclear stain DAPI. EGFPKLHL31 protein is distributed in both the nucleus and cytoplasm of COS-7 cells (Fig. 3A). To explore the distribution of
endogenous KLHL31 in cardiomyocytes, immunocytochemistry
in neonatal mouse primary cardiomyocytes was performed
using affinity purified rabbit polyclonal anti-human KLHL31 as
the primary antibody and F(ab’)2-PE-Cy3, goat anti-rabbit IgG
Weishi Yu et al.
A
B
a
b
c
447
Fig. 1. KLHL31 is conserved BTB-kelch
protein during evolution. (A) The domain
structure of KLHL31. Schematic diagram
of a BTB (amino acids 73-167), a BACK
(amino acids 172-273), and six consecutive kelch repeats (KH; amino acids 317614) of the KLHL31 protein. (B-a) Alignment of BTB domain, (B-b) BACK domain and six kelch domains with other
orthologues. Highly conserved amino
acids are indicated in deep grey. DDBJ/
EMBL/GenBank Accession Nos. for the
sequences are mouse Klhl31 (NM_
172925); rat (XM_236428); aêçëçéÜáä~
(NM_080250); dK= Ö~ääìë (XM_419909);
zebrafish (NM_001003727); uK=íêçéáÅ~äáë
(BC077340); `K= ÉäÉÖ~åë= (NM_058921).
The consensus sequence of the domain
is calculated and colored using Chroma.
(C) Un-rooted phylogenetic tree analysis
of KLHL31 and other homologue proteins. In addition to the proteins shown in
(B), Loc481846 (Canis), F7A7_180
(Arabidopsis thaliana), yjhT (Coli), and
SPCC 1223 (yeast) were also used in
the analysis.
C
as secondary antibody. As shown Fig. 3B, the endogenous
KLHL31 is also located in both the cytoplasm and nucleus of
mouse cardiomyocytes, however, most of the KLHL31 signal is
localized to the cytoplasm.
KLHL31 is a transcriptional repressor
To examine the potential function of KLHL31 in transcriptional
regulation, we constructed a fusion protein of KLHL31 with the
DNA binding domain (BD) of the yeast transcription factor
GAL4 under the control of the CMV promoter (Ai et al., 2007).
This construct, pCMV-BD-KLHL31, was co-transfected with
pL8G5-Luc reporter gene and pLexA-VP16 into COS-7 cells.
The pL8G5-Luc reporter contains eight copies of the LexA DNA
binding sites and five copies of the GAL4 DNA binding sites
linked to the luciferase reporter gene. pLexA-VP16 increases
luciferase expression through binding to the LexA-binding site
of pL8G5-Luc. When co-transfected with the pL8G5-Luc plasmid, the GAL4 BD-KLHL31 fusion protein inhibited the endogenous luciferase activity by 75%, and co-expression of GAL4BD-KLHL31 with pLexA-VP16 significantly inhibited the VP16activated luciferase activity by 66% (Fig. 4A), suggesting that
KLHL31 functions as a transcriptional repressor.
To further identify potential transcriptional regulatory domains
in KLHL31, we constructed three deletion mutants of GAL4KLHL31, pCMV-BD-BTB (1-184aa), pCMV-BD-BACK (170410aa) and pCMV-BD-Kelch-repeat (317-634aa). As shown in
Fig. 4B, pCMV-BD-BTB inhibited the luciferase activity of reporter gene by 60% and the pCMV-BD-Kelch-repeat inhibited
448
Suppression of MAPK/JNK Pathway by KLHL31
A
B
Fig. 2. The tissue distribution of KLHL31 transcript. (A) Identification
of polyclonal antibodies against KLHL31. få= îáíêç= translated products Flag-KLHL31 detected with the rabbit pre-immune serum (lane
1). få=îáíêç=translated products using either the Flag-vector (lane 2)
or Flag-KLHL31 (lane 3) as template detected with purified antiKLHL31 antibodies. The recombinant protein GST-KLHL31 (lane 4)
detected with purified anti-KLHL31 antibodies was used as a positive control. The ~êêçï=indicates Flag-KLHL31; the ~êêçïÜÉ~Ç=indicates GST-KLHL31 protein. (B) Expression of KLHL31 in human
embryonic tissues (16 weeks) analyzed by Western blot. A protein
product of approximately 70 kDa was detected in most tissues
examined, with highest levels in skeletal muscle and heart. β-actin
was used to confirm equal loading of total protein.
luciferase activity by 30%. These results indicate that both the
NH2-terminal BTB domain and the COOH-terminal Kelchrepeat motif contribute to transcriptional repression by KLHL31,
and that the BTB domain is the main target for the transcriptional repressor activity of KLHL31.
