* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Hair follicle differentiation: expression, structure and
Survey
Document related concepts
Transcript
Development 114, 417-433 (1992)
Printed in Great Britain © The Company of Biologists Limited 1992
417
Hair follicle differentiation: expression, structure and evolutionary
conservation of the hair type II keratin intermediate filament gene family
BARRY POWELL*, LESLEY CROCKER and GEORGE ROGERS
Department of Biochemistry, University of Adelaide, GPO Box 498, Adelaide, South Australia, 5001
•To whom correspondence should be addressed
Summary
During hair follicle development several cell streams are
programmed to differentiate from the cell population of
the follicle bulb. In the hair cells, a number of keratin
gene families are transcriptionally activated. We describe the characterization of the type II keratin
intermediate filament (IF) gene family which is expressed early in follicle differentiation. In sheep wool,
four type II IF proteins are expressed. One gene has
been completely sequenced and the expression of three of
the genes examined in detail. The sequenced gene
encodes a 55 X 103 Mr protein of the type II keratin IF
protein family, designated KII-9 in the new nomenclature we have adopted and described in the Introduction.
The gene has a similar exon/intron structure to the
epidermal type II keratin IF genes. In situ hybridization
experiments show that the genes are expressed in the
hair cortical cells but not in the cells of the outer root
sheath, inner root sheath or medulla. During hair
Introduction
Basal cells of hair follicles and the epidermis have a high
proliferation rate and undergo programs of continuous
or cyclic renewal. Whereas the epidermis is a relatively
simple stratified tissue consisting of three to four cell
layers, hair is more complex, with at least 10 different
cell types involved in an elegant architectural structure
(for reviews see, Auber, 1950; Montagna and Parakkal,
1974; Swift, 1977; Powell and Rogers, 1990a). In the
epidermis, the proliferative cells in the basal layer
divide and differentiate as they move upwards, changing their pattern of keratin gene expression (Sun et al.
1984; Fuchs et al. 1989; Roop et al. 1989; O'Guin et al.
1990). In the hair follicle, the proliferative cells in the
follicle bulb give rise to the cell types of the hair shaft,
namely the hair cuticle, cortex and medulla, and to the
inner root sheath, as distinctive differentiation programs are activated. A particularly complex differentiation pathway is established in the keratinocytes of the
hair cortex in which some 50 or more keratin genes,
belonging to several multigene families, are sequen-
keratinocyte differentiation the type II IF genes are
sequentially activated and coexpressed in the same cells.
Expression is first detected in cells in the middle of the
follicle bulb located near the dermal papilla and,
subsequently, two of the genes are transcriptionally
activated in the differentiating keratinocytes as they
migrate upwards, in the upper part of the bulb. A fourth
type II IF gene is activated later. The genes with the
same expression pattern are also closely related in
sequence and a number of conserved elements are
present in the promoters of those genes, including a
novel element which is also found in the promoter of a
coexpressed type I IF gene and three other hair keratin
genes.
Key words: Ovis aries, hair follicle, type II keratin IF gene
sequence, KII-9, in situ hybridization, evolutionary
conservation.
tially activated (Powell et al. 1992 and unpublished
data). During terminal differentiation of the hair shaft
keratinocytes, a filament network composed of two
families of intermediate filament (IF) proteins is crosslinked with an interfilamentous matrix composed of
several families of small proteins. Each protein seems
to contain at least 15 cysteine residues (Crewther, 1976;
Powell and Rogers, 1990a) and the extensive disulphide-bond cross- linking that occurs during terminal
differentiation contributes to producing a tissue that is
resistant to physical, chemical and biological agents.
Striking protein patterns can be seen in many hairs by
electron microscopy (Rogers, 1959) suggesting an
orderly assembly of the filament network and the
associated proteins. The hair keratin IF proteins appear
to be the first differentiation-specific keratins produced
when differentiation of the hair shaft keratinocytes
commences.
The IF found in the cells of mature mammalian hairs
and horny tissue are a special subset of keratin IF,
comprising four pairs of cysteine-rich proteins
(Crewther et al. 1980; Heid et al. 1986). All IF proteins
418
B. Powell, L. Crocker and G. Rogers
are characterized by a common secondary structure
consisting of a conserved central region of 310-340
amino acids, capable of adopting an ar-helical coiledcoil conformation, flanked by end domains that are
usually large and non-helical (for review see, Steinert
and Roop, 1988). The combined protein and gene
information indicate that the IF superfamily contains
more than 40 components. Several genes have been
sequenced and their common structures and sequence
conservation suggest that they could have evolved from
a primordial gene. The present IF gene superfamily is
composed of at least 6 families and a salient feature is
the diversity of expression of the individual genes (Sun
et al. 1984; Fuchs et al. 1989; Roop et al. 1989; O'Guin
et al. 1990). The keratin IF of epithelia form the largest
group by far, comprising two families, each containing
10-15 proteins. The fundamental IF unit is composed of
a heterodimer of one type I and one type II protein and
approximately equal numbers of genes encode both
types of proteins in the genome. Molecular and genetic
data indicate that they are located in clusters and
different chromosomal locations have been mapped for
the epidermal type I IF and type II IF genes (Lessin et
al. 1988; Romano et al. 1988; Rosenberg et al. 1988;
Nadeau et al. 1989; Popescu et al. 1989). Separate gene
clusters have been described for the hair keratin IF
genes (Powell et al. 1986) but their chromosomal
locations are not known. The expression of several type
I and type II genes has been studied in keratinizing skin
epithelia where the genes are expressed in type l/tyPe II
pairs and the expression of a particular pair is restricted
to a stage in epithelial keratinocyte differentiation.
A number of immunocytochemical studies have
described the expression of keratin IF proteins in hair
follicles (French and Hewish, 1986; Lynch et al. 1986;
Heid et al. 1988a, b). However, with one exception,
each antibody appeared to recognize most of the
components of either the hair type I or type II EF
families. A single, specific antibody detected a minor
type I IF component in human hair expressed in the
upper region of the follicle bulb (Heid et al. 1988a, b).
It is clear that the multiplicity of the keratin IF proteins
and their sequence similarities has always hampered the
generation of protein-specific antibodies and, in the
hair follicle, the complexity of cell types which express
EF proteins adds a further complicating dimension. A
complementary approach, better suited to analysing the
expression of keratin genes in the hair follicle in the
absence of appropriate antibodies, is RNA in situ
hybridization and we describe here the sequential
expression of individual components of this gene family
in hair keratinocyte differentiation and the first sequence of a hair type II keratin IF gene, KII-9.
A new keratin IF nomenclature
We have adopted a new nomenclature in this paper.
The present keratin EF nomenclature is limited in its
capacity to incorporate new genes and the hair keratin
gene nomenclature is cumbersome and would benefit
from rationalization. We propose a simple modification
of the existing nomenclature of Moll et al. (1982) which
would create a flexible system that could readily
incorporate new keratin EF genes and we have adopted
this scheme in the present paper. The hair proteins
belong to the EF protein superfamily and it is particularly important that aflexible,coherent nomenclature is
adopted before any more hair EF gene sequences with
diverse names are published. For example, published
names for the wool type II keratin EF protein family are;
a-keratin, a generic term including both type I and type
El proteins (Fraser et al. 1972), low sulphur component
7a, 7b, 7c and 5 (Crewther, 1976) for the proteins, 09 for
a cDNA (equivalent to protein 7c: Ward et al. 1982),
and B and D for two of the genes (gene D is equivalent
to the 09 cDNA: Powell et al. 1989). Each designation
in the proposed system would be of the form, Kn-m.x
where K denotes keratin, n is either I or II, denoting
type I or type El, the m value is the current catalogue
number for published genes or a new number for new
genes and the x value, if necessary, would denote a
variant of an existing gene. The current numbering
system for the human keratin EF catalogue could be
retained in each designation to preserve familiar
associations and new genes or proteins would be
awarded the next available 'm' number. Thus, as
referred to in this report, K14, a type I EF keratin,
becomes KI-14 (gene) or KJ-14 (protein), K5, a type II
keratin EF, becomes KII-5 (gene) or KII-5 (protein) and
K6b becomes KII-6.2 (gene) or KII-6.2 (protein). The
hair type II keratin EF genes described in this report
have the following designations; KII-9 (gene B in
Powell et al. 1989) and KII-10 (gene D in Powell et al.
1989; 09 cDNA in Ward et al. 1982; component 7c in
Crewther et al. 1976). The genes encoding two partial
cDNAs described here are KII-11 and KII-12 and the
genes designated KII-13, KII-14 and KII-15 are A, C
and E respectively in Powell et al. (1989).
Materials and methods
DNA subcloning and sequencing
For sequencing, appropriate DNA restriction fragments were
either cloned into M13mpl8 or 19 vectors (Norrander et al.
1983) for direct sequencing, or deletion clones were generated
by the DNAase I deletion method (Anderson, 1981). Singlestranded M13 template DNA was prepared by the method of
Winter and Fields (1980). All sequencing was performed by
the dideoxy chain termination method of Sanger et al. (1980)
using either Bresatec (Adelaide, South Australia) or USB
Sequenase sequencing kits and [a^PJdATP (3000 Q/mmol:
Bresatec). The DNA was sequenced in both directions.
