Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Vol. 3, 31-42, January 1992 Cell Growth The Human Skeletal a-Actin Promoter Is Regulated Thyroid Hormone: Identification of a Thyroid Hormone Response Element’ Elaina S. R. Collie University of Queensland, Biotechnology, Ritchie Queensland, and George Centre Research Biology St Lucia, and 4072, Australia Introduction Abstract Skeletal a-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3’,5Triiodo-L-thyronine (13) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal a-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that 13 induces the expression of the native skeletal a-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected a1 and fl c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (IRE) in the human skeletal a-actin gene. This IRE is located between nucleotide positions -1 73 and -149 with respect to the start of transcription at +1 (5’ TGGTCAACGCAGGGGACCCGGGCGG 3’). Electrophoretic mobility shift assay experiments showed that the putative skeletal a-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5’ unidirectional deletions of the skeletal a-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal a-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5’ and 3’ flanks, respectively. It is also surrounded by sequences densely populated by other Spi, SRF, and OF binding sites. In conclusion, these results indicate that T3-induced increases in a-actin mRNA in animals Thyroid hormones exert profound effects on the growth, development, and homeostasis of vertebrate organisms. These effects are primarily mediated by nuclear receptor proteins that act to increase the rates of transcription of target genes. These receptors are the cellular homologues of the v-erbA protooncogene and are members of the steroid hormone receptor superfamily of ligand-responsive transcriptional factors. Cloning of v-erbA-related cDNA3 sequences has revealed the existence, in mammals, of at least two distinct but closely related genes that encode TRs. These genes, which reside on separate chromosomes, have been termed the c-erbA-a and cerbA-fl genes. The c-erbA genes are alternatively spliced, resulting in heterogeneous mRNAs and protein products. This alternative splicing results in non-hormone-binding and tissue-specific TR forms which may fine tune the hormonal response (1, 2). The DNA-binding domains of the TR-a and -13 proteins are highly related (90-97%), as are the ligand-binding domains (88-98%), whereas the extreme amino termini are completely unrelated. The TRs show distinct temporal and spatial patterns of expression. The TR-a form exerts important functions in central nervous system, kidney, cardiac, and skeletal muscle (1, 2). The thyroid hormone receptor is thought to act by binding to specific DNA sequences in genes responsive to T3. These sequences are known as TREs and are generally recognized by their ability to confer T3 responsiveness to heterologous promoters and reporter genes. These TREs are purine-rich elements that contain a consensus core T3 receptor-binding motif G/A GGT/A cA/s (1, 3, 4), which may be part of a larger palindromic sequence, AGGTCA_.TGACCT (1-4). Thyroid hormones exert marked effects on cardiac and skeletal muscle. Thyroid hormone elicits a cardiac response similar, in many ways, to the effect of prolonged exercise. Hyperthyroidism results in an increased heart rate, cardiac output, and synthesis of a-MHC mRNA (Vi protein isoform). This in part reflects the increased metabolic demands imposed by augmented oxygen consumption in peripheral tissue. In addition, increases in 13- The abbreviations used are: cDNA, complementary amphenicol acetyltransferase; TRE, thyroid hormone TR, thyroid hormone receptor, T3, 3,3’,S-triiodo-i-thyronine; 3 binding Received 1This work 9/8/91. was supported by are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins. E. 0. Muscat2 for Molecular Laboratories, & Differentiation by the Australian Health and Medical Research Council, Special Projects Grant. 2 To whom requests for reprints should Research and a University be addressed. Council, National of Queensland factor; SRF, serum response factor; CTF/NF-l, transcription factor; EMSA, electrophoretic mobility myosin heavy chain; rGH, rodent growth hormone; modified Eagle’s medium; FCS, fetal calf serum; dioleoyloxy)propyl]-N,N,N-trimethylammonium-methyl N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic DNA; CAT, chlorresponse element, CBF, CArGCCAAT-binding shift assay; MHC, DMEM, Dulbecco’s DOTAP, N-[1-(2,3sulfate; acid. HEPES, 31 32 Characterization of a-Actin TREs adrenergic receptor number lead to increased sensitivity to catecholamines. Thyroid hormone is a limiting/essential factor during postnatal skeletal muscle development and maturation (5, 6). Hyperthyroidism induces the precocious development of adult fast contractile protein genes (7). An examination of muscle-specific genes has allowed the identification of additional direct targets of thyroid hormone action. These include several members of the myosin heavy chain gene family, atrial natriuretic factor, sarcolemmal calcium ATPase, and sarcoplasmic calcium ATPase (Ref. 8 and references therein). Furthermore, the effects of T3 on the expression of a particular gene are regulated in a highly tissue-specific manner (1, 5, 6). The actin monomers assemble into long cables that are twisted into a double helix to form the thin filament of the muscle sarcomere. In small mammals such as rodents, cardiac a-actin predominates (>95%) in the adult heart, although both isoforms are present neonatally. However, in larger mammals such as the porcine, bovine, and human species, the skeletal isotype of actin encodes up to 20-30% of the net a-actin in the adult heart (9-16). The skeletal isotype is under pathophysiological regulation (1 7, 18). The amount of skeletal a-actin increases in the adult heart during hypertrophy after imposition of a hemodynamic overload/aortic restriction (1 7), in cultured neonatal cardiomyocytes by administra(ion of a1- or /3-adrenergic agonists (19), and in cultured neonatal card iomyocytes stimulated by serum antigens (discussed in Ref. 18). These results correlated with the high levels of skeletal a-actin found in diseased human heart (11). In ventricular muscle, T3 stimulates the expression of the rodent a-MHC gene (Vi), while inhibiting the expression of the 13-MHC gene (V3) (20). Very recently, it has been demonstrated that the amount of skeletal a-actin mRNA in hearts from normal and hypophysectomized animals is also rapidly induced under these conditions. The presence of a-MHC in the thyrotoxic heart is in part responsible for the increase in maximum velocity of shortening of the unloaded muscle and for a contraction that is less efficient (5, 6). The a-MHC gene is also expressed in the atria, but T3 exerts minimal influence on its expression in this tissue (21). Functional analysis carried out in vivo and in vitro has identified the regulatory sequences required for hormonal regulation of the MHC