KLHL31 suppresses TRE and SRE-mediated
transcriptional activation
In order to investigate the role of KLHL31 in cell signal transduction, we examined whether KLHL31 was directly or indirectly involved in regulating the activity of transcription factors,
specificially MAPK-mediated transcriptional regulation. MAPK
signal transduction pathways are the most widespread mechanisms of eukaryotic cell regulation (Reszka et al., 1995). To
examine the effect of KLHL31 on this cell-signaling pathway,
we performed pathway-specific reporter gene assays to meas-
A
a
b
c
B
d
e
f
ure the transcription of TRE and SRE by KLHL31 in the COS-7
cells. Firstly, using pTRE-Luc, designed for monitoring induction
of TRE, we tested the effect of KLHL31 on the transcriptional
activity of TRE. Expression of KLHL31 significantly inhibited
TRE transcriptional activity by approximately 55% alone, by
80% in presence of c-Jun, by 25% in presence of c-fos, and by
68% in presence of c-jun and c-fos (Fig. 5A). Furthermore,
using a pSRE-Luc reporter designed for monitoring the induction of SRE, we demonstrated that KLHL31 also strongly inhibited SRE transcriptional activity by 59% alone and by 50% in
presence of c-Jun (Fig. 5B). In a further experiment, different
amounts of pCMV-Tag2B-KLHL31 were co-transfected with a
fixed amount of pTRE-Luc or pSRE-Luc into COS-7 cells. As
shown in Figs. 5C and 5D, KLHL31 caused dose-dependent
repression of TRE and SRE activity. To confirm the suppressive effect of KLHL31 in the MAPK pathway, we examined
protein levels of the downstream transcriptional factor c-Jun by
Western blot in COS-7 and Hela cells. Overexpression of
FLAG-KLHL31 significantly reduced c-Jun protein levels in both
COS-7 and Hela cells (Figs. 6A and 6B), and KLHL31 caused
a dose-dependent repression of c-Jun protein levels. However,
c-fos protein levels were not affected in Hela cells after 12 h of
starvation (Fig. 7A).
KLHL31 blocks UV-induced activation of JNK and c-Jun
phosphorylation
The transcription factor c-Jun is one of the major targets of the
JNK-signaling pathway. JNK phosphorylates c-Jun at Ser-63
and Ser-73 leading to an increase in its transcriptional activity
(Davis, 2000). To determine whether the activation of c-Jun is
affected by KLHL31, we examined the protein level of phosphoc-Jun in COS-7 cells. We found that the levels of phospho-cJun were significantly reduced in cells where KLHL31 is overexpressed (Fig. 7B, lanes 1-3). It is possible that KLHL31 action
is exerted through the dephosphorylation of JNK/SAPK resulting in a suppression of c-Jun activation. To determine whether
KLHL31 dephosphorylates JNKs, we then examined the protein levels of JNK/SAPK and phospho-JNK/SAPK in these cells.
As shown in lanes 1-3 of Fig. 7B, the overall protein levels of
JNK/SAPK were not affected by KLHL31, but the phosphorylated form of the protein could not be detected.
JNK was identified almost 10 years ago as a group of MAP
kinases that are activated by UV exposure and other external
stresses (Hibi et al., 1993). Consequently, we determined c-Jun
levels following JNK activation in response to UV irradiation. As
shown in Fig. 7B (lanes 4 and 5), UV-treated COS-7 cells exhibit relatively high levels of phosphorylated c-Jun and JNK, We
then determined whether this phosphorylation was affected by
Fig. 3. Cellular localization of KLHL31 protein
in cells. (A) Showing subcellular localization of
KLHL31 when overexpressed in COS-7 cells.
(a) EGFP-KLHL31 is localized both in the cell
nucleus and cytoplasm of COS-7 cells. (b) Cell
nuclei stained with DAPI. (c) The combined
image of (a) and (b). (B) Cellular localization of
endogenous KLHL31 protein in primary
neonatal mouse cardiomyocytes. (d) The
majority of KLHL31 is localized in the
cytoplasm of the cells; only a relatively small
amount KLHL31 signal is observed in the
nuclei. (e) Cell nuclei stained with Hochest. (f)
The combined image of (d) and (e).
Weishi Yu et al.
A
449
B
Fig. 4. KLHL31 is a repressive regulator of transcription. (A) pCMV-BD-KLHL31 is transiently transfected into COS-7 cells along with the
pL8G5-Luc reporter, the GAL4-KLHL31 fusion protein inhibited the luciferase activity by 75%. After cotransfection with pLexA-VP16, the VP16activated luciferase activity was significantly inhibited by 66%. (B) pCMV-BD-KLHL31-BTB, pCMV-BD-KLHL31-BACK, pCMV-BD-Kelch and
pCMV-BD-KLHL31 are transiently transfected into COS-7 cells along with the pL8G5-Luc reporter and pLexA-VP16. Control, no GAL4 fusion
protein was transfected. The BTB domain represses the reporter gene transcriptional activity as well as the full-length of KLHL31 by 60%. The
data are the mean of three repeats in a single transfection experiment after normalization for β-galactosidease activity. Each experiment was
repeated at least three times.
A
C
B
Fig. 5. Overexpression of KLHL31 inhibits
transcriptional activities of TRE and SRE.