Double-stranded DNA fragments were labeled with 32P by
the oligolabeling method of Feinberg and Vogelstein (1983)
using a Bresatec kit.
Primer extension and RNAase protection analysis of
RNA
Primer extensions were performed with 10 fig sheep follicle
RNA as described by Kuczek and Rogers (1987) using a 20mer primer, 5'-GCAGGTCATGATCCrTCTGG-3' specific
for the 5'-noncoding region of the gene (see Fig. 3). RNAase
protection analyses using 2 fig of sheep follicle RNA per
Expression of the hair type II keratin IF gene family
protection assay were performed as described by Kreig and
Melton (1987).
Southern and northern blots
Southern transfers of DNA onto Zeta Probe membrane (BioRad) were performed by the alkali method as described by
Reed and Mann (1985). Briefly, filter-bound DNA was
prehybridized for at least 2 hours at 41°C in 47% formamide,
10% dextran sulphate, 3 x SSPE, 1% SDS, 0.5% Blotto, 0.5
mg/ml sonicated salmon sperm DNA, then hybridized
overnight in the same solution with labeled probe. The final
stringency of the posthybridization washes is given in the
figure legends. Northern blots were performed as described
by MacKinnon et al. (1990).
(i)
-10.9 (KII-9)
-4.5 (KII-13)
-3.9 (KII-14)
Tissue in situ hybridization
In situ hybridizations on paraformaldehyde-fixed and sectioned sheep wool follicle biopsies were performed as
described by Powell and Rogers (1990b). RNA and cRNA
probes labeled to high specific activity using [<r-35S]UTP
(1,350 Ci/mmol; New England Nuclear, Boston, MA) were
synthesized with either T7 or SP6 RNA polymerase by the
method of Krieg and Melton (1987) using a kit obtained from
Bresatec.
cRNA probes
Probes for the various IF genes described below were
subcloned into pGEM2 vectors (Promega Biotec).
The KII-9 3'-noncoding probe; a 196 bp fragment from the
3'-noncoding and flanking region of KII-9 (nucleotides 62566451 in Fig. 3).
The KII-10 3'-noncoding probe; a 220 bp Pstl fragment
from a type II IF cDNA clone, equivalent to KII-10 (Powell et
al. 1986), including 18 bp of the C-terminal domain of KII-10
and 200 bp of the 3'-noncoding region.
The KII-11 3'-noncoding probe; a 120 bp Smal fragment.
The type I IF gene family probe; a 435 bp Pstl fragment
encoding part of the o--helical region of a wool follicle type I
IF cDNA clone (Powell et al. 1986; Wilson et al. 1988). A
comparison of two sheep type I IF wool keratin genes over the
probe region shows 92% nucleotide similarity.
The type II IF gene family probe; a 170 bp Pstl fragment
encoding part of the a--helical region of a wool follicle type II
IF cDNA clone (Powell et al. 1986). In comparing four sheep
wool type II keratin IF genes for which sequences are
available over this region there is at least 92% nucleotide
similarity (KII-9 - this report; KII-10 cDNA clone - K. Ward
et al. unpublished data; KII-11 and KII-12 cDNAs - B.
Powell, unpublished data).
Results
The complete sequence of a wool type II keratin IF
gene - KII-9
One of two cosmids previously identified as containing
sheep wool type II IF genes (Powell et al. 1986) has
been extensively sequenced. Two genes were originally
mapped in this cosmid using a partial cDNA clone as
probe but fine mapping with exon probes from the
sequenced KII-9 gene has revealed the 5' end of a third
type II IF gene in this cosmid (KII-14: Figs 1 and 2). An
exon 1 probe detects three EcoRI fragments (Fig. 1);
the 3.9 kb fragment containing the 5' end of KII-14 was
not previously detected with the short cDNA probe
419
KII-14
Fig. 1. Hybridization of an Nterminal domain gene probe to
cosmid 150. Cosmid 150 was
digested with £coRI, transferred
to Zeta Probe membrane and
hybridized with a labeled probe
(nucleotides 854-1241 in Fig. 3)
encoding the latter half of the Nterminal domain of KII-9 and
washed under highly stringent
conditions (0.1 X SSPE, 1%
SDS, 65°C). Track (i) shows the
ethidium bromide stained digest
and track (ii) shows the
hybridzation pattern. The sizes of
the hybridizing £coRI fragments
(in kb) and the genes they are
derived from (see Fig. 2) are
indicated to the right of the
panel.
KII-9
KII-13
EcoRI sites
Fig. 2. Schematic map of the three type II IF genes in
cosmid 150. The white line overlay through KII-9 marks
the extent of the sequenced region. The location of the Nterminal domain probe used in the cosmid Southern blots
(nucleotides 854-1241 in Fig. 3) is shown below KII-9 ( • ) .
The location of the genes and the direction of their
transcription are shown (|). Note that KII-9 and KII-13
were previously identified in this cosmid but were shown in
the incorrect orientation (Powell et al. 1986). Subsequent
hybridization experiments with a bank of probes has
unambiguously confirmed the map presented here (B.
Powell, unpublished data). The 10.9* EcoRI fragment also
contains the vector sequence.
used to isolate and initially map this cosmid (Powell et
al. 1986). Partial sequencing of KII-14 has confirmed
that it is another related type II IF gene (B. Powell,
unpublished data).
The complete KII-9 gene sequence is shown in Fig. 3.
From the sequence, a mRNA of about 2 kb is predicted,
encoding a basic protein of 506 amino acids with a Mr of
55 x 103. Sequence comparisons indicate that the
predicted protein belongs to the type II keratin IF
protein class and it is very similar to the sequence of a
wool type II keratin IF protein (KII-10: component 7c,
Sparrow et al. 1989). Additionally, the sequence of the
KII-9 gene reveals a similar pattern of exon/intron
boundaries and protein domain arrangement to other
420
B. Powell, L. Crocker and G. Rogers
720
P R
P. C
R
C
C
I
T
A
A
P
Y f t G
1 ..S...C
Y
R
G
1
.
T
G
G
F
G
S
R
5
V
C
G
G
F
R
A
G
S
C
AGCCGCAGCGTCTGCGGGGGCTTCCGTGCTGGCTCCTGO
L
t
.
7
P
I
.
N
t
.
E
I
P
P
H
840
A
960
Q
C
V , .IT,
O
B
E
K
E
Q
I
K
C
L
N
N
R
F
A
A
F
I
D
K
AGTGCGTGAAGCAAGAGGAGAAGGAGCAGATCAAGTGTCTCAACAACAGGTTCGCTGCCTTCATCGACAAdGTGAGTCTCCTTGATCACACCCTTCCTGAACCTTCCCTTCCTGGGTGGG 1080
1200
1320
1440
1560
tcagtcactca 1680
gtcctgtgcaactctttgcgacc^catggactgcagcaaccagcttccctatccttcatcatctcccagagcttgctcaaactcatgtccattgagtcagtgatgcaatccgaccatctt 1800
atcttttgtctcctccttctcttgccctcagtctttcccagcatcagggtcttttccaatgagtcaactcttcacaacaagtggccaaagtattggagcttcagcttcagcatcagtcat 1920
tccaataaatattcagggttgatttcctttaggattgactggtttgatctccttgcagtccaagggactctcaagagtctccatctccagagttagaaagcatcaattctTTGGGCACTC 2040
2160
L E
V R F L E Q 0 N
GACCCTCCCCAAGCCCCTCCATCCCCCAAATAGGCTTTGGGGCAGTAGGAGCCATCTGACCCCTTCTCCCACCCCAAATGGCAGtrrGCGCTTCCTGGAGCAGCAGAACAAGCTGCTGGAG 228 0
CTGTCCTCAGAGCTCAACAGCCTGCAGGAGGTGCTGGAGGGCTACAAGAAGAGPTGAGTGTGGCTGGGGGTGATGTTGGGCACAGGAACTGGACATGGATTCAACCCACTGGACGAGATT
GTGGGGAGGTCCCTAGTGTrGTCCCCTTCACTCCTGTAAGGTGGTGACCTCCCTCTGCCCTCTTTCCACAGP7ATGAGGAGGAAGTTGCTCTGAGAGCAACAGCCGAGAATGAGT7TGTG 324 0
A L K K
GCTCTGAAGAAG^TGAGTAACATGGGATTGGGAAGCTAGACATGAGGGATATCAGAATGACATGCTCTTGTTGGGGAGATCTATGTTCTCAACCTCCCTGTGGATGCAGTGACCTTGCCA 3360
D V P C A Y ( U R K S D L E A N ( v ) E A L I Q E m P F
ATCATCACCAGGGGTCCTCTTGCTCAAAGACTCCTCATCTTCTCAG^ATGTGGACTGTGCCTACClf'ccGCAAATCAGACCTTGAGGCCAATGTGGAGGCCCTGATTCAGGAGAC'TGACTT 4 08 0
4200
4320
E
I R V L Q A| u h
ATCTGCAdGAGATCCGAGT7CTCCAAGCCCAC
l
S
P
S
H
P
I
A
S
RI S
R
A
E
A
E
D
T
I Y
S
R
V
3
I
V
K
M
D
N
S
R
D
L
|
N
M
P
»
l
)
l
V
A
E
I
K
A
Q
Y
K
C E E I K A T V I R H G E T L R
AATCATCCGTGTTGTTCTGAGTGGGTGGTACATCCCATCCTGAGTTATAAGAGCCTCTCTGCrrCCCACCAGjrGTGAGGAGATCAAGGCCACAGTGATCCGGCACGGGGAGACCCTGCGT 4 800
R T K E E I N E L N R V I Q R L T A E V E N A K C Q
CGCACCAAGGAGGAGATCAATGAGCTGAATCGCGTGATCCAGAGGCTGACGGCTGAGGTCGAGAATGCCAAGTGCCAGtTAGGGTTTTTTTGAGGCCCACCAGGTGCCCACAGGCAGTGT 4 9 2 0
~ N S K L E A A V T Q A E Q Q G E ( A ) A L
( A ) P A (ri^Rj