genes. Thyroid-sensitive elements have been identified in the rodent a-MHC gene between nucleotide positions -599/-576 and -144/-132 (22, 23) and in the human a-MHC gene between nucleotide positions -151 and -138 (24). These cis-acting sequences have been shown to interact with protein factors in vitro (25). The latter site in the rodent species has been definitively shown to interact with the thyroid hormone receptor, TR-a1 (23). The sequences that mediate hormonal regulation are 5’ GGAGGTGACAGGA 3’ between nucleotide positions -144/-i32 and -151/-138 in the rodent and human species, respectively. These sequences are similar to the many variant TREs that are scattered throughout the rodent growth hormone promoter, have recently been found in the sarcoplasmic calcium ATPase promoter (8), and are known to function in vivo and in vitro (3, 4). Winegrad et a!. (18), who showed that thyroid hormone induced the accumulation of skeletal a-actin mRNA, did not find the TR-binding sites in the a-actin gene and could and/or not discriminate transcriptional/posttranscri between direct/indirect ptional mechanisms. This was probably attributable to the fact that they were scanning the sequence for consensus dyad repeat sites, using the new TR “half-site” core-binding motif described by Glass and Holloway (1) and Norman et a!. (3). We have identified some probable candidate TRE sequences for the interaction ofthe receptor with this promoter that are accommodated by the core consensus sequence. This sequence contains a purmne-rich element, G/ GGT/A cA/s that is highly conserved. These putative TREs may account for the induction of skeletal a-actin during T3 treatment, and they are located between nucleotide positions -273/-249 and -173/-149. In the current study, we showed that T3 induced the transcription of the native skeletal a-actin promoter between nucleotide positions -2000 and +239 which is linked to the CAT reporter gene in COS-i fibroblasts and myogenic C2C12 cells. This T3 (10-50 nM) -induced transcriptional activation is dependent on the expression of the TR a1 and fl isoforms. EMSA assays were used to identify a putative TRE in the human skeletal a-actin gene. This TRE is located between nucleotide positions -1 73 and -149 with respect to the start of transcription at +1 (5’ TGGTCMCGCAGGGGACCCGGGCGG 3’). This sequence fits the six-base pair core-binding motif for the TR G/ GGT/ cA/ and is similar to TREs defined in the rodent growth hormone gene (3). Transfection experiments indicated that this TRE was functional in vivo. The putative skeletal a-actin TRE and defined rodent growth hormone TREs (which bind TRs in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. This TRE is flanked on its boundaries by the transcription factors, SpI (26-28), CTF (29-31), and SRF (32-34). Results Transcriptional Activation of the a-Actin Promoter by T3 and Thyroid Hormone Receptors in Nonmuscle and Myogenic Cells Transcriptional Activation of the Skeletal a-Actin Promoter by the a and 13 c-erbA Products in COS-1 Fibroblasts. Transfection studies were carried out to investigate whether the Cis-acting sequence between nucleotides -2000 and +239 in the native skeletal a-actin promoter were responsive to T3 via the thyroid hormone receptor in vivo. For this purpose, we used the plasmid pHSA2000CAT, which contains the native skeletal aactin promoter linked to the CAT gene. COS-1 cells, which are a fibroblast cell line deficient in TRs, were grown in thyroid hormone-deficient medium for 24 h prior to transfection. In transient expression assays, equal amounts of either pUC18 or a mixture of the rodent c-erbA-a and c-erbA-f3 cDNAs cloned into CDM8 (a eukaryotic expression vector) (35) were cotransfected into this cell line with the skeletal a-actin promoter pHSA2000CAT. The protein products of the c-erbA-a and c-erbA-13 cDNAs are the a and 13 isoforms of the thyroid hormone receptor. The cells transiently expressing the a and 13TRs were then grown in the presence T3 (10 nM) for 48-72 h from the day after transfection. The cells that were transfected with pUCi8 were grown in T3-deficient medium over the same time period. The Cell 2 1 3 4 5 6 2 1 3 4 Growth 5 & Differentiation 6 33 7 ... .. ...... 1. pCAT+pUC18 2. pCAT + c-erbA.a + c-erbA- 3. pHSA2000CAT + pUCI 4. pHSA2000CAT + c-erbA-cx 5. pHSA2000CAT + pUCI8 6. pHSA2000CAT + c-erbA-ct + T3 ....#{149}S#{149} 8 + c-erbA- + T3 + c-erbA- + T3 Fig. 1. The skeletal a-actin promoter is trans-activated by c-erbA and T3 in COS-1 cells. CAT assays demonstrating the effect of T3/TRs on the human skeletal a-actin promoter sequences between -2000 and +239 in COS-1 cells, in the presence of c-erbA TRs and T3 (10 nM). The transfections and CAT assays were performed as described in “Materials and Methods.” CAT activity in the presence from pHSA2000CAT of T3 and 4 and 6), as opposed TRs, was increased respectively early linked c-erbA-cx + c-erbA-3 5. pHSA2000CAT + pUCI8 1 , Lanes 6. pHSA2000CAT + c-erbA-a + T3 with 7. pHSA2000CAT + c-erbA-3 + T3 to CAT) in the and a 3-4- T3-dependent trans-activation they are cotransfected with of the rodent a and 3 forms of the TR. The T3/TR-independent expression of pCAT demonstrates that the T3-dependent induction mediated by the a-actin TRE is sequence specific. The a- and i9-c-erbA Genes Mediate Similar Functions in the T3/TR Transfection Assay. The requirement for cerbA gene products activation indicated thyroid hormone + pCAT These transient cotransfection experiments have demonstrated that the sequences between nucleotide positions -2000 and +239 in the skeletal a-actin gene are capable of mediating CAT expression when pUC18 4. presence ofT3 (Fig. 1, Lanes 1 and 2). The pCAT plasmid expresses at high levels in COS-1 cells, because of very efficient replication from the SV4O origin of replication posttransfection. These transfections were performed in triplicate with different plasmid preparations, fold T3/TR induction was seen in each case. + pCAT+pUC18 to that in cells not transfected SV4O) promoter 2. pEMSV-CAT 3-4-fold (Fig. pEMSV-CAT 3. TRs and grown in the absence of T3 (Fig. 1, Lanes 3 and 5). This level of induction with T3 and TRs is similar to that observed by Zilz et a!. (35) in their work on the hepatic S14 gene. In addition, this transcriptional induc(ion was not observed when c-erbA-cx and c-erbA-f3 were cotransfected into COS-1 cells with the pCAT vector (an enhancerless 1. during T3-dependent transcriptional that the process is mediated through receptors. We investigated the func- + c-erbA-a + c-erbA-3 + T3 + T3 Fig. 2. The skeletal cx-actin promoter is trans-activated by T3 and either c-erbA-a or -/3 in COS-1 cells. CAT assays demonstrating the functional activity of the c-erbA-a or -(. TRs with respect to trans-activation of the human skeletal actin promoter in the presence of T, (10 nM) in COS-1 cells. From the pEMSV-CAT, pCAT, and pHSA2000CAT transfections in this experiment, we used 5, 5, and 25 M1 of extract for the CAT assays, respectively, because the skeletal a-actin promoter did not express