(A) Repression of TRE-Luc transcriptional
activity by the overexpression of KLHL31.
(B) Repression of SRE-Luc transcriptional
activity by the overexpressing of KLHL31.
(C, D) Dose-dependent activation of the
reporter genes TRE-Luc and SRE-Luc
activity by pCMV-Tag2B-KLHL31. COS-7
cells transfected with individual reporter
plasmid and the corresponding plasmids
are shown in the figures. The data are the
mean of three repeats in a single transfection experiment after normalization for
β-galactosidease activity. Each experiment was performed at least three times.
D
KLHL31. As shown in Fig. 7B overexpression of KLHL31 was
associated with a significant reduction in phsophorylatioin of cJun and JNK (Fig. 7B, compare lanes 5 and 6), similar results
were obtained in Hela cells (Fig. 7B, lanes 7-9). Taken together,
these results provide evidence that KLHL31 may interact with
MAP kinase to down-regulate JNK signaling, leading to reduced phosphorylation of the JNK target c-Jun.
DISCUSSION
Recent studies of BTB-kelch family proteins suggest their extensive involvement in development and disease. For example,
the KLHL10 interacts with CUL3 and mediates protein ubiquiti-
nation during spermiogenesis (Wang et al., 2006). The vaccinia
virus kelch-like protein C2L affects calcium-independent adhesion to the extracellular matrix and inflammation in a murine
intradermal model (Pires de Miranda et al., 2003). KLHL7 antibodies are associated with various cancers, and also with neurological disease in some patients (Bredholt et al., 2006). Gigaxonin is a novel and distinct cytoskeletal BTB protein that
may represent a general pathological target for neurodegenerative disorders (Bomont et al., 2000). The PLZF (promyelocytic
leukemia zinc finger) transcriptional repressor, when fused to
retinoic acid receptor alpha (RARalpha), causes a refractory
form of acute promyelocytic leukemia, and the protein inhibits
cell growth and expression of cyclin A. PLZF lacking the BTB
450
A
Suppression of MAPK/JNK Pathway by KLHL31
B
A
B
Fig. 6. Western blot analysis of c-Jun. Western blot was performed
using the proteins of COS-7 cells (A) and Hela cells (B) transfected
with pCMV-Tag2B and pCMV-Tag2B-KLHL31(1 μg or 4 μg plasmids were transfected into cells in 60-mm dish). Overexpression of
KLHL31 significantly reduced c-Jun protein levels. Anti-Flag antibody was used to measure the KLHL31 protein level, and β-actin
was used as internal control.
domain interacts with a Wilson disease protein ATP7B to positively regulate ERK signal transduction (Ko et al., 2006; Melnick=
et al., 2002; Yeyati et al., 1999). Finally, the gene encoding the
BTB-protein BCL-6, is a proto-oncogene specifically involved in
the pathogenesis of large-cell lymphoma (Shaffer et al., 2000;
Ye et al., 1993).
Here, we report the identification of a novel member of the
human BTB-kelch transcriptional factor family, hieiPN, from
an embryonic cDNA heart library. This gene has an NH2terminal BTB domain and six COOH-terminal kelch motifs. Like
other BTB-kelch family proteins, KLHL31 is highly conserved
during evolution. Most BTB family members have been proposed to be transcriptional repressors (Ahmad et al., 2003;
Melnick et al., 2000; Qi et al., 2006; Shaffer et al., 2000; Yeyati
et al., 1999) and we now show that the BTB protein KLHL31
exerts a strong repressive effect on transcription mediated
through TRE and SRE. We also show that the BTB domain
alone exerts significant repression on reporter gene activity,
although somewhat weaker than that intact KLHL31 (Fig. 4).
Interestingly, the kelch motifs also exert a weak repressive
effect suggesting that both domains are required for full repressor activity.
The MAPK family is an important mediator of signal transduction and is activated by a variety of stimuli, such as growth factors
and cellular stresses (Davis, 1994). MAPK are major components of pathways involved in embryogenesis including cell
differentiation, cell proliferation, and cell death. One of the most
explored functions of MAPK signaling is the regulation of gene
expression by direct or indirect phosphorylation and subsequent
activation of transcription factors (Whitmarsh et al., 2000). MAPK
pathways are also involved in multiple cellular processes through
phosphorylation of specific endpoint targets. For example, the
persistent elevation of phosphorylated extracellular-signal-regulated kinase (ERK) regulates cell proliferation (Huang et al.,
2003). Phosphorylation and activation of JNK and c-Jun, may
contribute to uncontrolled cell-cycle progression and oncogenesis
(Leventaki et al., 2007). The JNK-dependent phosphorylation of
the transcription factor, SRF, plays a crucial role for ÅóêSN expression during neuronal cell death, and the SRE-like CArG domain
in the upstream ÅóêSN promoter is necessary for its induction by
etoposide (Kim et al., 2003).