CTGTGTGGAGAGACCATAACCCACCTTGCTTCTCTCCTGGGCCCTTAG^CTCCAAGCTGGAGGCTGCAGTCACCCAGGCTGAGCAGCAGGGCGAGG^AGCCC7CGCTGATGCCM<GCGC 5 1 6 0
K
L
A
G
L
E
E
A
L
Q
K
A
K
Q
D
M
A
C
L
L
K
E
Y
Q
E
V
M
N
S
K
L
G
L
D
I
E
I
A
T
Y
5280
R R L L E G l Q ) E Q R
GCTCTGATTCAGTCACTAATG7TGCCTTTTTCT7TTTCCCTCTCAG^TGTGTGAAGGCGTTGGGTfCGTGAATGTCTfrTGAGTATCCTCGGCCCCGTGTGGATGGG7T7ACrrGCCTCC 5 6 4 0
5760
C V t S S R C G V V C C P I . C '
:AGfrrGTCAGCAGCTCCCGCGGCGGGGTCGTCTGCGGAGACCTCTGC 5860
V
T
g
S
V
C
S
A
P C
S
G
^
h-- A
V -a
-T --C L . C
A
P C
G (P
6000
CTGGGCGCGGGCGGCGTGGGCTCCTGCGGCATCAGCTCCTACGGCGTGGGT7CCTGCGCCAGCGTCTGCCGCAAATGTTAGGCCTCCCAACGCAGGCCCCGCCCGGGCATCTCTCCCCCG 6 1 2 0
CTGAGCCTTGTCTGTACTTCTGTTATCCTCCTCAGGGTC^AGGTTTGGGAGAGTCCCCAAACATGAAGCAGAGAAAACCCCAGGTCTCGGGTrTTCCTCTT7CCCTGGGCTCACAGCAGT 6 6 0 0
C T C G G G T T T A G C C A A G G A T G G T G C T A G G G C A C T A T A T C C T G T A A T T T T A T C C A C A C C A C C T T C A C A A G A T G T C T I G C A G A T C A A G A A C T A G A G C T C A G G G A C C C A C A G T A G C C A G G G C C 6720
CACAAGCAGTGTGTTTTATTTGTCAGTAGTATTCTTTTGCAGATATAAAAT 7 3 7 1
Expression of the hair type II keratin IF gene family
Fig. 3. Complete sequence of the sheep wool KII-9 gene
encoding a 55 x 103 Mx protein. Three type II keratin IF
protein domains, the N-terminal (H), a-helical (D) and Cterminal domains ( • ) are boxed as shown. Predicted
linker regions, LI, LI 2 and L2 within the a--helical
domain are not boxed and are in italics. The intron/exon
junctions are indicated by vertical lines and the predicted
amino acid sequences of the exons are given above the
nucleotide sequence in the one- letter code. Circled amino
acids represent differences between this predicted sequence
and the published protein sequence of a wool type II IF
protein (KII-10: component 7c, Sparrow et al. 1989). The
eukaryotic gene transcription signal sequences, the CAAT,
TATA and AATAAA sequence motifs are higlighted by
reverse text. A 24 bp palindrome about 90 bp beyond the
polyadenylation signal is shown by opposed arrows. The 20
mer used in primer extension analysis covers nucleotides
652-671 (underlined), the N-terminal domain probe from
nucleotide 638-858 (note: this probe differs from the Nterminal domain probe used in the cosmid Southern blot
and described in Fig. 1) and the C-terminal domain probe
from nucleotide 5847-6171. The fragment used in the
RNAase protection assay to determine the 3' end of the
gene was derived from a DNAase I deletion-derived M13
clone and extended from nucleotide 6256-6750. The
presence of a 42 bp direct repeat in the first intron
(nucleotides 1032-1073 then 1369-1410) is highlighted by
underlining. A highly repetitive element in the first intron
(nucleotides 1664-2030) is shown in lower case. It is
homologous to Alu-type repeats noted in the related
artiodactyl genomes of cow and goat (Duncan, 1987) and
one has also been found in the second intron of a wool
keratin type I IF gene (Wilson et al. 1988). Note: the
precise identity of the four nucleotides designated "N"
(2933-2936) has not been unambiguously determined. The
predicted amino acid sequence of KII-9 has previously
been published in a different format in the review by
Powell and Rogers (1990a). These sequence data are
available from EMBL/GenBank/DDBJ under accession
number X62509.
type II keratin IF genes. The gene is split into 9 exons,
and all the introns interrupt the coding region of the
gene at exactly the same phase of the triplet codon as
found in the human epidermal KII-5 gene (Lersch et al.
1989) and KI1-6.2 gene (Tyner et al. 1985).
The KII-9 gene produces an abundant transcript in
wool follicle RNA and northern analysis with a genespecific probe detects an mRNA of 2.3 kb in size (Fig.
4A). The start of transcription of the gene was
determined by primer extension analysis. A genespecific 20-mer priming from the 5' non-coding region
produced strong extensions on sheep wool follicle RNA
(Fig. 4B). There were two extension products, the
major one 2 bp shorter than the other, indicating minor
heterogeneity in the start site of the mRNA. 5' noncoding regions of 63 bp and 65 bp are predicted. The 3'
end of the mRNA was identified by RNAase protection
experiments (Fig. 4C). A gene fragment spanning the
putative polyadenylation signal was used in an RNAase
protection experiment with sheep follicle RNA. Two
fragments of 225 bp and 230 bp were protected (Fig.
4C) indicating that the mRNA terminates 15-20 bp
downstream of the AATAAA motif and has a 3' non-
421
coding region of about 400 bp. Exclusive of the poly(A)
tail, a mRNA of 2 kb is predicted.
Upstream of the transcription start site are CAAT
box and TATA box-like sequences. A putative polyadenylation signal is found 378 bp downstream of the
protein termination codon and about 90 bp 3' to that is a
24 bp palindrome which could form a stem-loop
structure. Interestingly, this palindrome appears to
cause premature transcription termination by SP6 and
T7 RNA polymerases in vitro (B. Powell, unpublished
data).
The 506 amino acid protein predicted from the KII-9
gene is very similar to the 491 amino acid protein (KTT10; component 7c) isolated from sheep wool and
sequenced by Sparrow et al. (1989). The N-terminal
domain of KII-9 is four amino acids shorter than the
domain in KII-10 and the C-terminal domain is 19
amino acids longer. In total there are 57 amino acid
differences between the two proteins (see Figs 3 and 5)
and the differences in the N- and C-terminal domains
are clustered to the ends of those domains. Complete Cterminal domain sequences are now available for three
hair type II IF proteins (Fig. 5). They are 69, 71 and 90
amino acid residues in length and each has an overall
cysteine composition of 14%. Although the latter half
of each domain shows considerable sequence variation
the proteins terminate in a conserved dipeptide, a basic
residue followed by cysteine.
Two partial cDNA clones (KII-11 and KII-12) have
also been isolated from a wool follicle cDNA library
using the wool KII-10 clone (B. Powell, unpublished
data) and when the sequences for the predicted proteins
are compared with the two complete sequences (KU-9
and KII-10) it is clear that they are a family of proteins
(Fig. 5). The KII-11 cDNA encodes 153 amino acids of
a type II IF protein, including part of the a-helical
domain and all the C-terminal domain. The protein
predicted from this clone is closely related to KII-9 and
KII-10; for example, it shows only one amino acid
difference, compared to 8 in the same region of the
predicted KII-12 protein (Fig. 5). The KII-12 cDNA
encodes 286 amino acids of the central a^helical domain
of a type II IF protein and differs substantially from
KII-9, KII-10 and KII-11 (Fig. 5).
Expression of the hair type II keratin IF gene family
in hair fibre differentiation
Expression of this type II keratin IF gene family in hair
follicle development was examined in a number of
different hair types. Specific cRNA probes for three
hair type II keratin EF genes and a general gene family
probe were hybridized to follicle tissue sections. Our in
situ data using these probes, in combination with genespecific probes, show that this gene family is expressed
only in the hair shaft keratinocytes and not in other hair
or epithelial cell lineages in the skin. The spatial pattern
of expression found for the IF gene whose complete
sequence is reported here is typical of the gene family
although differential timing of expression of at least two
other hair type II IF genes occurs (see below). A gene-
422
B. Powell, L. Crocker and G. Rogers
Fig. 4. Analysis of the Kll-9
mRNA. (A) Northern blot
5'
erttfmapping
fy
end
mapping
analysis.