efficiently in fibroblasts relative to pEMSV-CAT. tional differences between the a and 3 receptors with respect to the trans-activation of the cs-actin TRE in the presence of T3. The a-actin promoter pHSA2000CAT construct was cotransfected into COS-1 cells with either pUC18, the a isoform, or the /3 isoform of the thyroid hormone receptor. The CAT activity was approximately 3-fold and 5-fold higher in the presence of a-c-erbA or 13-c-erbA, respectively, after T3 treatment (Fig. 2, Lanes 57). As demonstrated by other investigators, no significant difference in functional activity was found between the a- and 13-c-erbA products with respect to the extent of trans-activation of the skeletal a-actin promoter after 1, treatment. This set of transfections also demonstrated that a plasmid ney sarcoma CAT gene presence containing virus long (pEMSV-CAT) of T3 and a strong viral terminal (36) cotransfected promoter repeat) was not TRs (Fig. linked induced 2, Lanes (Mobto the in the 1 and 34 Characterization 1 of (,-Actin 2 TREs 3 4 5 6 . (A) . HUMAN SKELETAL ALPHA ACTIN TREs : -23 -24 5’ GGGCAACTGGGTCGGGTCAGGAGOG 3’ : -:3 -149 5’ TGGTCAACGCAGGGGACCCGGGCGG 3’ (B) RODENT HORMONE GROWTH 5’ :T;;; -1 r -16j/-14E) rH -7/-46 rH -27/-6 S TREs AAGGTAAGATCAGGACTGACCG 3’ CGCAGGAGAGCAGT1GGGACCG 3’ w 1 I fig. ‘ AAAAAGGCAGGAGCCTTGGGTC 3’ 5’ 3’ AAAAAGGGCATGCAAGGAC9b, 4. Thyroid hormone response elements. A, the putative TREs in the skeletal a-actin promoter. Sequences of one strand of doublestranded oligonucleotide probes that were synthesized to represent putative thyroid hormone receptor binding sites in the skeletal a-actin promoter. The direction and location of the four putative HSA TREs are indicated by arrows. These sequences match the six-base pair core sequence-binding motif for the thyroid hormone receptor: G1 GGT/A CA, human 1. pCAT+pUC18 2. pCAT + c-erbA-cc + c-erbA- 3. pHSA2000CAT + pUC18 4. pHSA2000CAT + c-erbA-a 5. pHSA2000CAT + pUC18 6. pHSA2000CAT+ c-erbA-a + T3 C. The + + c-erbA- c-erbA- #{247} T3 + 2). The T3/TR-independent expression of the Moloney sarcoma viral promoter and pCAT demonstrates that the T3/TR-dependent trans-activation mediated by the aactin promoter is sequence specific. TranscriptionalActivation of the Skeletal a-Actin Promoter by the a- and 13-c-erb A Products in Myogenic C2C12 Cells. Similar experiments to those outlined above carried line. Initially, out either in C2C12 cells, a mouse pUC1 8 or the c-erbA-a myogenic and to the transcripgrowth hormone DNA sequences have been shown binding of thyroid nucleotide positions at +1. to confer T3 responsiveness to the rGH promoter via hormone receptors to these cis-acting regions. The are indicated with respect to the start of transcription were in C2C12 T3 Fig. 3. The skeletal a-actin promoter is trans-activated by c-erbA and T3 in C2C12 ells. CAT assays demonstrating the effect of T3/TRs on the human skeletal actin Promoter sequences between -2000 and +239 in C2C12 cells, in the presence of c-erbA TRs and T, (10 nM(. were nucleotide positions are indicated with respect tional start site at +1 . B, the defined TREs in the rodent promoter (rGH). Boxed region, the four rGH TREs. These cell -13expres- sion vectors were cotransfected into this cell line with the skeletal a-actin promoter. The cells were then grown in thyroid hormone-deficient medium in the absence or presence (10 nM) of T3, respectively. In cells transfected with the TRs and grown in the presence of T3, a 2-4-fold increase in CAT activity was observed with pHSA2000CAT (Fig. 3, Lanes 4 and 6) when compared to cells transfected with pUC1 8 and grown in T3-deficient medium (Fig. 3, Lanes 3 and 5). In addition, no induction was observed in the presence of T3 in cells cotransfected with the receptors and the pCAT vector DNA (Fig. 3, Lanes 1 and 2). These transfection studies were carried out in duplicate. The pCAT plasmid expressed at the expected low levels in these cells, because the SV4O origin of replication does not function in rodent cells. Additional experiments were then performed to determine whether exogenous thyroid hormone receptors required the skeletal a-actin cells to elicit promoter. a T3 response For this purpose, from C2C12 cells transfected with the skeletal a-actin pHSA2000CAT plasmid were grown either in the presence (10-50 nM) or absence of T3. Expectedly, little or irreproducible increases in CAT activity were seen in C2 myogenic cells transfected with the skeletal a-actin promoter (data not shown). This has been observed in other cell lines derived from tissues, including liver and muscle that normally express large amounts of endogenous T3 receptors and has also been seen in primary hepatocytes (35), and cardiocytes (8). One possible explanation for these findings, put forward by ZiIz the endogenous from fied et a!. (35) T3 receptors among others, are limiting the transfected constructs. This by our data, which demonstrated is that or sequestered hypothesis that the is yenskeletal a-actin sequences and +239 mediate between nucleotide positions a response to T3 dependent -2000 on co- transfected hormone cells. thyroid Characterization sponse Elements Identification core consensus CI was putative promoter receptors in C2C12 of the Putative Thyroid Hormone Rein the Human Skeletal a-Actin Gene of Putative Skeletal a-Actin TREs. The T3 receptor-binding motif used to scan the human skeletal TREs (3). Putative TREs were region of this gene tions -273/-249 and -173/-149, transcriptional start site at +1 regions are indicated as follows: GGGCAACTGGGTCGGGTCAGGAGG between . [G/A GGT/A a-actin identified nucleotide cA/ gene for in the posi- with respect to the The sequences of these (a) HSA -273/-249 5’ 3’ and (b) HSA Cell A B CArG Probe .J. I- Q_o sayed as described and Methods.” - 1 73/-i 5‘ 49 I-F- TGGTCAACGCAGGGGACCGGGCGG of possible Oligonuclewere synputative cis- -173/-149. Nuclear Extracts from Differentiated Cells Form a Complex with a Putative regulated of differentiation to assay stages regulation extracts myoblasts, days after tracts were ically and confluent myoblasts, and myotubes (3 and 4 mitogen withdrawal, respectively). These exassayed for levels of CBF, which is biochemimmunologically indistinguishable from SRF of Oct-i constitutively (data not expressed proteins from shown) the a in different devel- and are used extracts of expression (Fig. 58). of a nuclear This to demonstrated factor known in these of these experiments, cells and verified the extracts. the HSA -273/-249 and a-actin teins are sequences binding The protein sequence -173/-149 factor. This differentiated demonstrates to these that regions that of the interacted with is a constitutively the protein different skeletal the expressed that bound proa-actin HSA factor to the HSA sequence is a developmentally regulated protein factor was expressed only in highly muscle cells (myotubes, day 4) and could be detected in myogenic cells at an earlier stage of development (Fig. The Skeletal a-Actin TRE/Protein Complex Is Specifically Competed by Defined Rodent Growth