Download Differential Gene Expression

AP Biology: Notes and Practice
Differential Gene Expression
Model 1
In the embryonic development of eukaryotes, a zygote gives rise to cells of many different types. Therefore, the
development process must produce cells of different types that form higher-level structures. Cells must undergo
mitosis (division), differentiation (specialization of function) and morphogenesis (organization to give the
organism its shape). Almost all cells in an organism contain the same genome (set of DNA); however, if each
cell is to have a specialized function, each must regulate its genes differently. The genes that regulate the
embryonic development of eukaryotic organisms are called homeotic genes. This model explores the homeotic
genes at work in the embryonic development of Drosophila (fly), shown in Figure 1 below.
Figure 1
1. According to the passage, what three processes are required for embryonic development in eukaryotes?
What is the purpose of each process?
AP Biology: Notes and Practice
2. In the 1970s, a group of German researchers wanted to analyze the expression of the bicoid gene, one of the
homeotic genes. Bicoid is a gene known to be expressed in Drosophila eggs even before fertilization
occurs. Scientists hypothesized that the bicoid gene codes for a protein the aids in development of the head
(anterior) end of the embryo. To test their hypothesis, the researchers used techniques to visualize where
bicoid mRNA and protein was produced in an embryo. Their results are displayed below. Regions
containing bicoid mRNA/protein are darker.
Fertilization
Figure 2
a. Recall that transcription and translation take place so that a gene can be expressed. According to Figure
2, which of these processes occurs before fertilization for the bicoid gene? Explain your reasoning.
b. According to Figure 2, which processes occur after fertilization for the bicoid gene? Explain your
reasoning.
c. Assuming the researchers hypothesis was correct, label the end of the Drosophila embryo that is
expected to become the head. Explain your reasoning.
d. The researchers then followed the development of the embryo and found the Bicoid protein did specify
the fly’s anterior end. To test this hypothesis further, scientists injected pure bicoid mRNA into different
regions of embryos. Predict what they would have found if injections were made at the sites in the
embryos below.
Injection Sites
Embryo 1
Embryo 2
Embryo 3
AP Biology: Notes and Practice
e. The image below displays two flies. Predict which fly developed from an egg containing a wild-type
bicoid gene and which fly developed from an egg containing a mutated bicoid gene. Explain your
prediction.
Model 2
In addition to the bicoid gene, other genes participate in
embryonic development in Drosophila. These include
the hunchback, caudal, and nanos genes. The
distribution of mRNA present in egg cells before
fertilization is displayed in Figure 3.
Figure 3
3. In Model 1, you learned that the bicoid gene in expressed in the region where the head and other anterior
structures develop. Based on the information provided in the figure, predict what structures on Drosophila
the following genes control. Explain your predictions.
 Nanos

Hunchback

Caudal
4. Figure 4 provides the distribution of bicoid,
hunchback, caudal, and nanos proteins after
fertilization.
a. Based on Figure 4, what modifications do you
need to make to the predictions made in
question 3? Explain your reasoning.
Figure 4
AP Biology: Notes and Practice
b. When mRNA is present in a certain part of the embryo, but protein is not produced in that location, what
process is being inhibited?
c. Based on the information provided in question b, which protein is inhibited in the anterior region of the
embryo? Explain your reasoning.
d. Based on the information provided in question b, which protein is inhibited in the posterior region of the
embryo? Explain your reasoning.
e. The bicoid protein can bind to mRNA and act as an inhibitor in the production of other proteins. Based
on the data provided in the figures, what type of mRNA do you predict the bicoid protein inhibits in
translation? Justify your prediction with data from the figures.
f. What other protein do you predict acts as an mRNA inhibitor AND which mRNA molecule do you think
it inhibits? Justify your prediction with data from the figures.
g. The caudal protein is responsible for development of the Drosophila abdominal region. If a mutant
form of the bicoid gene was present in the mother’s egg cell, explain how the development of the embryo
would be affected. Include a discussion of bicoid mRNA, caudal mRNA, bicoid protein, and caudal
protein in your response.
AP Biology: Notes and Practice
Model 3
In virtually all mammals, there are seven vertebrae in the neck, though these vertebrae can vary in size from
species to species. Bones grow because of the proliferation of cartilage-producing cells called chondrocytes. A
gene product serving as a transcription factor controls the production of this cell during embryonic development
and childhood. The relative concentrations of chondrocytes and the gene product over time in humans and
giraffes are displayed in Figure 5.
Giraffes
Concentration
Concentration
Humans
Chondrocytes
Gene Product
Time
Time
Figure 5
5. A partial DNA sequence for the gene that controls chondrocyte production in humans and giraffes is shown
below.
Human:
5’
GTATCCAACGGTTGTGTGAGTAAAATT
3’
Giraffe:
5’
GTATCAAATGGATGTGTGAGCAAAATT
3’
a. Use the genetic code to transcribe and translate the DNA for both humans and giraffes.
Human mRNA :
- Human amino acid sequence :
-
Giraffe mRNA :
Giraffe amino acid sequence :
b. What conclusion can you draw on the basis of the amino acid sequences found in part a?
6. According to Figure 5, compare the concentrations of chondrocytes over time between humans and giraffes.
AP Biology: Notes and Practice
7. Based on the information provided in the passage and the trends described in question 6, which organism
experiences more bone growth in their vertebrae? Explain your reasoning.
8. Transcription factors can either serve as inducers or repressors. Which of these roles does the gene product
displayed in Figure 5 serve in the proliferation of chondrocytes? Explain your answer citing data from the
figures.
9. Propose an explanation for why giraffes have longer necks than humans. Include a discussion of
chondrocytes and the gene product of interest in your response.