Total wool follicle
'NortherfP:
RNA (10 II%) was
M + lx 0.2x O.lx —
M,
electrophoresed and
m
transferred to Zeta-Probe
membrane. The filter was
501 -i
probed with a gene-specific 494
489 - I
bp fragment that included 3'noncoding and 3' flanking
111sequence from Kll-9
404(nucleotides 6256-6750 in Fig.
110 J
3) and was washed at high
331stringency (0.1 x SSPE,
I
0.5%SDS; 65°C). The
approximate size of the
23kb-1
hybridizing band was
determined relative to the 18S
and 28S ribosomal RNAs.
242(B) Determination of the start
site of transcription. Track B,
extension products obtained
67when sheep wool follicle RNA
was primed with a 20 mer
190f
specific for Kll-9 (nucleotides
652-671 in Fig. 3) are shown
alongside molecular mass
markers, track M (sizes in bases). The cap sites are indicated, • . No extension products were obtained when sheep rumen
RNA was used. (C) Determination of the 3' end of the mRNA. Labeled cRNA, complementary to the expected 3' end of
the gene (see 'A' above) was hybridized to total wool follicle RNA (2 fig) then digested with varying amounts of RNAase
A and Tl. The protected fragments ( • ) were resolved by electrophoresis: (+) track, control with yeast RNA instead of
wool follicle RNA: l x - O.lx, RNAase protections with varying concentrations of RNAase;lx is 34 fig/m\ RNAase A and
1.7 jig/ml RNAase Tl: (—) track, no RNAase digestion. The sizes of molecular mass markers (M) are given in base pairs.
A
B
specific 3' noncoding region probe for Kll-9 hybridized
to the cortical cell keratinocytes of the wool follicle
(Fig. 6). Hybridization grains were first detectable in
the cells above the dermal papilla, in general within
three cells distance above the basement membrane that
separates the follicle bulb from the apex of the dermal
papilla (Figs 6 and 9). The RNA hybridization signal
was detectable until well up the hair shaft and
examination of the stage of follicle development by
multichrome staining (Auber, 1950) indicated that it
persisted into the keratinization zone. No signals were
observed in the outer root sheath or inner root sheath
cells and no signals were observed in the medulla when
medullated fibres were analysed (Fig. 7). Furthermore,
no hybridization was detectable in any epidermal cells
(data not shown).
The expression patterns obtained with three genespecific probes are shown in Figs 7, 8 and 9. The
specificity of each probe was established by genomic
Southern blots (data not shown). Cortical cell hybridization signals were observed for all probes. In situ
hybridizations performed to serial follicle cross-sections
from the upper bulb region with the three gene-specific
probes suggest that expression of KII-11 is delayed
relative to the others (Fig. 8). Immediately preceding
the section in which KII-11 expression was examined
and could not be detected (Fig. 8B,F), and therefore at
a lower point in the follicle bulb, we detected
expression of KII-10 (Fig. 8A,E). Comparison of KII10 and KII-11 expression in the upper region of the
follicle bulb in serial follicle longitudinal sections (Fig.
9E-H) clearly indicates that the initiation of KII-10
expression precedes that of KII-11. Serial sections
probed with Kll-9 and KII-10 show no difference in the
start of their expression (Fig. 9A-D). Thus, it appears
that the spatial and stage-specific expression patterns of
KII-9 and KII-10 are probably identical, whereas the
hybridization signals obtained with the KII-11 probe
suggest that it is transcriptionally activated later.
General probes were constructed to examine the
expression of the hair type I and type II IF gene
families. Each probe encoded part of the a'-helical
domain and was highly conserved (3=92% similarity)
between the known wool IF gene sequences in each
family. When serial longitudinal sections were probed a
bilobed appearance of gene expression extended down
around trie apex of the dermal papilla and was more
noticeable with the type II IF probe (Fig. 9I-L). In
serial cross-sections through the upper part of the
follicle bulb and dermal papilla expression of both type
I and type II IF genes was visible and preferentially
occurred on one side of the bulb (Fig. 10). This pattern
may indicate that cells on one side of the follicle bulb
differentiate first, or may simply reflect the normal
deflected angle of the follicle bulb relative to the hair
shaft in wool follicles, in which case it is likely that hair
423
C G ? R P G R C .£ I ? V A P- *V R- G .1 S C Y R S L T G G F G 5 V 3 V C G G F
53
KII-9
Kii-10
Gene
Protein
KII-9
KII-10
Gene
Protein
KII-12
cDNA
KII-9
KII-10
KII-12
Gene
Protein
CDNA
L N H R F A A F I D K V R F L E Q Q N K L L E T K L O F Y QNROCCESHL
. . . . . . . . .
. . . . . . . . . .
r
0 X
. . g . . . . . . .
. . . . . . . R
. . .
KII-9
KII-10
KII-12
Gene
Protein
CDNA
A D 3 G R L S S E L N S L Q E V L E G Y K K R Y E I E V A L R A T A E N E P V A L K K D V D C A Y L R K 3 D L E A N 2 2 7
. . . . . . . . . . . H v * * > * " " " ' - K * * O # I ' . ' . « . . « . . . * . « • • • . . . . v
•"
. . . . . . X ' . . . a V « ' ' - ' ' . . ' K ' " « t ' ' ' . . " . ' ' " > - V
. . . . . . . . . . . .
KII-9
KII-10
Gene
Protein
KII-12
cDNA
KII-9
KII-10
KII-12
KII-ll
Gene
Protein
CDNA
CDNA
3 R 3RAEAE3W
• •
« •
KII-9
KII-10
KII-12
KII-11
Gene
Protein
CDMA
CDNA
K
«
•
.
KII-9
Gene
KII-10
Prote
KII-11
CDNA
KII-9
KII-10
Gene
Protein
1 T (. L
KII-11
CDNA
. • i T. V C S !/ 'J
H. ,ii
I *
"•••! " <•' - '• '.. • » 'I
rir" % • v • • • • s s
Expression of the hair type II keratin IF gene family
i' :. K '. •
- ' ''
. >
J
H A & C V K Q E E K E Q I I C
:
S
.
V E A L I Q E T D F L R R L Y 1 E E I R V L Q A
. . « * « I » . . « . . . Q .
. . . . . . .
L
•
•
.
E
•
•
.
A
•
«
.
E P L F 8 G Y I E T L R R E A E C A E
169
. . . . I . . .
v .
N M D B I V A E I K A Q Y D D I A
... C
. . . . . . . . . . . . .
... c v
. . . . . . . . . . . .
« . . . v i * B B . . K - . . D * * " Q I * B '
Y R 3 K C E E I K A T V I R H G E T L R R T K E E I H E L H R V I Q R L T A E V E N A 1 C C Q B S
A V T Q A E Q 0 G E A A L A
• • • * • •
• • • • v « « l l
« « A 1 »
* • • »
. . « • . . . . . . • . . •
: j ' :
A ?
J
111
Kn-12->- • I • • • s H
D A K R K L A G L E E A L 0 K A K Q D M A C L L K E Y Q E V M H 3 K L G L D I E
« « R C * * ' * *
" • R S •
-<-Ul-12
• .. c . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . .
2«5
343
401
: ', ;, ; ; ii v h •. : v s I ! ,1 ; 5 •. v :• ; : : : v i : i i • v - •; s v : 'j A .• , s : •. 459
? '.' H u v - 1; r :. a A s "j v a
a s : i. • c I I r .-;».,
Fig. 5. Comparison of the amino acid sequences of wool keratin type II IF proteins. The amino acid sequence predicted
from the gene presented in this paper is given in full and numbered, and the other sequences are compared with it. The Nterminal and C-tenninal domains are shaded, the predicted linker regions are boxed and in italics. The amino acid
sequence of the KII-10 protein was determined by Sparrow et al. (1989). The sequences denoted KII-11 and KH- 12
represent amino acid sequences predicted from two partial cDNA clones isolated from a sheep wool follicle cDNA library
with a wool type II IF cDNA probe (B. Powell, unpublished data). The KII-11 clone of 762 bp, encodes 153 amino acids
of a type II IF protein, including part of the o--helical domain (84 amino acids) all the C-terminal domain (69 amino acids)
and 300 bp of the 3'-noncoding region. The KII-12 clone of 860 bp, encodes 286 amino acids of a type II IF protein and is
truncated at both ends, containing only sequence from the central o--helical domain of the protein. The truncated ends of
the coding regions of these clones are indicated by arrows. At positions where differences occur, the variant amino acids
are given in bold type. In the C-terminal domain of the protein predicted from the KII-11 cDNA clone there is a single
amino acid insertion, an alanine residue, circled. Note that the order of the first two amino acids of KII-10 has not been
determined (Sparrow et al. 1989).
IF gene expression is simultaneously activated in cells
equidistant from the dermal papilla (Fig. 9 and see Fig.
11).
Hair keratin gene transcription is first detected in
cells around the apex of the dermal papilla and
dramatically increases in cells above the apex (Fig. 91L). In contrast to the expression pattern shown by
general hair IF gene probes, expression of KII-9 and
KII-10 starts in cells about two to four cells above the
dermal papilla (see Figs 6 and 9A-D) and transcription
of KII-11 starts even later (Fig. 9G,H). To account for
this differential hybridization between the general
family probe and the gene-specific probe, another
related gene must be transcriptionally activated first. As
there appear to be only four wool type II IF proteins
(see above) the gene encoding the KII-12 cDNA
described in this report, a fourth member of the hair
type II IF family, is a prime candidate as the first type II
gene to be activated. The patterns of expression
revealed with the gene-specific probes suggest that the
genes of the hair type II keratin IF family are
sequentially activated and coexpressed in the same cells
(Fig. 11).