Hormone TREs. Previously defined thyroid hormone response ele5D). (38, 39); these factors EMSA two not in muscle. proliferating standardize the amount of nuclear extracts used in the experiments (Fig. 5A). The amount of MEF-2 protein (40), which is a differentially expressed factor, was also measnuclear - HSA -1 73/-149 oligonucleotides specifically interacted with a factor(s) in mouse myogenic cells. The differential regulation of these factors is depicted in Fig. 5, C and D. The expression patterns of the factors that bound the -273/-249 opmental Specifically, of TRE-bound were isolated In the stage (Fig. 5C). In contrast, mobility shift assays (37) were used to determine the putative skeletal a-actin TREs interacted with nuclear factor in vitro. Nuclear extracts were prepared from mouse myogenic C2C12 myoblasts and myotubes in the * i promoter. Skeletal Muscle TRE. Electropho- retic that pattern . I be differentially thesized to enable characterization of these acting motifs. In the following study, these oligonucleotides will be referred to as HSA -273/-249 and HSA ured .#{149}.#{149}. in “Materials Each of these regions contained a number TREs, which have been outlined in Fig. 4A. otides corresponding to the above sequences the 0 0 developmental (32, 34), and 49 m mm(Y) 1.1 3’. are both HSA -173/-i 1 mmc’)’4 F-I-- . Fig. 5. Detection of a factor that interacts with the skeletal a-actin TRE that is differentially regulated during myogenesis. Electrophoretic mobility shift analysis of C2C12 myogenesis using the following DNA probes: (A) CArG; (B) MEF-2; (C) HSA -273/ -249; and (0) HSA -173/-149. Proliferating myoblasts )PMB(, confluent myoblasts (CMB), and myotubes after 3 and 4 days of mitogen withdrawal (MT3 and MT4, respectively). The DNA probes were incubated with 510 g of nuclear extract and as- 35 D HSA -273/-249 II cv) & Differentiation C MEF-2 I Developmental Stage Growth to ments from the rat [rGH TREs -190/-167, -6 (Fig. 48)], which purified TRs (3) and growth hormone promoter region -168/-146, -701-46, and -27/ have been shown to interact with function in vivo (41, 42), were used in EMSA experiments with the myogenic C2C12 cell nuclear extracts. These defined TREs interacted with a specific factor that was differentially regulated in mouse myogenic cells and more abundantly expressed in differentiated myotubes (data not shown). This finding was 36 Characterization of o-Actin TREs Probe HSA -1 731-1 49 Competitor HSA Molar Excess C 40 80 160 C 40 80 1 60 C rGH -1681-146 -173/.149 I rGH #{149} #{149} #{149} 1 #{149} 1 #{149} #{149} . . 1 -701-46 l , 2 40 80 160 3 4 5 . pUCI8 pHSA432C:T + pUC18 pHSA432CAT + c-erbA-a pHSA432CAT + c-erbA.cc pHSA432C;T + c-erbA-)3 pHSA432CAT S #{149} K 9 10 pHSA153CAT + pHSAIS3CAT + pUCI8 pHSA153CAT + c-erbA-cz pHSAI53CAT + c.erbA-a + c-erbA-3 11 #{149} pHSA1S3CAT 12 #{149} pHSAI53CAT The skeletal o-actin TRE is functional in vivo. CAT the effect of T3 (100 nM( on two deleted human actin promoters, pHSA432CAT and pHSA153CAT, in COS-1 presence of c-erbA-o and -. The transfections and CAT performed as described in “Materials and Methods.” quences Probe LISA - 1 7 1/- 1 49 in C2 myotube nuclear of each DNA ( ompetitor is indicated. C. the the absence of any unlabeled competitor. analogous to the EMSA -173/-149 oligonucleotide We tested the ability hormone TREs, rGH extra ontrot results obtained (Fig. SD). of the defined -168/-146 and rGH ts. The molar excess binding reaction in with the rodent HSA growth -70/-46 (Fig. 48), to compete specifically for binding to HSA -273/ -249 and -1731-149. The complex formed by HSA -273/-249 was not competed by the rGH TREs (160fold) or HSA -173/-149 (data not shown). In contrast, the HSA -173/-149 binding site bound to a nuclear factor that was specifically competed by both rGH TREs at a 40-fold molar excess (Fig. 6). This DNA-protein interaction was also competed by a 20-fold molar excess (data not shown). This competition by sequences that interacted with purified TR provided evidence vitro interaction of a IRE-associated factor with ified DNA sequence in the skeletal a-actin for the in the specpromoter between nucleotide positions T3 + T3 + + c-erbA-3 + T3 pUCI8 T3 + + T3 T3 assays dem- Fig. 7. onstrating [‘B. . The skeletal a-actin TRE-associated factor is specifically competed by the defined rodent growth hormone TREs. The effect of competition, by various DNA fragments, on the complex formed in vitro with the + c-erbA.3 + #{149} 1 #{149} #{149} #{149} #{149} 7 , + #{149} #{149} 6 I pHSA432C:\T skeletal acells, in the assays were -432/+239 and -153/+239, respectively (43). These regions were linked to the gene coding for CAT. The plasmids pHSA432CAT and pHSA1S3CAT were cotransfected into COS-i cells with equal amounts of either pUC18 or c-erbA-a and cerbA-(3 cDNAs cloned into the CDM8 expression vector. After iO M T3 treatment, only pHSA432CAT exhibited a T3-dependent ence of either trans-activation (3.2-4.4-fold) in the pres- c-erbA-a or c-erbA-13 (Fig. 7, Lanes 3 and 5 versus Lanes 4 and 6). This construct contained the TRE sequences defined in vitro between nucleotide positions -173 and -149. However, the plasmid pHSA153CAT, which does not contain the TRE defined in vitro, was not inducible (Fig. 7, expenibetween nucleotide positions -432 and -153 were required for the T3/ TR-dependent trans-activation. This indicated that the IRE (-173/-i49) was functional in vivo. The presence of cotransfected TR-a or -I in the absence of ligand led to a decrease in pHSA432CAT (Fig. 7, Lanes 1 and 2 versus Lanes 3 and 5), indicating that TRs display a repressorlike function in the absence of hormone, which has been noted in other systems (8). Lanes ments by T3 in the presence of TR-a 9 and 11 versus Lanes 10 and showed that the cis sequences or TR-fl 12). These region. The cis-acting Region between Nucleotide Positions -432 and -153 in the Skeletal a-Actin Gene Contains a Functional TRE We then examined the ability of this putative TRE to mediate a T,/TR-dependent transactivation in vivo. We used two 5’ unidirectional deletion mutants, pHSA432CAT and pHSA1S3CAT, which contained se- The Skeletal a-Actin 1/CTF Binding Sites TRE Is Flanked by SpI, SRF, and NF- We decided to determine whether other transcription factors interacted with the skeletal a-actin promoter, 5’ and 3’ of the putative TRE between nucleotide positions -173 and -149. We have interference previously analysis, shown and DNase by EMSA, 1 studies methylation (31) that CBF Cell Growth Fig. 8. Schematic 37 #{149}4-SS representa- tion of the proteins interacting with the skeletal a-actin promoter, showing the relative position of the TRE versus characterized SRF, SpI, and NF-1/CTF -700 -600 -500 -300 -400 -200 -100 #{149}o sites. Spi TRE SRF gene that (A) SpI Consensus 5’G G G G TA C A (B) HSA & Differentiation 1-724 C G G AATAAT Alpha 67 9 I - 6 5 5 TGTGCGTGGGGGAAGGGGTCGACG 6 3 5 I - 6 1 3 CAGGGAGCTCGGGGGTGGGAAGAGA HSA -379/-355 HSA -2 HSA - HSA -129/-109 bers represent 3’ - SpI 1 4 1 GGGGACCCGGGCGGGGGCCCC GGCCGAGGGAGGGGGCTCGAG SpI