Some proteins of the BTB family have been shown to regulate the MAPK signaling pathway. For example, overexpression
Fig. 7. Overexpression of KLHL31 blocks JNK-mediated c-Jun activity not c-fos. (A) c-fos is induced with serum starvation, overexpression of KLHL31 has no apparent effect on c-fos activation (lane 4). (B)
Expression vector or KLHL31 were transfected into cells, and treated
2
with 100 J/m ultraviolet light (UV); lysates were prepared 40 min after
stimulation and were assayed for their ability to phosphorylate MAPK
signal molecules. Lanes 1-3 shows the protein levels for the untreated
COS-7 cells, KLHL31 reduces the phosphorylation of c-Jun. Lanes 46 shows that KLHL31 inhibits UV-induced JNK phosphorylation, and
leads to reduced protein levels and reduced phosphorylation of the
JNK target c-Jun in COS-7 cells. The UV-irradiation-induced JNK and
c-Jun activation are also significantly blocked by expression of
KLHL31 in Hela cells (compare lanes 7-9). The experiment was repeated twice with similar results.
of Mayven results in an induction of c-Jun protein levels, as well
as increased AP-1 transcriptional activity in MCF-7 and T47D
breast cancer cells. Furthermore, Mayven activated the c-Jun
N-terminal kinase in breast cancer cells (Bu et al., 2005). Using
transient transfection and reporter assays, we have shown that
KLHL31 represses transcription via both SRE and TRE.
KLHL31 also strongly enhances the transcriptional repression
exerted by c-Jun in luciferase reporter assays (Fig. 5A). Interestingly, KLHL31 inhibits UV-induced JNK phosphorylation,
leading to reduced protein levels and reduced phosphorylation
of the JNK target c-Jun (Fig. 7B). KLHL31 had only a weak
repressive effect on c-fos (Fig. 5A), implying that the activity of
c-fos is not regulated by KLHL31; In addition, overexpression of
KLHL31 had no effect on the stress-induced c-fos expression
(Fig. 7A).
Recent studies suggest that MAPK pathways are critical not
only to the response of cardiovascular cells to extracellular
stress but also to developmental cues that regulate cardiovascular development (Aggeli et al., 2004; Tanoue et al., 2003).
The DNA-binding activity of AP-1/c-Jun was found to be dramatically increased in failing hearts, an increase that was not
observed in compensatory cardiac hypertrophy (Freire et al.,
2007). In addition, AP-1/c-Jun activation in cardiomyocytes
resulted in reduction of α-MHC mRNA (Freire=et al., 2007). cJun is a key component of AP-1 transcription factor complex,
and its transcriptional activity is potentiated by phosphorylation
of serines 63 and 73 within its transactivation domain by the cJun kinase family of MAPKs (JNK1-3) (Xia et al., 1998). Phos-
Weishi Yu et al.
phorylation of pre-existing and newly synthesized c-Jun proteins can further enhance their transcriptional activities and
inhibit its ubiquitination and degradation (Fuchs et al., 1996;
Musti et alK, 1997), supporting a strong autoregulatory loop for
c-jun expression and induction of TRE target genes (Angel et
alK, 1988; Jeanmougin et alK,=1998; Whitmarsh et alK,=1996).
The phosphorylation of transcription factors by MAPK signaling pathways regulates their activities in a number of ways
including (i) their intracellular location, (ii) their protein levels, (iii)
their binding to DNA, and (iv) their interactions with regulatory
proteins (Yang=et al., 2003). With respect to cellular localization,
MAPK signaling pathways can either stimulate the translocation
of transcription factors to the nucleus to promote their activity or
conversely, stimulate the export of transcription factors from the
nucleus and hence facilitate their inactivation (Hood et alK,
1999). The efficient phosphorylation of transcription factors by
MAPKs requires that these proteins colocalize in cells. Therefore, in addition to mechanisms that control the localization of
transcription factors, there are also mechanisms to control the
cellular distribution of MAPKs to ensure that the appropriate
transcriptional responses to extracellular stimuli are elicited. In
unstimulated cells, ERK is predominantly cytoplasmic, but upon
activation, it accumulates in the nucleus (reviewed in Lewis et
al., 1998). Transfected KLHL31 protein distributes in both the
nucleus and cytoplasm of COS-7 cells, but in neonatal mouse
primary cardiomyocytes, most of the KLHL31 signal is localized
in the cytoplasm (Fig. 3), suggesting the native KLHL31 protein
may reduce the phosphorylation of JNK, and block the translocation of JNK to the nucleus to activate the substrate c-Jun.