Conservation of the hair type II keratin IF gene family
in mammalian evolution
The evolutionary conservation of the hair type II
keratin IF family was compared between genomes from
the two more recent branches in mammalian evolution,
the placental mammals and the marsupial mammals
(Fig. 12). Three DNA probes, each encoding separate
domains of the protein, were used. The N-terminal, ahelical and C-terminal probes detected multiple restriction fragments in all tracks, documenting the conservation of hair type II IF genes in mammalian evolution.
The N-terminal domain probe (220 bp) encoding the
first 64 amino acids of KII-9 detected eight sheep EcoRl
fragments, four strongly and four weakly. Seven
fragments were readily detected in human DNA but
fewer and fainter fragments were detected in the more
distantly related marsupial genomes, generally two to
four fragments. The four strongly hybridizing sheep
424
B. Powell, L. Crocker and G. Rogers
Fig. 6. In situ localization of KII-9
expression to the hair cortex in
differentiating wool follicles.
Longitudinal 7 pern sections of wool
follicles from Merino sheep were
hybridized with 35S-labeled antisense
and sense (data not shown: sense
control probes produced random
signals) RNA probes from the 3'noncoding region of KII-9.
(A) Bright-field, (B) dark-field
views. C, cortex; I, inner root
sheath, ORS, outer root sheath; DP,
dermal papilla. The arrows show the
cells that line the inside of the
follicle bulb, and the basement
membrane that separates the dermal
papilla from those cells is shown by
the row of dots. Note that during
the tissue fixation there has been
some contraction of the dermal
papilla from the basement
membrane. Bar, 74 /im.
fragments correspond to the four type II IF genes,
namely KII-9, KII-10, KII-13 and KII-14, located in the
two cosmid clones previously isolated (Powell et al.
1986). The four fainter bands detected in the sheep
genomic Southern blot (Fig. 12) could represent weakly
homologous N-terminal domains from other type II IF
genes, possibly belonging to the genes specifying the
two related wool follicle type II IF cDNA clones, KII11 and KII-12 (see Fig. 5).
A similarly complex pattern is seen with each of the
other two domain probes (Fig. 12B,C). The increased
complexity of the blot with the ar-helical domain probe
is likely explained by two features of this probe. The
probe covers one of the most conserved regions of type
II EF genes, which is the sequence encoding the 3' end
of the a'-helical domain, and we expect it to detect type
II IF genes expressed in other keratinizing epithelia.
Secondly, the probe spans two intron locations found in
all type II IF genes to date and could detect a number of
EcoRl restriction fragments. Although all introns
sequenced in this region appear to be small and for KII9 and two other sheep type II IF genes (KII-13 in this
cosmid and KII-11 in another sheep cosmid [Powell et
al. 1986 and B. Powell; unpublished data]) a single
EcoRI fragment is detected, the possibility remains that
other type II IF genes could contain Eco RI sites within
this region.
The C-terminal domain probe (324 bp) encoding 77
amino acids from the end of the KII-9 protein detected
six sheep Eco RI fragments (Fig: 12C). The two
strongest are derived from KII-9, reported here, and
KII-10, in another sheep cosmid (Powell et al. 1986). In
comparing equivalent sequences from the probe and
the KII-11 cDNA there is only a 55% similarity over the
C-terminal domain region covered by the probe and
therefore the gene fragment specifying the KII-11
cDNA is likely to be one of those weakly hybridizing
fragments. Once again, a number of fragments were
readily detected in human DNA and weakly in the
other mammalian DNAs examined.
The hybridization data indicate that at least two type
II keratin IF subgroups exist within the sheep genome
and are expressed in the wool follicle. In the other
mammalian genomes examined, we do not see two
distinct groups of hybridizing fragments and, with the
exception of the human blots, at most five fragments
were detected. Those sets of fragments may represent
the genes most closely related to the sheep KII-9 probes
in the other genomes and the subgroup represented by
the weakly hybridizing fragments in the sheep DNA
Expression of the hair type II keratin IF gene family
Fig. 7. Cortical cell-specific expression of KII-9, KII-10 and
KII-11 in medullated follicles. Transverse 7 j/m sections of
wool follicles (Tukidale breed) were hybridized with 35Slabeled antisense and sense (sense control probes produced
random signals: data not shown) RNA probes from the 3'noncoding regions of KII-9 (A,B); KII-10 (C,D) and KII11 (E,F). Bright-field, (A,C,E) and dark-field views
(B,D,F). Note that there is no hybridization to the
medulla. Bar, 105 fan.
could be too different in those genomes to be detected
under our hybridization conditions.
Discussion
The formation of hairs involves the terminal differentiation of several cell types from a population of
mitotically active cells in the follicle bulb. Keratinocytes
of the differentiating hair shaft express a number of
keratin proteins (Crewther, 1976; Gillespie, 1983) and
these are produced from several multigene families (for
review see Powell and Rogers, 1990a) in specific
sequential transcription patterns (Powell et al. 1992 and
unpublished data). During this process the type II IF
proteins interact with their type I counterparts to create
a filament scaffold to which a number of families of
small cysteine-containing proteins are believed to
complex in the later stages of differentiation. We have
425
characterized the expression of one of the major gene
families in hair follicle differentiation, the hair type II
keratin IF gene family.
Two families of hair keratin IF proteins are present in
mammals (Marshall and Gillespie, 1977; Crewther et al.
1980; Heid et al. 1986; Powell and Rogers, 1986) and
they appear to be subsets of epidermal keratin IF (for
review see Powell and Rogers, 1990a). Their N- and Cterminal domains are immediately distinctive, with a
high proportion of cysteine residues, and a mathematical analysis of keratin IF sequence similarities in the ahelical rod region confirms a subset classification
(Conway and Parry, 1988). In each hair keratin family
there are four predominant proteins and an additional
minor component has been found in human and bovine
hair but not in sheep wool (Heid et al. 1988a). Three
hair type I keratin sequences have been published, a
protein, a gene and a cDNA, two representing sheep
wool proteins (Dowling et al. 1986; Wilson et al. 1988)
and one representing a mouse hair protein (Bertolino et
al. 1988). The complete gene sequence encoding a hair
type II IF protein (KII-9) is reported here, and the
partial protein sequences of two related proteins (KII11 and KII-12) derived from cDNA clones, in combination with the sequenced wool KII-10 protein (component 7c; Sparrow et al. 1989) represent a family of
four hair type II keratin proteins (Fig. 5). However, the
hair type II keratin IF gene family can be divided into at
least two subgroups, classified by different sequences
encoding the protein N- and C-terminal domains.
Within the subgroup typified by KII-9, two genes are
expressed in the hair follicle, KII-9 and KII-10, and
there are at least two other genes, KII-13 and KII-14,
which are not expressed in the follicle.
Expression of hair keratin IF genes during
differentiation of the hair
One of the first markers of hair keratin gene expression
appears to be the transcription of the IF genes. We have
compared the expression of the hair type I and type II
keratin IF gene families and examined the expression of
three type II IF genes in detail. Our in situ hybridization
studies indicate that expression of some of the hair type
I and type II keratin IF genes commences in follicle
bulb cells located near the dermal papilla (Figs 9I-L and
10) and that differential expression of hair type II genes
occurs during hair keratinocyte differentiation (Figs 8
and 9).
Two principles of gene expression have emerged
from the epidermal keratin IF genes that have been
studied; namely, coexpression of type I and type II
genes and differential expression of genes during the
movement of epidermal cells from the basal layer (Sun
et al. 1984; Fuchs et al. 1989; Roop et al. 1989; O'Guin
et al. 1990). In the epidermis the keratin genes
expressed in the basal keratinocytes are down-regulated
and new keratin genes are transcriptionally activated as
the cells move upwards. The hair type II keratin genes
are sequentially activated but do not appear to be
down-regulated during follicle growth.
A number of immunocytochemical studies have
426
B. Powell, L. Crocker and G. Rogers
D
>\
Fig. 8. Developmental expression of hair type II IF genes
in wool follicles. Serial transverse 7 \an sections of wool follicles
(Merino x Dorset Horn breed) were hybridized with 35S-labeled antisense and sense (data not shown: sense control probes
produced random signals) RNA probes from the 3'-noncoding region of KII-9 and KII-10 or the KII-11 cDNA clone (see
Materials and methods for origin of clones). A is the lowest section shown, B, C and D are serially higher. (A-D) Brightfield, (E-F) dark-field views. In order the panels are; KII-10 (A,E); Kll-11, (B,F); KII-9, (C,G); KII- 10, (D,H). Note the
changing hybridization pattern with different gene probes to the two follicles sectioned through the upper bulb region
(arrows). Bar, 105 /an.
shown the expression of keratin IF proteins in hair
follicles (French and Hewish, 1986; Lynch et al. 1986;
Heid et al. 1988a, b). With one exception, each
antibody appeared to recognize most of the components of either the hair type I or type II IF families.