lettering. binding binding sites a-actin gene. A, the SpI is displayed in bold Nucleotides appearing at lower frequencies in desites are displayed in plain text. B, sequences of one described in the skeletal by Evans et al. (48) strand of double-stranded oligonucleotide probes that were synthesized to represent putative SpI binding sites in the skeletal a-actin promoter. The nucleotides in these probes that were accommodated by the consensus are underlined. interacts with the skeletal a-actin promoter at positions -98/-89, -1 79/-i 70, and -225/-2i6. These regulatory regions contain the CCArGG (CC A-rich GG) sequence motif, CC (A+T-nich)6GG (32). CBF has been shown to be necessary for efficient myogenic specific expression (32, 33, 43-47), and it is biochemically and immunologically mndistinguisdhable from SRF (33, 34). Interestingly, the SRF site at -i79/-i70 is adjacent and 5’ to the skeletal a-actin TRE (Fig. 8). We decided to scan the promoter sequence for putative SpI consensus sequence motifs. The trans-acting factor SpI has been shown to interact with the degenerate binding sites, conforming to the following consensus as described by Evans et a!. (48) (Fig. 9A) (numbers are percentage of each base at that position): GM G,9 G1 121 occurrences Sites ACATGGTTGGGGAGGCCTTTGGGAC sequence sequence (num- out of seven): G7 G7 G7 Cs A5 G7 G7 G7 G5 G4 I -27 3 CTCGCCCCACCCCATCCCCTCCGGC Putative uppercase fined SpI C GCCCGCGCCTCCTCCCCGGCCGTCCGCCCTCGCCTCCCCCCGCACGT - consensus G Actin - 16 1I consensus TA HSA Fig. 9. G CCG HSA 91 have the following Sequence T Skeletal -771 CTF A11 C1 A4 G1 C82 C96 C,9 G,, G,,, C58 A,4 A,, T A21 A1, 14 Cli C7 G14 17 Gustafson and ized seven SpI binding Kedes (49) have defined sites in the human 121 A7 and charactercardiac a-actin Cl C1 C C2 11 T TI 1 In the case of the human skeletal a-actin gene, we found at least seven putative SpI binding sites in the promoter between nucleotide positions -77i and -i08 (Fig. 98). We synthesized oligonucleotide probes for each of these sites and incubated them with purified HeLa cell SpI protein (26-28) (kindly provided by J. Kadonaga, S. Jackson, and R. Tjian). All seven oligonucleotides, at nucleotide positions -77i/-724, -679/-655, -635/-6i3, -379/-355, -297/-273, -i61/-i4i, and -129/-i08, interacted with SpI in gel retardation assays but with variable degrees of affinity (Fig. iO). Interestingly, an SpI site was found to be located 3’ of the skeletal a-actin TRE, between nucleotide positions -173 and -149 (Fig. 8). In addition, these seven oligonucleotides interacted with SpI present in crude nuclear extracts, and these interactions were competed with cardiac a-actin SpI binding sites (data not shown). The SpI binding activity in these extracts was reduced during myogenic differentiation (data not shown), as previously reported by Gustafson and Kedes (49). Additional scrutiny of the nucleotide sequences of the skeletal a-actin promoter identified a putative NF-i/CTF binding site between the second and third CBF binding sites (Fig. 8). This sequence at HSA -i99/-i86, TGGGACCGGGCCAA, is compatible with the consensus sequence proposed by Jones et a!. (30): TGG(A/ c)NNNNNGCCAA. In addition, the actin gene site matches, at 1 i of i4 bases (underlined), a human 13globmn high affinity CTF site (29): TGGTATGGGGCCAA. An oligonucleotide probe, HSA -2i0/-i78, was shown to interact with a factor present in crude nuclear extract and was specifically competed by itself and by a proven CTF/NF-i site from ras [-319/-295 (29)] (Fig. hA). The identity ofthe oligonucleotide as a CTF/NF-i binding site was convincingly demonstrated by its interaction with purified CTF/NF-i from HeLa cells (kindly provided by S. Jackson and R. Tjian), as shown in Fig. i 1 B. In summary, we have demonstrated that the skeletal a-actin TRE is juxtaposed to SRF and SpI binding sites, at its 5’ and 3’ flanks, respectively. Furthermore, it is sunrounded by CTF binding a region carpeted sites (summarized by other in Fig. 8). SpI, SRF, and 38 (harac t(’ri/.itIOri ot ,ir\c Cr) Lt) ‘- (9 (0 it) N- (Y) (9 (0 I I ig. tin TREs IC) Lt) C’) C’) NC’J 0) NC’) NcY) (‘4 , , - “zt - 0 ‘- - (0 0) 1 T- (\j NN- I (‘4 < < < < < (I) I (I) I (I) I (I) I (I) (I) I I 1 (1. SpI interacts with niultiple sites in the skeletal o-actin gene. Spl Protein troll) t-lela cells int(’racts svith a number ol Grich sites in the skeletal o-,u tin I)r111tr. The (iligonucleoti(le pU)bes denoted in Fig. 9B sver(’ inc ubated with puriti(’(l Spt, and the l)ound complexes ssc’r(’ ObstrV(’(l l)V gel ‘k’ trophoresis nlol)ility shift analysis as descriI’d in ‘Materials ,uil Methods,” Purltiv(l Discussion In the human present skeletal investigation, we have shown that the a-actin promoter is capable of mediating a T1/TR-dependent trans-activation of CAT expression. Our data indicate that the Trinfluenced induction of aactin mRNA in animals (18) is a direct transcriptional effect. The putative skeletal a-actin TRE [5’ TGGTCAACGCAGGGGACCCGGGCGG 3’ (-1 73/- 1 49)] contains sequences that fit the consensus motif, C1 GG /A/ (, A/(, (3) and show homology to TREs defined by meth- ylation interference analysis in the growth hormone gene (GGGACC and GGGACG) (3). T3/TR-dependent transactivation was shown to require sequences between nucleotide positions -432 and -153 that encompassed the consensus sequences. The skeletal a-actin TRE interacts with a developmentally regulated protein from muscle cells. This DNA/protein complex is specifically com- peted by defined rGH TREs that have been shown to interact with purified thyroid hormone receptors and confer T1 regulation (3, 41, 42). The ability of T to activate the skeletal a-actin promoter was strictly dependent on the expression of either cotransfected aor fl-c-erbA genes in fibroblastic and muscle cells. These results were expected in the COS-1 cells because these cells have been shown to contain insufficient levels of TRs for trans-activation of genes after 15 treatment. In contrast, muscle is one of the tissues targeted by thyroid hormone, and hence it was unexpected that C2C12 cells should require cotransfected aor [3-c-erbfl in order to mediate a significant T response. However, a number of explanations may account for these observations. Zilz et a!. (35), among others (8), have suggested that the level of endogenous receptors is insufficient to bind to a large number of transfected DNA molecules introduced into cells. Alternatively, the endogenous receptor may be sequestered in a form not freely available to new sites in the time frame of the experiment. For example, the T1 receptor may be bound to another protein or to a chromosomal site. Consistent with this latter possibility, it is known that the receptor is localized as a chromosomably bound protein in either the presence or absence of the ligand. Thus, the TR might actually be bound to its cognate TRE sequence in the absence of hormone and not readily reequibibrated with the transfected DNA molecules. These data are consistent with other tissue culture model systems (including primary hepatocytes and cardiocytes) (8, 35) that express endogenous TRs, where it has been observed that transfected IRs are required to mediate T3 regulation of a transfected gene. Furthermore, other immortalized myogenic cell lines (e.g. L6E69) have failed to support the induction of transcription after T3 treatment, although the identical cis-acting sequence has responded to hormonal treatment in primary cardiocytes (23). However, it should also be noted that the sarcoplasmic calcium ATPase TRE only supports T1-dependent trans-activation in the presence of transfected TRs in primary cardiocytes (8). These myogenic cells may have adapted to continuous cell culture in vitro in media containing TH by expressing the nonTi-binding forms ofthe a-TRs (a2). Using the cotransfection assay, both the a and 13forms of the thyroid hormone receptor were found to activate the skeletal a-actin IRE in COS-1 and C2C12 cells. a-cerbA mRNA is much more abundant in skeletal and cardiac muscle than the 13-TR, and hence the a-TR is more likely to mediate the response of the endogenous skeletal a-actin gene in these muscles. However, no functional differences were seen between the a- and 13IRs with respect to trans-activation of the skeletal a-actin promoter. Our data support 1990 (18), who found in the hearts of normal the observations of Winegrad that skeletal a-actin and hypophysectomized 2-24 h ofT3 treatment. This induction during a time of preferential a-MHC bates the expression of this isoform studies did not distinguish a direct thyroid hormone on the gene or an ondary to changes in hemodynamics. a cis-acting motif that accounts for effect of 13 on the skeletal a-actin was et a!., induced rats after ofa-actin occurred synthesis (13 stimuof the MHC). Their regulatory effect of indirect effect secWe have identified a direct regulatory gene. Furthermore, Cell CTF/NF- I Conscnsus PROBE HSA -210/-178 COMPETITOR Human CCCGCGTI’ACCTGGGACCGGGCCAACCCGCTCC Harvey ras-1 AATFCCGAATGGCGCGCAGCCAATGGTAGGCA B NUCLEAR EXTRACF PURIFIED CFF/NF- I I 1 :: N .a COMPETITOR Fig. 1 1. NF-l/CTF o-actin promoter. was shown interacts The HSA to interact with and C2 nuclear extracts mobility shift analysis. 0 ,, 0 0 < , .< 0 B C’, X 0 < r .o ‘ X I with the skeletal -210/-186 probe purified NF-1/CTF by gel electrophoresis this could account for the quick response of skeletal aactin to hormonal or hemodynamic changes. The skeletal a-actin IRE, like the rodent and human a-MHC TREs, fit into the consensus core 13 receptorbinding motif G/ GGT/A CA/c which is a “half site” of the larger TGACCT. & Differentiation TGG(A/C)NNNNNGCCAA A CRUDE Growth palindromic/dyad Retinoic acid repeat sequence AGGTCA... and vitamin D receptors that are members of the steroid/thyroid superfamily of ligandmodulated receptors are also known to bind this palmdromic sequence. Very recently, palindromic half sites (encoding estrogen and glucocorticoid response elements) have been implicated in positive and negative responses to estrogen and glucocorticoids via interactions with their respective receptors and transcription factors such as los and jun (AP-i) with Oct-i (50-54). The function of the skeletal a-actin TRE during myogenic ontogeny may be controlled by similar regulatory mechanisms involving ubiquitous transcription factors such as SpI, SRF, and CTF, which were found to interact with regions flanking the a-actin TRE. These transcription factors have also been shown to be involved in proteinprotein interactions involving other factors (55). The ubiquitous proteins such as SpI, SRF, and CTF may act like or in concert with the TR auxiliary protein (56, 57), and other tissue-specific factors (58, 59), which have been shown to enhance binding of the receptor to the TRE in vivo via multicomponent protein complexes. Materials and Methods Cell Culture and Transfection. Mouse myogenic C2 cells supplemented with 20% previously (43). This cell biochemically and mormyotubes by mitogen with 2% FCS in 10% was essentially complete within 72to isoform switching in the actin mul- (60, 61) were grown in DMEM FCS in 10% CO2 as described line was induced to differentiate phologically into multinucleate withdrawal (DMEM supplemented C02). Differentiation 96 h with respect 39 40 Characterization of a-Actin tigene (8). However, family differentiate TREs at a very these high cells will spontaneously confluence (100%) in the presence of mitogens. COS-i fibroblasts were grown in DMEM supplemented with i0% FCS in iO% CO2. Each 60-mm dish of cells was transiently transfected with 10 of reporter plasmid mixed with an additional vectors or pUCi8 DNA. each transfection by the addition DNA expressing CAT, amount of the TR expression The total amount of DNA in experiment (1 1 jzg) was kept constant of pUCi8 DNA. Prior to transfection, the cells were cultured for 24 h in thyroid-deficient medium containing iO% charcoal-stripped FCS in DMEM. The DNA mixtures were cotransfected into C2 myoblasts and COS-i fibroblasts by the liposome-mediated procedure. We used the cationic lipid DOTAP. Unilamellar vesicles were formed by mixing-the appropriate DNAs with 30- 40 I of DOTAP and 1 X HEPES-buffered saline to a total volume of 200 jab. After a 10-mm incubation at room temperature, this mixture was added to 6 ml of fresh culture (thyroid-deficient) medium and added to the cells, which were between 50 and 70% confluent. After a period of 20-24 h, fresh medium with or without T3 (10 nM) was added to the cells. The cells were harvested for the assay of CAT enzyme activity 60-72 h after the transfection period. Each transfection experiment was performed three times using at least two different plasmid preparations in order to overcome the variability inherent in transfections. CAT Assays. The cells were harvested, and the CAT activity was measured as previously described (62). Aliquots of the cell extracts were incubated at 37#{176}C, with 0.1-0.4 cCi of [14C]chloramphenicol of S mM acetyl CoA (Amersham) in the presence and 0.25 M Tnis-HCI, pH 7.8. After a 2-4-h incubation period, the reaction was stopped by the addition of 1 ml ethyl acetate, which was used to extract the chloramphenicol and its acetylated forms. The extracted gel thin-layer ously (61). scintillation Plasmids. materials were chromatography Quantitation plates of CAT assays analyzed on as described was performed counting of the chromatograms. The plasmid pEMSV-CAT was described Davis et a!. (36). The cerless SV4O promoter plasmid linked silica previ- cells were using 10% Nonidet serum albumin, We thank Dr. Howard Towle for generously providing and -13 expression vectors in CDM8 and Drs. S. Jackson, R. Tjian for their generous gift of SpI and CTF. We thank the SpI and CTF oligonucleotides. following incubation in 10 mi HEPES (pH 7.9), 10 mt’i KCI, 0.1 mM EDTA, 0.1 mri ethyleneglycol bis(f3-aminoethyl ether)-N,N,N’,N’-tetraacetic acid, 1 mivi dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, and 2 pg/mI 3-5 g of the rat c-erbA-a N. Tanese, and Larry Kedes for References 1 . Glass, C. K., and the thyroid hormone Holloway, receptor. 1. M. Regulation Biochim. Biophys. of gene expression by Ada, 1032: 157-176, 1990. 2. Forman, nuclear B. M., and hormone nol., 1293-1301, 3. Norman, Samuels, receptors: H. H. Interactions the regulatory zipper among a subfamily model, Mol. F., growth hormone Biol. Chem., 264: Lavin, gene T. N., contains 12063-12073, Baxter, 1. D., multiple and thyroid West, B. L. The response elements. 5. Swynghedauw, tractile proteins 771, 1986. A. M., Mercadier, J. J., and Schwartz, during cardiac growth. nt. Rev. Cytol., 263: Chem., 8. Rohrer, myosin Chem., chain mRNA 6370-6374, D. hormone hormone receptor 1. Biol. sequence. B. Developmental and functional adaptation in cardiac and skeletal muscle, Physiol. Rev., heavy K., and rat J. 1989. 4. Lavin, T. N., Baxter, I. D., and Horita, S. The thyroid binds to multiple domains of the rat growth 5’ flanking Chem., 263: 9418-9426, 1988. fast myosin of Endocri- 1990. M. by P-40 and as a nonspecific The assays were mm and electropolyacrylamide: and 2 mi EDTA. acid, dried, and Acknowledgments 7. Russel, S. D., Cambon, N., Nadal-Ginard, Thyroid hormone induces a nerve independent pCAT promoter (an enhanto CAT in a pUCi9 back- lysed 6 cg of bovine polydeoxyinosinic-deoxycytidylic acid competitor in Dignam buffer C (64). incubated at room temperature for 20 phoresed through a 6% (20:1 bisacrylamide) gel in 80 mi Tnis borate Gels were briefly soaked in 10% acetic autoradiographed. 6. Lompre, expression . The of protein, by bone) was purchased from Promega. The plasmids expressing the rodent a- and fl-c-erbA genes in the eukaryotic expression vector CDM8, containing the cytomegalovirus promoter, and SV4O origin of replication were described by Zilz et a!. (35). The plasmids pHSA2000CAT, pHSA432CAT, and pHSA153CAT were described by Muscat et a!. (32, 43). Oligonucleotides. The sequences of the oligonucleotide probes used in the EMSA experiments are as follows: CArG 5’ GAAGGGGACCAAATAAGGCAAGGTGG 3’; MEF-2 5 ‘ ATCTGAAAGGCATAGCCCCATATATCAGTGATATAAATAGAACCTGCAG 3 ‘ The underlined sequences indicate the binding region for the associated factor. The TRE, SpI, and CTF oligonucleotides were described in the text. Nuclear Extracts and Gel Mobility Shift Assays. Nuclear extracts were prepared by the method of Schreiber et a!. (63). of leupeptin and aprotinin (Boehninger Mannheim). Nuclear proteins were extracted with 0.4 NI NaCI, 20 mi HEPES (pH 7.9), 1 mM EDTA, 1 mi ethyleneglycol bis(13aminoethyl ether)-N,N,N’,N’-tetraacetic acid, i m’i dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, and 2 tg/ml aprotinin and leupeptin. Each binding mixture (25 tI) contained i -2 ng of a T4 polynucleotide kinase-labeled DNA fragment, 5-10 zg K. Changes 124: 137-186, B., and skeletal in gene 1991. Whalen, precocious in rat hindlimb of con66: 710- R. G. expression of J. muscle. Biol. 1988. Hartong, retinoic R., and acid Dillman, on slow W. H. sarcoplasmic heavy chain a-gene expression 266: 8638-8646, 1991. in Influence of thyroid calcium cardiac ATPase and myocytes. J. Biol. 9, Bains, W., Ponte, P., Blau, H., and Kedes, L. Cardiac actin is the major actin gene product in skeletal muscle differentiation in vitro. Mol. Cell. Biol., 10. 4: 1449-1453, Gunning, 1984. P., Hardeman, and Kedes, L. Differential human myogenesis. Mol. 11. Gunning, alpha-cardiac P., Ponte, actin genes cle and heart. Mol. Cell. E., Wade, patterns Cell. Biol., R., Ponte, P., Bains, of transcript 7: 4100-4114, P., Blau, H., and are co-expressed Biol., 3: 1985-1995, Kedes, in adult W., Blau, accumulation 1987. H., during L. Alpha-skeletal human skeletal and mus- 1983. 12. Hayward, L. j., and Schwartz, R. J. Sequential expression of chicken actin genes during myogenesis. J. Cell Biol., 2: 1044-1051, 1982. 13. Mayer, Y., Czosnek, H., Zeelon, P., Yaffe, sion of the genes coding for the skeletal and Nucleic Acids Res., 12: 1087-1 100, 1984. 14. Minty, skeletal actin A. I., actins Alonso, S., Caravatti, M., and Buckingham, actin mRNA in the mouse and its identity Cell, 30: 185-192, 1982. muscle mRNA. D., and Nudel, cardiac U. Expresin the heart. M. E. A fast with cardiac 15. Vandekerckhove, expression of skeletal muscle tissues and 16. Vandekerckhove, evolution of muscle j., Bugaisky, G., and Buckingham, M. Simultaneous muscle and heart actin protein in various striated cells. J. Biol. Chem., 261: 1838-1843, 1986. J., de Couet, H-G., specific actins: a protein and Weber, K. Molecular chemical analysis. In: C. G. Cell Growth dos Remedios, Muscle 1983. and and j. A. Barden Non-muscle Cells, Actin: Structure pp. 241-248. (eds.), Sydney: and 1 7. Schwartz, K., Dela Bastie, D., Bouvaret, P., Olieviero, and Buckingham, M. a-Skeletal actin mRNA’s accumulate phied adult rat hearts. Circ. Res., 59: 551-556, 1986. 18. Winegrad, S., Wisnewsky, C., and hormone on the accumulation of mRNA hearts from normal and hypophysectomized USA, 87: 2456-2460, 1990. Function Academic in Press, P., Alonso, S., in hypertro- Schwartz, K. Effect of thyroid for skeletal and cardiac actin in rats. Proc. NatI. Acad. Sci. 19. Bishopric, N., and Kedes, L. Adrenergic regulation of the skeletal aactin gene promoter during myocardial cell hypertrophy. Proc. NatI. Acad. Sci. USA, 88: 2132-2136, 1991. 20. Lompre, cardiac A-M., ventricular Nadal-Ginard, B., and Mahdavi, V. Expression a- and fi-MHC genes is developmentally Chem., 259: 6437-6446, 1984. and of the hormon- J. Biol. ally regulated. 21. Isumo, S., Nadal-Ginard, B., and Mahdavi, V. All members MHC multi-gene family respond to thyroid hormone in a highly specific manner. Science (Washington DC), 231: 597-600, 1986. of the tissue 22. Gustafson, T. A., Markham, B. E., BahI, J., and Morkin, E. Thyroid hormone regulates expression of a transfected a-MHC fusion gene in fetal heart cells. Proc. NatI. Acad. Sci. USA, 84: 3122-3126, 1987. 23. Izumo, S., and Mahdavi, V. Thyroid hormone receptor generated by alternative splicing differentially activate MHC cription. Nature (Lond.), 334: 539-543, 1988. a-isoforms gene trans- 24. Tsika, R. W., BahI, j., Leinwand, L. A., and Morkin, E. Thyroid hormone regulates expression of a transfected human a-MHC fusion gene in fetal rat heart cells. Proc. NatI. Acad. Sci. USA, 87: 379-383, 39. Sturm, R. A., Das, G., and Herr, W. The ubiquitous protein Oct-i contains a POU domain with a homeo Genes & Dev., 2: 1582-1599, 1988. 9: 5022-5033, 1985. expression. 44. Mol. Miwa, and mutually cardiac actin 45, negative skeletal 47, Walsh, K., and N. C., Rigby, P. W., and Ziff, E. B. Trans-acting protein factors of eucaryotic transcription. Genes & Dev., 2: 2657- 2681, 1988. 32. Muscat, G. E. 0., Gustafson, T. A., and Kedes, L. A common factor regulates skeletal and cardiac a-actin transcription in muscle. Mol. Cell. Biol., 8:4120-4133, 1988. 33. Tuil, D., Clergue, N., Montarass, D., Pinset, C., Kahn, A., and PhanDinh Tuy, F. CCArGG boxes, cis-acting elements with dual specificity: muscle specific activation and serum responsiveness. J. Mol. Biol., 213: 677-686, 34. Boxer, actin 35. L. M., Prywes, CArG-binding sponse thyroid 1990. factor. ZiIz, factor Mol. 514 promoter. 36. Davis, transfected 1987. 9: 515-522, M. B., and Towle, response J. Biol. G., and Kedes, is indistinguishable Cell. Biol., N. D., Murray, hormone R., Roeder, elements located Chem., 265: 8136-8143, R., Weintraub, cDNA converts H., and fibroblasts from L. The sarcomeric c-los serum re- the 1989. H. Identification far upstream of multiple from the rat 1990. Lassar, A. Expression of a single to myoblasts. Cell, 51: 987-1000, box domains have R. J. A combination of closely elements regulates Biol., 10: 528-538, Mol. Cell. Schimmel, P. DNA-binding is important site for expression positive of the human associated transcription 1990. different promoter Cell. Biol., 9: 2 191for two in muscle skeletal cells. actin Mol. Cell. 1988. 48. Evans, T., DeChiara, T., and Efstratiadis, A. A promoter of the insulin-like growth factor II gene consists of minimal control elements. Mol. Biol., 199: 61-81, 1988. 49. Gustafson, which interact 50. Activation T. A., and Kedes, L. H. Identification with functional regions of the Cell. Biol., 8: 3269-3283, 1989. Mol. Gaub, M. P., Bellard, M., Scheuer, of multiple human cardiac I., Chambon, P., and of the ovalbumin gene by the estrogen complex. Cell, 63: 1267-1276, 1990. 1990. Jones, promoter 1987. CArG promoter gene. 8: 1800-1802, 29. Santoro, C., Mermod, N., Andrews, P. C., and Tjian, R. A family of human CCAAT-box-binding proteins activate transcription and DNA replication: cloning and expression of multiple cDNAs. Nature (Lond.), 334: 218-224, 1988. 31. R. J., and Moore, hormone regulatory roles in expression Cell. Biol., 7: 2803-2813, 1987. cis-acting a-actin factors 51. Diamond, cription factor and the regulation growth 46. Walsh, K. Cross binding of factors to functionally elements in the c-los and skeletal actin genes. Mol. 2201, 1989. los-jun P., Kelly, T., and Tjian, R. A transcription and DNA repli- rat 7: 4089-4099, L. Duplicated K. L., and Schwartz, and ofthe Biol., Kedes, dependent gene. Mol. Chow, positive Cell. T., and 28. Jones, K. A., Kadonaga, J. T., Luciw, P. A., and Tjian, R. Activation of the AIDS retrovirus promoter by the cellular transcription factor, Spl. Science (Washington DC), 232: 755-759, 1986. 30. Jones, K. A., Kadonaga, J. T., Rosenfeld, cellular DNA binding protein that activates cation. Cell, 48: 79-81, 1987. J. W., Koenig, 43. Muscat, G. E. 0., and Kedes, 1. Multiple 5’ flanking regions of the human a-skeletal actin gene synergistically modulate muscle specific gene promoter. activation Sci., 11: 20- Larsen, P. R., Harney, characterization of the elements required for induction by thyroid hormone with and without a cotransfected a-type thyroid hormone receptor. J. Biol. Chem., 264: 178182, 1989. Biol., 27. Kadonaga, J. T., Jones, K. A., and Tjian, R. Promoter-specific of RNA polymerase II transcription by Spl. Trends Biochem. 23, 1986. 1989. 42. Brent, G. A., D. D. Functional 25. Markham, B., BahI, j., Gustafson, T. A., and Morkin, E. Interaction of a protein factor within a thyroid hormone sensitive region of rat a-MHC gene. j. Biol. Chem., 262: 12856-12862, 1987. 511-517, octamer binding box subdomain. 41 . Forman, B. M., Yang, C-R., Stanley, F., Casanova, J., and Samuels, H. H. c-erbA protooncogenes mediate thyroid hormone-dependent and independent regulation of rodent growth hormone and prolactin genes. Mol. Endocrinol., 2: 902-911, 1988. promoter P., Kadonaga, j. T., Barrera-Saldana, H., Takahashi, K., P., and Tjian, R. Bi-directional Sv 40 transcription mediated Sp 1 binding interactions. Science (Washington DC), 230: 41 40. Gosset, L. A., Kelvin, D. J., Sternberg, E. A., and Olson, E. A new myocyte specific enhancer binding factor that recognises a conserved element associated with multiple muscle specific genes. Mol. Cell. Biol., 1990. 26. Gidoni, Chambon, by tandem & Differentiation M., Miner, interactions: from a single DNA J., Yoshinaga, selectors element. of Science S. K., and positive (Washington receptor rat J. proteins a-actin Corsi, P. 5. involves the Yammamoto, or negative DC), 249: K. Transregulation 1266-1271, 52. Yang-Yen, H-F., Chambard, J-C., Sun, Y-L., Smeal, T., Schmidt, T. J., J., and Karin, M. Transcriptional interference between c-jun and the glucocorticoid receptor: mutual inhibition of DNA binding due to Drouin, direct protein-protein 53. Schule, N., Verma, tein c-jun interaction. R., Rangarajan, Cell, I., and Evans, R. M. and the glucocorticoid 54. Bruggemeier, U., Ubiquitous transcription promoter through Kalff, 1991. 55. R. E., Shaw, Herrara, 1205-1215, M., factor Franke, Oct-i W. Darling, heterodimeters with hormone Nordheim, 58. Murray, 59. M. 68-72, with the T3 receptor. B., and Towle, Mol. M. A., and 37. Fried, M., and Crothers, D. M. Equilibrium and kinetics of lac repressor-operator interactions by polyacrylamide gel electrophoresis. Nucleic Acids Res., 9: 6505-6525, 1981. distinct nuclear thyroid hormone 38. Baumruker, T., Sturm, R. A., and Herr, W. OBP100 binds remarkably degenerate octamer motifs through specific interaction with flanking sequence. Genes & Dev., 2: 1400-1413, 1988. 60. Cell, 1989. H. C. Identification Berrodin, protein T. J. Thyroid dependent response element. E. R., and Chin, binds DNA and Endocrinol., 5: 73-84, Darling, D. S., and Koenig, R. that interfere with transcriptional interaction with a nuclear protein. of nuclear binding of the thyroid hormone receptor element. Mol. Endocrinol., 3: 1434-1442, Lazar, receptors. A. Occupation of the ccomplex is unaltered by J. 57, O’Donnell, A. L., Rosen, E. D., Thyroid hormone receptor mutations activation also interfere with receptor Mol. Endocrinol., 5: 94-99, 1991. enhance response J., Yang, oncopro1990. S., Burnside, J., Winslow, receptor-auxiliary protein (TRAP) D. S., Beebe, Triiodothyronine forms 1991. between 1217-1226, S., Scheidereit, C., and Beato, M. mediates induction of the MMTV fos serum response in vivo by a multiprotein growth factor induction. Nature (Lond.), 340: 56. L., Bolado, antagonism Cell, 62: interaction P. E., and 1990. S., Ransome, Functional receptor. synergistic 64: 565-572, 62: P., Kliewer, and factors to a thyroid J. that hormone 1989. hormone receptors form independent Mol. complexes with Endocrinol., 4: 1627-1635, a 1990. Yaffe, ogenic 725-727, cells D., and Saxel, isolated 1977. from 0. Serial dystrophic passaging mouse and differentiation muscle. Nature (Lond.), of my270: 42 Characterization of a-Actin TREs 61. Yaffe, D., and Saxel, 0. requirements for differentiation. A myogenic cell Differentiation, line with altered serum 7: 1 59-166, 1977. 62. Gorman, C. M., Moffat, L. F., and Howard, B. H. Recombinant which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol., 2: 1044-1051, 1982. genomes 63. Schreiber, E., Mathias, P., Muller, M., and Schaffner, W. Rapid detection of octamer from a small number binding proteins of cells. Nucleic with mininuclear extracts, prepared Acids Res., 17: 6419, 1989. 64. Dignam, J. D., Lebovitz, R. M., and Roeder, R. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res., 1 1: 1475-1489, 1983.