SRE is one of several cis-elements that mediate c-fos induction and is recognized by a dimer of the serum response factor
(SRF), which recruits monomeric ternary complex factors,
whose members include Elk-1, SAP-1 or SAP-2 (Herrera et al.,
1989). SRF function appears to be important for heart development as SRF mutant embryos show defects in both the cardiac compact layer and in the trabeculations, in addition several
critical cardiac transcriptional factors were downregulated in
these embryos (Parlakian et al., 2004). The absence of SRF in
cardiomyocytes and smooth muscle cells (SMC) leads to ultrastructural defects in contractile/cytoskeletal assembly (Miano=et
al., 2004). SRF controls SMC gene transcription via binding to
CArG box DNA sequences found within genes that exhibit
SMC-restricted expression. The SRF-CArG interaction is a
critical convergence point for signals that either activate SMC
gene expression to promote normal SMC differentiation or repress SMC gene expression during pathophysiological conditions (McDonald et al., 2006). Interestingly, the promoter region
of KLHL31 contains a CArG box. Thus, SRF may bind to the
CArG boxes of KLHL31 gene and regulate KLHL31 gene function.
In conclusion, we have identified and characterized a novel
human gene, KLHL31, from a human embryonic heart cDNA
library. KLHL31 is highly expressed in human embryonic skeletal and cardiac muscle where it is located in both the cell cytoplasm and in the nucleus. Overexpression of KLHL31 inhibits
the transcriptional activities of both TRE and SRE, and downregulates JNK signaling, leading to reduced phosphorylation of
the JNK target c-Jun. These results suggest that KLHL31 may
act, directly or indirectly, as a negative transcriptional regulator
in MAPK-mediated signaling pathways. It is likely that KLHL31
protein acts in synergy with other transcription factors to integrate information from multiple extracellular signals to induce
the necessary cellular changes required for tissue specification
and morphogenesis and it may also play roles in the regulation
of heart development and in heart disease.
451
kçíÉW= pìééäÉãÉåí~êó= áåÑçêã~íáçå= áë= ~î~áä~ÄäÉ= çå= íÜÉ= jçäÉJ
ÅìäÉë=~åÇ=`Éääë=ïÉÄëáíÉ=EïïïKãçäÅÉääëKçêÖFK
ACKNOWLEDGMENTS
We are grateful to all members of the Center for Heart Development, College of Life Sciences in Hunan Normal University
for their excellent technical assistance and encouragement.
This study was supported in part by the National Natural Science Foundation of China (No. 90508004, 30570934, 30671054,
30671053, 30671171, 30670274, 30671137, 30771146,
30771170, 30871340, 30871417, 30800627), PCSIRT of
Education Ministry of China (IRT0445), National Basic Research Program of China (2005CB522505), New Century Excellent Talents in University (NCET-05-0713), a China Postdoctoral Science Foundation (20060400260), the Foundation of
Hunan Province (05J2007, 06JJ4120), and Hunan Science and
Technology Project (2008NK3108, 2008 RS4011). This work is
also partially supported by the Research Platform of Cell Signaling Networks from the Science and Technology Commission
of Shanghai Municipality (06DZ22923).
REFERENCES
Aggeli, I.K., Gaitanaki, C., Lazou, A., and Beis, I. (2002). Hyperosmotic and thermal stresses activate p38-MAPK in the perfused
amphibian heart. J. Exp. Biol.=OMR, 443-454.
Ahmad, K.F., Melnick, A., Lax, S., Bouchard, D., Liu, J., Kiang, C.L.,
Mayer, S., Takahashi, S., Licht, J.D, and Privé, G.G. (2003).
Mechanism of SMRT corepressor recruitment by the BCL6 BTB
domain. Mol. Cell NO, 1551-1564.
Ai, J., Wang, Y., Tan, K., Deng, Y., Luo, N., Yuan, W., Wang, Z., Li,
Y., Wang, Y., Mo, X., et al.=(2008). A human homolog of mouse
Lbh gene, hLBH, expresses in heart and activates SRE and AP1 mediated MAPK signaling pathway. Mol. Biol. Rep. PR, 179187.
Angel P., Hattori K., Smeal T., and Karin M. (1988). The jun protooncogene is positively autoregulated by its product, Jun/AP-1.
Cell=RR, 875-885.
Bomont, P., Cavalier, L., Blondeau, F., Ben Hamida, C., Belal, S.,
Tazir, M., Demir, E., Topaloglu, H., Korinthenberg, R., Tüysüz,
B., et al.=(2000). The gene encoding gigaxonin, a new member
of the cytoskeletal BTB/kelch repeat family, is mutated in giant
axonal neuropathy. Nat. Genet.=OS, 370-374.
Bredholt, G., Storstein, A., Haugen, M., Krossnes, B.K., Husebye,
E., Knappskog, P., and Vedeler, C.A. (2006). Detection of
autoantibodies to the BTB-kelch protein KLHL7 in cancer sera.
Scand. J. Immunol. SQ, 325-335.
Bu, X., Avraham, H.K., Li, X., Lim, B., Jiang, S., Fu, Y., Pestell, R.G.,
and Avraham, S. (2005). Mayven induces c-Jun expression and
cyclin D1 activation in breast cancer cells. Oncogene OQ, 23982409.
Cai, Z., Wang, Y., Yu, W., Xiao, J., Li, Y., Liu, L., Zhu, C., Tan, K.,
Deng, Y., Yuan, W., et al. (2006). hnulp1, a basic helix-loophelix protein with a novel transcriptional repressive domain, inhibits transcriptional activity of serum reponse factor. Biochem.
Biophys. Res. Commun. PQP, 973-981.
Cao, L., Wang, Z., Zhu, C., Zhao, Y., Yuan, W., Li, J., Wang, Y.,
Ying, Z., Li, Y., Yu, W., et al. (2005). ZNF383, a novel KRABcontaining zinc finger protein, suppresses MAPK signaling
pathway. Biochem. Biophys. Res. Commun. PPP, 1034-1043.
Carim-Todd, L., Sumoy, L., Andreu, N., Estivill, X., and Escarceller,
M. (2001). Identification and characterization of BTBD1, a novel
BTB domain containing gene on human chromosome 15q24.
Gene OSO, 275-281.
Couderc, J.L., Godt, D., Zollman, S., Chen, J., Li, M., Tiong, S.,
Cramton, S.E., Sahut-Barnola, I., and Laski, F.A. (2002). The
bric a brac locus consists of two paralogous genes encoding
BTB/POZ domain proteins and acts as homeotic and morphogenetic regulator of imaginal development in aêçëçéÜáä~. Development NOV, 2419-2433.
Davis, R.J. (1994). MAPKs: new JNK expands the group. Trends
Biochem. Sci. NV, 470-473.
Davis, R.J. (2000). Signal transduction by the JNK group of MAP
452
Suppression of MAPK/JNK Pathway by KLHL31
kinases.=Cell=NMP, 239-252.
Freire, G., Ocampo, C., Ilbawi, N., Griffin, A.J., and Gupta, M.
(2007). Overt expression of AP-1 reduces alpha myosin heavy
chain expression and contributes to heart failure from chronic
volume overload. J. Mol. Cell. Cardiol.=QP, 465-478.
Fu, J., Gao, J., Pi, R., and Liu, P. (2005). An optimized protocol for
culture of cardiomyocyte from neonatal rat. Cytotechnology QV,
109-116.
Fuchs, S.Y., Dolan, L., Davis, R.J, and Ronai, Z. (1996). Phosphorylation-dependent targeting of c-Jun ubiquitination by Jun
N-kinase. Oncogene NP, 1531-1535.
Geyer, R., Wee, S., Anderson, S., Yates, J., and Wolf, D.A. (2003).
BTB/POZ domain proteins are putative substrate adaptors for
cullin 3 ubiquitin ligases. Mol. Cell NO, 783-790.
Herrera, R.E., Shaw, P.E., and Nordheim, A. (1989). Occupation of
the c-fos serum response element áå= îáîç by a multi-protein
complex is unaltered by growth-factor induction. Nature PQM, 6870.
Hibi, M., Lin, A., Smeal, T., Minden, A., and Karin, M. (1993). Identification of an oncoprotein- and UV-responsive protein kinase
that binds and potentiates the c-Jun activation domain. Genes
Dev. T, 2135-2148.
Hood, J.K., and Silver, P.A. (1999). In or out? Regulating nuclear
transport. Curr. Opin. Cell Biol.=NN, 241-247.
Huang, H., Petkova, S.B., Cohen, A.W., Bouzahzah, B., Chan, J.,
Zhou, J.N., Factor, S.M., Weiss, L.M., Krishnamachary, M.,
Mukherjee, S., et al. (2003). Activation of transcription factors
AP-1 and NF-kappa B in murine Chagasic myocarditis. Infect.
Immun. TN, 2859-2867.
Kang, M.I., Kobayashi, A., Wakabayashi, N., Kim, S.G., and Yamamoto, M. (2004). Scaffolding of Keap1 to the actin cytoskeleton controls the function of Nrf2 as key regulator of cytoprotective phase 2 genes. Proc. Nat. Acad. Sci. USA NMN, 2046-2051.
Kim, K.H., Min, Y.K., Baik, J.H., Lau, L.F., Chaqour, B., and Chung,
K.C. (2003). Expression of angiogenic factor Cyr61 during neuronal cell death via the activation of c-Jun N-terminal kinase and
serum response factor. J. Biol. Chem. OTU, 13847-13854.
Kim, T.G., Kraus, J.C., Chen, J., and Lee, Y. (2003). JUMONJI, a
critical factor for cardiac development, functions as a transcriptional repressor. J. Biol. Chem. OTU, 42247-42255.
Ko, J.H., Son, W., Bae, G.Y., Kang, J.H., Oh, W., and Yoo, O.J.
(2006). A new hepatocytic isoform of PLZF lacking the BTB domain interacts with ATP7B, the Wilson disease protein, and
positively regulates ERK signal transduction. J. Biol. Chem.=VV,
719-734.
Kobayashi, A., Kang, M.I., Okawa, H., Ohtsuji, M., Zenke, Y., Chiba,
T., Igarashi, K., and Yamamoto, M. (2004). Oxidative stress
sensor Keap1 functions as an adaptor for Cul3-based E3 ligase
to regulate proteasomal degradation of Nrf2. Mol. Cell. Biol.=OQ,
7130-7139.
Kreusch, A., Pfaffinger, P.J., Stevens, C.F., and Choe, S. (1998).
Crystal structure of the tetramerization domain of the Shaker potassium channel. Nature=PVO, 945-948.
Kroll, J., Shi, X.Z., Caprilli, A., Liu, H.H., Waskow, C., Lin, K.M.,
Miyazaki, T., Rodewald, H.R., and Sato, T.N. (2005). The BTBkelch protein KLHL6 is involved in B-lymphocyte antigen receptor signaling and germinal center formation. Mol. Cell. Biol. OR,
8531-8540.
Laezza, F., Wilding, T.J., Sequeira, S., Coussen, F., Zhang, X.Z.,
Hill-Robinson, R., Mulle, C., Huettner, J.E., and Craig, A.M.
(2007). KRIP6: A novel BTB/kelch protein regulating function of
kainite receptors. Mol. Cell. Neurosci. PQ, 539-550.
Leventaki, V., Drakos, E., Medeiros, L.J., Lim, M.S., ElenitobaJohnson, K.S., Claret, F.X., and Rassidakis, G.Z. (2007). NPMALK oncogenic kinase promotes cell-cycle progression through
activation of JNK/cJun signaling in anaplastic large-cell lymphoma. Blood NNM, 1621-1630.
Lewis, T.S., Shapiro, P.S., and Ahn, N.G., (1998). Signal transduction through MAP kinase cascades. Adv. Cancer Res. TQ, 49139.
Li, X., Peng, H., Schultz, D.C., Lopez-Guisa, J.M., and Rauscher, F.L.
(1999). Structure-function studies of the BTB/POZ transcriptional repression domain from the promyelocytic leukemia zinc
finger oncoprotein. Cancer Res.=RV, 5275-5282.
McDonald, O.G., Wamhoff, B.R., Hoofnagle, M.H., and Owens, G.K.
(2006). Control of SRF binding to CArG box chromatin regulates
smooth muscle gene expression=áå=îáîç.=J. Clin. Invest. NNS, 36-48.
Melnick, A., Carlile, G., Ahmad, K.F., Kiang, C.L., Corcoran, C.,
Bardwell, V., Prive, G.G., and Licht, J.D. (2002). Critical residues
within the BTB domain of PLZF and Bcl-6 modulate interaction
with corepressors. Mol. Cell. Biol.=OO, 1804-1818.
Miano, J.M., Ramanan, N., Georger, M.A., de Nesy Bentley, K.L.,
Emerson, R.L., Balza, R.O., Jr., Xiao, Q., Weiler, H., Ginty, D.D.,
and Misra, R.P. (2004). Restricted inactivation of serum response factor to the cardiovascular system. Proc. Nat. Acad. Sci.
USA NMN, 17132-17137.
Minor, D.L., Lin, Y.F., Mobley, B.C., Avelar, A., Jan, Y.N., Jan, L.Y.,
and Berger, J.M. (2000). The polar T1 interface is linked to conformational changes that open the voltage-gated potassium
channel.=Cell NMO, 657-670.
Musti, A.M., Treier, M., and Bohmann, D. (1997). Reduced ubiquitin-dependent degradation of c-jun after phosphorylation by
MAP kinases. Science=OTR, 400-402.
Nacak, T.G., Alajati, A., Leptien, K., Fulda, C., Weber, H., Miki, T.,
Czepluch, F.S., Waltenberger, J., Wieland, T., Augustin, H.G., et
al. (2007). The BTB-Kelch protein kleip controls endothelial migration and sprouting angiogenesis. Circ. Res. NMM, 1155-1163.
Nakayama, K., Nakayama, N., Davidson, B., Sheu, J.J., Jinawath,
N., Santillan, A., Salani, R., Bristow, R.E., Morin, P.J., Kurman,
R.J., et al. (2006). A BTB/POZ protein, NAC-1, is related to tumor recurrence and is essential for tumor growth and survival.=
Proc. Nat. Acad. Sci. USA=NMP, 18739-18744.
Parlakian, A., Tuil, D., Hamard, G., Tavernier, G., Hentzen, D.,
Concordet, J.P., Paulin, D., Li, Z., and Daegelen, D. (2004). Targeted inactivation of serum response factor in the developing
heart results in myocardial defects and embryonic lethality. Mol.
Cell. Biol.=OQ, 5281-5289.
Pires de Miranda, M., Reading, P.C., Tscharke, D.C., Murphy, B.J.,
and Smith, G.L. (2003). The vaccinia virus kelch-like protein C2L
affects calcium-independent adhesion to the extracellular matrix
and inflammation in a murine intradermal model. J. General Virol.=
UQ, 2459-2471.
Prag, S., and Adams, J.C. (2003). Molecular phylogeny of the
kelch-repeat superfamily reveals an expansion of BTB/kelch
proteins in animal. BMC Bioinformatics=Q, 42-62.