The single, specific antibody produced in those studies
detected a minor type I IF component in human hair
(Heid et al. 1988a, b). The initial staining in the follicle
bulb cells with the general antibodies was weak but
soon increased in cells around and above the apex of the
dermal papilla. Whereas some staining patterns
(French and Hewish, 1986; Heid et al. 1988a, b) began
in the middle of the follicle bulb other antibodies did
not stain those lower bulb cells, but first showed
staining in the upper bulb cells around the apex of the
dermal papilla (Lynch et al. 1986). Differences in
sensitivity may account for these variations or, alternatively, differences in antibody specificity. It is clear that
the multiplicity of the keratin IF proteins and their
sequence similarities has always hampered the generation of protein-specific antibodies and, in the hair
follicle, the complexity of cell types that express IF
proteins adds a further complicating dimension. RNA
in situ hybridization, a complementary approach to
immunolocalization, can be a more specific approach to
analysing the expression of keratin genes in the hair
follicle. Our data with general hair IF and gene-specific
probes unequivocally demonstrate sequential expression of hair type II IF genes in follicle differentiation (Fig. 11).
The hair cells that express these keratin IF genes are
differentiating as they move upward from the follicle
bulb. The first cells in which hair keratin gene
transcripts were detected were in the middle bulb
region around the top of the dermal papilla (Fig. 10).
Similar results were observed in rat hair follicles with a
longer sheep wool type I keratin IF gene probe (Kopan
and Fuchs, 1989). In relative distance from the top of
the dermal papilla expression of KII-9 and KII-10 starts
two to four cells above it and KII-11 starts another two
to four cells later. With the general antibodies staining
was first detectable in cells at least two to three cell
Expression of the hair type II keratin IF gene family
All
Fig. 9. Expression of the hair type I and type II IF genes in follicle development. Serial 7 ym sections of wool follicles
were hybridized with 35S-labeled antisense and sense (data not shown: sense control probes produced random signals)
RNA probes from the 3'-noncoding region of KII-9, KII-10 or the KII-11 cDNA clone, or general hair type I or II IF
probes (see Materials and methods for origin of clones). For reference, the arrows indicate the follicle bulb cell at the apex
of the dermal papilla. (A,B and C,D) serial follicle sections (Merino breed) hybridized with KII-9 3'-noncoding probe (A,
bright-field; B, dark-field) or KII-10 3'-noncoding probe (C, bright-field; D, dark-field). (E,F and G,H) serial follicle
sections (Merino x Dorset Horn breed) hybridized with KII-10 3'-noncoding probe (E, bright-field; F, dark-field) or KII11 3'-noncoding probe (G, bright-field; H, dark-field). (I,J and K,L) Serial follicle sections (Merino breed) hybridized with
a general hair type I keratin IF probe (I, bright-field; J, dark-field) or a general hair type II IF probe (K, bright-field; L,
dark-field). The plane of sectioning gives a false appearance of a constriction in the I, J follicle section. Bars: (A-D) 54
mm; (E-L) 60 /an.
428
B. Powell, L. Crocker and G. Rogers
Fig. 10. Expression of the hair type I and type II IF genes in the follicle bulb. Transverse 7 ^m sections of wool follicles
(Merino x Dorset Horn breed) were hybridized with 35S-labeled antisense and sense (data not shown: sense control probes
produced random signals) general hair type I or II IF probes (see Materials and methods for origin of clones). (A) Brightfield, (B) dark-field view of follicle hybridized with a hair type II IF gene probe. (C) Bright- field, (D) dark-field view of
follicle hybridized with a hair type I IF gene probe. The centrally located dermal papilla cells are indicated by arrows.
Note that the follicle section in C and D which shows an even pattern of hybridization is a suprabulbar cross-section. Bar:
120/an.
layers removed from the dermal papilla, although in a
few instances very weak staining of some cells adjacent
to those in contact with the basement membrane was
seen (Heid et al. 1988a, b; Moll et al. 1988). A type I
keratin IF protein present in low abundance in human
hair was shown to be expressed at a late stage in follicle
differentiation (Heid et al. 1988a) like the sheep KII-11
gene (Fig. 9G,H).
The hair keratin IF gene families are not expressed in
the epidermis, and in the follicle their expression is
restricted to the cells of the upper bulb and hair shaft
keratinocytes. We have not seen any hybridization to
the medulla with our hair IF gene probes (Fig. 7).
Antibody studies of human and bovine hair follicles
indicate that hair-related keratin IF are also expressed
in the cuticle cells (Heid et al. 1988a). From our in situ
data it is not clear whether the hair keratin IF genes are
expressed in the hair shaft cuticle cells. Because the
wool cuticle is composed of only a single layer of cells,
we have not been able to distinguish between expression in adjacent cortical and cuticle cells with 35 Slabeled probes when there is expression in the cortex.
Other 'hard' keratin structures, such as nail, hoof and
horn have previously been shown to possess proteins
with similar characterisitics to hair keratin IF (Marshall
and Gillespie, 1977; Marshall, 1983; Baden and Kubilus, 1984). Hair-related proteins are found in the
keratinising cells of hoof and nail (Lynch et al. 1986;
Heid et al. 1988b; Moll et al. 1988), tongue (Heid et al.
1988b; Dhouailly et al. 1989) and possibly even in some
thymic cells (Heid et al. 1988b). One hair-related
protein expressed in the tongue appears to be a novel
Expression of the hair type II keratin IF gene family
Fig. 11. Sequential transcriptional activation of hair type II
keratin IF genes during hair differentiation. This schematic
depiction of the expression patterns of hair type II EF
genes is based on the in situ hybridzation data presented in
this report. Upward cell movement and differentiation are
shown by arrows and the sequential expression of the hair
type II IF gene family is shown by an increase in stippling
density. A type II EF gene, possibly KII-12 (see text) is
transcriptionally activated in cells near the apex of the
dermal papilla, represented as an arc of expressing cells
(stippled). As these keratinocytes move up two other type
II LF genes {K1I-9 and KII-10) are transcriptionally
activated in the upper part of the bulb (cross-hatched). A
fourth hair type II EF gene (Kll-11) is activated a little
later (black). DP, dermal papilla; IRS, inner root sheath;
ORS, outer root sheath.
type I keratin IF, larger than any already identified
(Dhouailly et al. 1989). We have recently found that
KII-10 is expressed in sheep hoof and in the embryonic
claw epithelium of transgenic mice (B. Powell, unpublished data). The two hair-like type II keratin IF genes
in our cosmids that are not expressed in the hair follicle
(KII-13 and KII-14, see above) are also candidates for
expression in these epithelia. In one cosmid we
sequenced the 5' end of a novel hair-like type II IF gene
which is not expressed in the hair follicle (KII-15:
Powell et al. 1989 and B. Powell, unpublished data).
The predicted N-terminal domain of KII-15 contains
five cysteine residues, compared to the 10 or more
present in KII-9 and KII-10 and, interestingly, its
predicted amino acid sequence looks like a hybrid
between a hair and an epidermal type II protein, the
human KII-6.2 protein (Tyner et al. 1985). Clearly
there are hair or hair-related genes that are expressed in
a diversity of epithelia and to positively identify the
keratin IF genes expressed in these epithelia in situ
hybridizations with gene-specific probes are required.
Regulation of hair type II keratin IF gene expression
The keratin IF gene family is a multigene family whose
genes are expressed in a variety of different epithelial
cell types and under specific expression programs
during the differentiation of those cells. The gene
sequences and transcription factors that regulate these
expression patterns are not precisely known, but rapid
advances are being made towards discovering them. In
hair keratinocyte differentiation the coexpression of
429
hair type I and type II IF genes and the differential
expression of the type II genes and several other
families of genes encoding the hair matrix proteins
(Powell et al. 1992 and unpublished data) point to the
operation of complex regulatory mechanisms.
Inspection of the promoter region of the hair KII-9
gene and comparisons with a number of other hair
keratin genes from sheep has revealed several conserved sequence motifs which could be involved in the
regulation of hair keratin gene expression (Fig. 13 and
see Powell et al. 1992). One interesting motif, a 9 bp
nearly palindromic sequence, 5'-CTTTGAAGA-3', is
located 209 nucleotides upstream of the transcription
start site of KII-9. This motif, denoted HK1, was
initially identified in a survey of 15 hair keratin genes,
being found in the promoter regions of six genes,
including keratin IF and keratin IF-associated genes,
and located between 180 and 240 bp upstream of the
transcription start sites (Powell et al. 1992). It is well
conserved, with only three nucleotide mismatches
amongst the several copies. It is not present in the
proximal promoter regions of any epidermal keratin IF
genes but, intriguingly, the 5' half of the HK1 motif is
present in some putative regulatory elements in a
recently compiled vertebrate gene survey (Locker and
Buzard, 1990) and in the promoters of three human
keratin IF genes (Johnson et al. 1985; Tyner et al. 1985;
RayChaudhury et al. 1986).
To date, two motifs have been found in the
promoters of epidermal keratin IF genes and shown to
be involved in DNA-protein interactions (Leask et al.
1990; Snape et al. 1990). Both are similar to the AP2
consensus sequence and do not direct tissue-specific
expression but seem to have a more general role in
keratin gene transcription. The HK1 motifs in the
promoters of the two expressed hair type II keratin
genes (KII-9 and KII-10) are part of longer regions of
DNA conservation which include API and KTF1 motifs
(Snape et al. 1990), and both could be potential
regulatory elements of these genes (Fig. 14). The KII-9
sequence is similar to the API motif, whereas the KII10 sequence is more like the KTF1 motif.
In addition to the sequences discussed above there
are potential binding sites for API and AP2 elsewhere
in the hair KII-9 promoter. The API motif is palindromic and one of the slightly variant API motifs located in
the first intron of KII-9 is part of a much longer
palindromic sequence (Fig. 13). Interestingly, that
sequence is conserved in three other sheep type II genes
(KII-10, KII-13 and KII-14; B. Powell, unpublished
data). Both KII-9 API motifs differ in only the last
nucleotide from the highly conserved API consensus
sequence identified by Risse et al. (1989). Significantly,
FOS protein has recently been demonstrated in rat hair
follicles by immunohistochemisty (Fisher et al. 1991)
and its expression pattern seems to parallel our in situ
hybridization data with the hair keratin IF gene probes.
With the finding of consensus API motifs in the
promoter regions of the hair KII-9 and KII-10 genes
(Fig. 14 and Powell et al. 1992), these data suggest a
role for API in hair keratin gene transcription.
430
B. Powell, L. Crocker and G. Rogers
Fig. 12. Mammalian Southern
blots with wool type II keratin IF
gene probes. Four /ig of EcoRIdigested genomic DNAs from
placental mammals (sheep,
human and mouse) and marsupial
mammals (possum, Trichosurus
vulpecula; quo 11, Dasyurus
viverrinus; wallaby, Macropus
eugenii) were electrophoresed
through a 0.8% agarose gel in
TAE buffer (Maniatis et al. 1982)
and transferred to Zeta-Probe
membrane using a vacuum
blotting apparatus. All final post
hybridization washes were 2x
SSPE, 1% SDS at 65°C. (A) Nterminal domain probe. The 221
bp N-terminal domain probe was
derived from KII-9, nucleotides
638-858 (see Fig. 3). The filled
arrowhead ( • ) indicates the
EcoKl band representing KII-9
and the open arrowheads ( > )
represent, from top to bottom,
KII-10, KII-13 and Kll-14. (B)
The o^helical domain probe was a
237 bp Pstl fragment derived
from the KII-10 cDNA clone
used to isolate this cosmid
(Powell et al. 1986). The
equivalent nucleotide sequence in
KII-9 has 96% similarity to the
KII-10 cDNA sequence and the
corresponding Pst I sites are conserved and are found at nucleotides 5185 and 5913 in the gene sequence in Fig. 3. The
filled arrowhead ( • ) indicates the EcoRI band representing KII-9. (C) C-terminal domain probe. The C-terminal domain
325 bp probe was derived from KII-9, nucleotides 5847-6171 (see Fig. 3). The filled arrowhead ( • ) indicates the EcoBA
band representing KII-9 and the open arrowhead (t>) represents KII-10. Note: The end of the gel containing DNA < 1 kb
in size was accidently lost.
N-Termina) Domain Probe
Placental
( Marsnpial
B
<t-Heikftl Domain Probe
Placental
• Marsupial
S/S//J/
il
AP2
TAGGCCCCCCACTCACACCTGCACACACACAGGTCACCTGCTTCTACCACTTCTGGTTTCc£TTCTCCTCCCTCCACTCTCto<X^
ACTGGCATCTTTTACATAGAGGAGGGTGCGGGCCACTATTAAAGCACATTCTAGAGAGGC
-237
t****
CCAAT
*
ACCCTGAGGCT
KTF1
" 117
M.lTkrCf,
AGTTTCC ACAAGACTCC AGCTCACCTCTCCTGTACTCTGCAACCTACACCTCCAGAAGGATC ATGACCTGC
TATA
EXON1
Fig. 13. Conserved DNA sequence motifs in the promoter of the hair type II IF gene. A number of DNA sequences
are conserved between KII-9 and the promoter region of another sheep type II IF gene expressed in the wool
follicle, and several motifs identified in the promoters of other unrelated genes were noted too. The HKI motif was
identified in a survey of other wool keratin genes (Powell et al. 1992). The two transcription start sites mapped by
primer extension (Fig. 4B) are shown by arrows and the most 5' site is denoted as +1, the start of KII-9 transcription.
The 5 shaded and/or unlabeled boxed regions indicate sequences that are conserved in another wool gene, KII-10
(Powell et al. 1992). The FfKl, API and one of the AP2 motifs are found in these longer conserved sequences.
A palindromic sequence encompassing an API motif in the intron is depicted by inverted arrows. Consensus API
(TGA^TCA: Risse et al. 1989) and AP2 (CC^C^GGC: Mitchell et al. 1987) motifs are boxed, the CAAT and TATA
motifs are depicted by white type and the KTF1 motif, identified in a Xenopus type I keratin IF gene (Snape et al. 1990)
is given below a similar sequence in the KII-9 promoter.
Expression of the hair type II keratin IF gene family
HKl
431
References
-217 JTJTGAAGP TGAAAC-ATGCJGfcCTC:
-186 rrfTGAAG? TGAAACAGGCCTG IGGC :
VTGAACC CAG
ACCATG IAGC r
-236
-178 TTTTTGTTTAACAAACACCCyC }CGC r
-66 CCCCTTGGCTTTCATCACCCAC ICCC I
-250 TCCGATGGGAAAGTGTAGCCJG pSCC ;
-139 TCGTAAAAATCTTGTATTGGCJG £«X \
CCCCWWC
Sheep
Sheep
Sheep
Xenopus
Hum«n
Human
Hunuui
typeIIIF-tf//-9
type II IF-*//-/0
typel IF
typel IF
(KTF1)
typel IF -Kl-14 (KTF1)
typel IF -Kl-14 (KER1)
type U IF -K1I-1 (KER1)
AP2conseram
Fig. 14. A comparison of the promoter regions of hair and
epidermal keratin IF genes. This comparison of the
proximal promoter regions of three hair and three
epidermal-expressed keratin IF genes is centred on the
region containing the hair HKl motif and the epidermal
KTF1 (Snape et al. 1990) and KER1 motifs (Leask et al.
1990). The HKl motif in the promoters of three hair
keratin IF genes described in the text is highlighted.
Nucleotides in common with the Xenopus KTF1 motif are
shown in bold. The AGGC motif of the right half of the
AP2 consensus sequence (Mitchell et al. 1987) and
corresponding sequences in the keratin gene promoters are
boxed. In the sheep wool KII-9 gene the similarity to the
API consensus sequence (Risse et al. 1989) is overlined.
Inverted repeats in each motif are indicated by opposed
arrows. In the promoter regions of the sheep type I gene
and the type II IF KII-9 gene, gaps of four and one
nucleotide respectively have been introduced to match the
positions of the HKl and KTFl-like similarities in those
promoters to the KIl-10 gene promoter. Note that the
conservation of nucleotides between the sheep type II IF
gene sequences extends several nucleotides 3' to the HKl
motif. The KTFl-like similarity in the Kl-14 promoter is
present on the opposite strand relative to the other motifs.
A central C nucleotide in the two KER1 motifs is
displaced below the sequence to highlight the similarity to
the KTF1 motif. Sequences are numbered negatively with
respect to the transcription start sites. The sequences are
from the following sources; sheep KII-9 gene sequence
(this report), sheep KII-10 gene sequence (Powell et al.
1992), sheep type I IF gene sequence (Wilson et al. 1988),
Xenopus type I IF sequence (Snape et al. 1990), human
Kl-14 (KTF1) sequence (Marchuk et al. 1985), human Kl14 (KER1) sequence (Leask et al. 1990) and human KII-1
sequence (Johnson et al. 1985).
In hair keratinocyte differentiation both coordinate
and differential expression patterns of hair type II IF
genes have been identified by in situ hybridization. It is
now important to determine which of the conserved
DNA motifs located in the promoters of these genes are
involved in the regulation of hair keratin expression.
We thank Dr David Hayman for providing the marsupial
DNAs, Dr Elizabeth Kuczek for the northern blot analysis,
Elaine Batty for her skill in producing longitudinal follicle
sections from sheep skin biopsies, Antonietta Nesci for help
with the in situ hybridizations, Michael Calder for photographic assistance and Simon Bawden for comments on the
manuscript. We also thank Dr. David Parry for his comments
on our suggestions for a unified keratin IF protein and gene
nomenclature. This work was supported by a grant from the
Wool Research Trust Fund on the recommendation of the
Australian Wool Corporation.
Anderson, S. (1981). Shotgun DNA sequencing using cloned DNase
I-generated fragments. Nucl. Acids Res. 9, 3015-3027.
Auber, L. (1950). The anatomy of follicles producing woolfibreswith
special reference to keratinization. Trans. R. Soc. Edinb 52(partl),
191-254.
Baden, H. P. and Kubilus, J. (1984). A comparative study of the
immunologic properties of hoof and nail fibrous proteins. J. invest.
Derm. 83, 327-331.
Bertolino, A. P., Checkla, D. M., Nottennan, R., Sklaver, I., SchifT,
T. A., Freedberg, I. and DiDona, G. J. (1988). Cloning and
characterization of a mouse type I hair keratin cDNA. J. invest.
Derm. 91, 541-546.
Conway, J. F. and Parry, D. A. D. (1988). Intermediate filament
structure: 3. Analysis of sequence homologies. Int. J. Biol.
Macromol. 10, 79-98.
Crewther, W. G. (1976). Primary structure and chemical properties of
wool. In Proceedings of the 5th International Wool Textile Research
Conference, Vol. I. (ed. K. Ziegler), pp. 1-101. Aachen: German
Wool Res. Inst.
Crewther, W. G., Dowling, L. M., Gough, K. H., Marshall, R. C. and
Sparrow, L. G. (1980). The microfibrillar proteins of a^keratin. In
Fibrous Proteins: Scientific, Medical and Industrial Aspects, Vol. 2.
(ed. D. A. D. Parry and L. K. Creamer), pp.151-159. New York:
Academic Press.
Dhouailly, D., Xu, C , Manabe, M., Schenner, A. and Sun, T.-T.
(1989). Expression of hair-related keratins in a soft epithelium:
subpopulations of human and mouse dorsal tongue keratinocytes
express keratin markers for hair-, skin-, and esophageal-types of
differentiation. Expl. Cell Res. 181, 141-158.
Dowling, L., Crewther, W. G. and Inglis, A. S. (1986). The primary
structure of component 8c-l, a subunit protein of intermediate
filaments in wool keratin. Biochem. J. 236, 695-703.
Duncan, C. H. (1987). Novel Alu-type repeat in artiodactyls. Nucl.
Acids Res. 15, 1340.
Felnberg, A. P. and Vogelstein, B. (1983). A technique for
radiolabeling DNA restriction endonuclease fragments to high
specific activity. Analyt. Biochem. 132, 6-13.
Fisher, C , Byers, M. R., Iadrola, M. J. and Powers, E. A. (1991).
Patterns of epithelial expression of Fos protein suggest an
important role in the transition from viable to cornified cell during
keratinization. Development 111, 253-258.
Fraser, R. D. B., MacRae, T. P. and Rogers, G. E. (1972). Keratins.
Their Composition, Structure and Biosynthesis. Springfield Illinois:
Charles C. Thomas.
French, P. W. and Hewish, D. R. (1986). Localization of low-sulphur
keratin proteins in the wool follicle using monoclonal antibodies. J.
Cell Biol. 102, 1412-1418.
Fuchs, E., Stoler, A., Kopan, R. and Rosenberg, M. (1989). The
differential expression of keratin genes in human epidermal cells.
In The Biology of Wool and Hair. (eds. G.E. Rogers, P.J. Reis,
K.A. Ward and R.C. Marshall), pp. 287-309. London: Chapman
and Hall.
Gillespie, J. M. (1983). The structural proteins of hair: isolation,
characterization and regulation of biosynthesis. In Biochemistry
and Physiology of the Skin, 1st edition, (ed. L. A. Goldsmith), pp.
475-510. Oxford: Oxford Univ. Press.
Held, H. W., Moll, I. and Franke, W. W. (1988a). Patterns of
expression of trichocytic and epithelial cytokeratins in mammalian
tissues. I. Human and bovine hair follicles. Differentiation 37, 137157.
Held, H. W., Moll, I. and Franke, W. W. (1988b). Patterns of
expression of trichocytic and epithelial cytokeratins in mammalian
tissues. II. Concomittant and mutually exclusive synthesis of
trichocytic and epithelial cytokeratins in diverse human and bovine
tissues (hair follicle, nail bed and matrix, lingual papilla and thymic
reticulum). Differentiation 37, 215-230.
Held, H. W., Werner, E. and Franke, W. W. (1986). The complement
of native o^keratin polypeptides of hair-forming cells: a subset of
eight polypeptides that differ from epithelial cytokeratins.
Differentiation 32, 101-119.
Johnson, L. D., Idler, W. W., Zhou, X.-M., Roop, D. R. and Steinert,
432
B. Powell, L. Crocker and G. Rogers
P. M. (1985). Structure of a gene for the human epidermal 67-kDa
keratin. Proc. natn. Acad. Sci. U. S. A. 82, 1896-1900.
Kopan, R. and Fuchs, E. (1989). A new look into an old problem:
keratins as tools to investigate determination, morphogenesis and
differentiation in skin. Genes Dev. 3, 1-15.
Kreig, P. A. and Melton, D. A. (1987). In vitro RNA synthesis with
SP6 RNA polymerase. Methods in Enzymol. 155, 397^15.
Kuczek, E. S. and Rogers, G. E. (1987). Sheep wool glycine +
tyrosine-rich keratin genes: a family of low sequence homology.
Eur. J. Biochem. 166, 79-85.
Leask, A., Rosenberg, M., Vassar, R. and Fuchs, E. (1990).
Regulation of a human epidermal keratin gene: sequences and
nuclear factors involved in keratinocyte-specific transcription.
Genes Dev. 4, 1985-1998.
Lersch, R., SteUmach, V., Stocks, C , Gludlce, G. and Fuchs, E.
(1989). Isolation, sequence and expression of a human keratin K5
gene: transcriptional regulation of keratins and insights into
pairwise control. Molec. cell. Biol. 9, 3685-3697.
Lessin, S. R., Huebner, K., Isobe, M., Croce, C. M. and Stelnert, P.
M. (1988). Chromosomal mapping of human keratin genes:
evidence of non-linkage. /. invest. Derm. 91, 572-578.
Locker, J. and Buzard, G. (1990). A dictionary of transcription
control sequences. DNA Sequence 1, 3-11.
Lynch, M. H., O'Guin, W. M., Hardy, C , Mak, L. and Sun, T.-T.
(1986). Acidic and basic nail/hair ("hard") keratins: their
colocalization in upper cortical and cuticle cells of the human hair
follicle and their relationship to "soft" keratins. /. Cell Biol. 103,
2593-2606.
MacKinnon, P. J., Powell, B. C. and Rogers, G. E. (1990). Structure
and expression of genes for a class of cysteine-rich proteins of the
cuticle layers of differentiating wool and hair follicles. /. Cell Biol.
I l l , 2587-2600.
Maniatis, T., Fritsch, E. F. and Sambrook, J. (1982). Molecular
Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory.
U. S. A.
Marchuk, D., McCrohon, S. and Fuchs, E. (1985). Complete
sequence of a type I human keratin gene. Presence of enhancer-like
elements in the regulatory region of the gene. Proc. natn. Acad.
Sci. U. S. A. 82, 1609-1613.
Marshall, R. C. (1983). Characterization of the proteins of human
hair and nail by electrophoresis. /. invest. Derm. 80, 519-524.
Marshall, R. C. and Gillespie, J. M. (1977). The keratin proteins of
wool, horn and hoof from sheep. Aust. J. biol. Sci. 30, 389-400.
Mitchell, P. J., Wang, C. and Tjlan, R. (1987). Positive and negative
regulation of transcription in vitro: enhancer-binding protein AP-2
is inhibited by SV40 T antigen. Cell 50, 847-861.
Moll, I., Held, H. W., Franke, W. W. and MoU, R. (1988). Patterns of
expression of trichocytic and epithelial cytokeratins in mammalian
tissues. Ill Hair and nail formation during human fetal
development. Differentiation 39, 167-184.
Moll, R., Franke, W. W., Schiller, D. L., Gelger, B. and Krepler, R.
(1982). The catalog of human cytokeratin polypeptides: patterns of
expression of specific cytokeratins in normal epithelia, tumours and
cultured cells. Cell 31, 11-24.
Montagna, W. and Parakkal, P. F. (1974). The Structure and Function
of Skin. 3rd edit. New York: Academic Press.
Nadeau, J. H., Berger, F. G., Cox, D. R., Crosby, J. L., Davlsson, M.
T., Ferrara, D., Fnchs, E., Hart, C , Hunihan, L., Lalley, P. A.,
Langley, S. H., Martin, G. R., Nichols, L., Philips, S. J., Roderick,
T. H., Roop, D. R., Ruddle, F. H., Skow, L. C. and Compton, J. G.
(1989). A family of type I keratin genes and the homeobox-2 gene
complex are closely linked to the rex locus on mouse chromosome
11. Genomics 5, 454-462.
Norrander, J. T., Kempe, T. and Messing, J. (1983). Construction of
improved M13 vectors using oligodeoxynucleotide-directed
mutagenesis. Gene 26, 101-106.
O'Guin, W. M., Schermer, A., Lynch, M. and Sun, T.-T. (1990).
Differentiation-specific expression of keratin pairs. In Cellular and
Molecular Biology of Intermediate Filaments, (eds. R. D. Goldman
and P. M. Steinert), pp. 301-334. New York: Plenum Press.
Popescu, N. C , Bowden, P. E. and DiPaolo, J. A. (1989). Two type II
keratin genes are localized on human chromosome 12. Hum.
Genet. 8, 109-112.
Powell, B. C , Cam, G. R., Fietz, M. J. and Rogers, G. E. (1986).
Clustered arrangement of keratin intermediate genes. Proc. natn.
Acad. Sci. U. S. A. 83, 5048-5052.
Powell, B., Kuczek, E., Crocker, L., O'DonneU, M. and Rogers, G. E.
(1989). Keratin gene expression in wool fibre development. In The
Biology of Wool and Hair. (eds. G.E. Rogers, P.J. