Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Reading DNA and Mutations Activity 1. 2. 3. 4. 5. Split into 2 groups Take a big piece of paper Record your DNA sequence Make Amino Acids Make Proteins DNA Amino Acid Protein A DNA SENTENCE! • Here's the sequence: GCATGCTGCGAAACTTTGGCTGA Separate into Codons • First, try separating the sequence into three-letter codons. Codons • You can do this three ways: GCA TGC TGC GAA ACT TTG GCT GAG CAT GCT GCG AAA CTT TGG CTG AGC ATG CTG CGA AAC TTT GGC TGA Where did you start? • How can you tell which of the three codon "reading frames" is the correct one? • All genes begin with the three-letter sequence "ATG," which encodes the amino acid methionine (Met). Therefore, the correct reading frame will contain the codon "ATG." Amino Acids • Review "What is the Universal Genetic Code?" on the right side of this page. • Then use the Code, shown below, to determine the amino acid sequence • Once you've translated the DNA sequence, go back and try to make each of the mutations discussed at right. Order • • • • DNA Codons (start at Met – ATG) Amino Acids Protein Mutation Types Point mutations are single nucleotide base changes in a gene's DNA sequence. : Insertion mutations and deletion mutations add or remove one or more DNA bases. This type of mutation can change the gene's protein product in the following ways: • Missense mutations are point mutations that result in a single amino acid change within the protein. • Nonsense mutations are point mutations that create a premature "translation stop signal" (or "stop" codon), causing the protein to be shortened. • Silent mutations are point mutations that do not cause amino acid changes within the protein. • Insertion and deletion mutations cause frameshift mutations, which change the grouping of nucleotide bases into codons. • This results in a shift of "reading frame" during protein translation. MUTATE A DNA SENTENCE! • It's time to try your hand at mutating a DNA sequence. • Here's the sequence: GCATGCTGCGAAACTTTGGCTGA Mutation Effects Missense mutation: • What does a missense mutation look like? • How does it change the amino acid sequence? Nonsense Mutation: • What does a nonsense mutation look like? • How does it change the amino acid sequence? Frame Shift: • You can make more than one frameshift mutation. • What do they look like? • How do they change the amino acid sequence? • Notice how a single amino acid can be encoded by a number of different codons. • What are some examples of silent mutations in the DNA sequence?