Qi, J., Zhang, X., Zhang, H.K., Yang, H.M., Zhou, Y.B., and Han,
Z.G. (2006). ZBTB34, a novel human BTB/POZ zinc finger protein, is a potential transcriptional repressor. Mol. Cell. Biochem.=
OVM, 159-167.
Reszka, A.A., Seger, R., Diltz, C.D., Krebs, E.G., and Fischer, E.H.
(1995). Association of mitogen-activated protein kinase with the
microtubule cytoskeleton. Proc. Nat. Acad. Sci. USA=VO, 88818885.
Rozek, D., and Pfeifer, G..P. (1993). få= îáîç protein-DNA interactions at the c-jun promoter: preformed complexes mediate the
UV response. Mol. Cell. Biol.=NP, 5490-5499.
Shaffer, A.L., Yu, X., He, Y., Boldrick, J., Chan, E.P., and Staudt,
L.M. (2000). BCL-6 represses genes that function in lymphocyte
differentiation, inflammation, and cell cycle control. Immunity NP,
199-212.
Shaknovich, R., Yeyati, P.L., Ivins, S., Melnick, A., Lempert, C.,
Waxman, S., Zelent, A., and Licht, J.D. (1998). The promyelocytic leukemia zinc finger protein affects myeloid cell growth,
differentiation, and apoptosis. Mol. Cell. Biol.=NU, 5533-5545.
Stogios, P.J., and Prive, G.G. (2004). The BACK domain in BTBkelch proteins. Trends Biochem.=OV, 634-637.
Stogios, P.J., Downs, G.S., Jauhal, J.J., Nandra, S.K., and Privé,
G.G. (2005). Sequence and structural analysis of BTB domain
proteins. Genome Biol. S, R82.
Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). CLUSTAL
W: improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap
penalties and weight matrix choice. Nucleic Acids Res. OO,
4673-4680.
Wang, S.H., Zheng, H.L., Esaki, Y., Kelly, F., and Yan, W. (2006).
Cullin3 Is a KLHL10-Interacting protein preferentially expressed
during late spermiogenesis. Biol. Reprod.=TQ, 102-108.
Whitmarsh, A.J., and Davis, R.J. (1996). Transcription factor AP-1
regulation by mitogen-activated protein kinase signal transduction pathways. J. Mol. Med. TQ, 589-607.
Whitmarsh, A.J., and Davis, R.J. (2000). Regulation of transcription
factor function by phosphorylation.=Cell. Mol. Life Sci. RT, 11721183.
Wilkins, A., Ping, Q., and Carpenter, C.L. (2004). RhoBTB2 is a
Weishi Yu et al.
substrate of the mammalian Cul3 ubiquitin ligase complex.
Genes Dev. NU, 856-861.
Wu, Y.L., and Gong, Z. (2004). A novel zebrafish kelchlike gene klhl
and its human ortholog KLHL display conserved expression patterns in skeletal and cardiac muscles. Gene PPU, 75-83.
Xia, Y., Wu, Z.G., Su., B., Murray, B., and Karin, M. (1998). JNKK1
organizes a MAP kinase module through specific and sequential
interactions with upstream and downstream components mediated by its amino-terminal extension. Genes Dev.= NO, 33693381.=
Xu, L., Wei, Y., Reboul, J., Vaglio, P., Shin, T.H., Vidal, M., Elledge,
S.J., and Harper, J.W. (2003). BTB proteins are substratespecific adaptors in an SCF-like modular ubiquitin ligase containing CUL-3. Nature QOR, 316-321.
Yang, S.H., Sharrocks, A.D., and Whitmarsh, A.J. (2003). Transcriptional regulation by the MAP kinase signaling cascades.
Gene POM, 3-21.
453
Ye, B.H., Lista, F., Lo Coco, F., Knowles, D.M., Offit, K., Chaganti,
R.S., and Dalla-Favera, R. (1993). Alterations of a zinc fingerencoding gene, BCL-6, in diffuse large-cell lymphoma. Science=
OSO, 747-750.
Yeyati, P.L., Shaknovich, R., Boterashvili, S., Li, J., Ball, H.J.,
Waxman, S., Nason-Burchenal, K., Dmitrovsky, E., Zelent, A.,
and Licht, J.D. (1999). Leukemia translocation protein PLZF inhibits cell growth and expression of cyclin A. Oncogene=NU, 925934.
Ziegelbauer, J., Shan, B., Yager, D., Larabell, C., Hoffmann, B., and
Tjian, R. (2001). Transcription factor MIZ-1 is regulated via
microtubule association. Mol. Cell U, 339-349.
Zollman, S., Godt, D., Privé, G.G., Couderc, J.L., and Laski, F.A.
(1994). The BTB domain, found primarily in zinc finger proteins,
defines an evolutionarily conserved family that includes several
developmentally regulated genes in Drosophila. Proc. Nat. Acad.
Sci. USA=VN, 10717-10721.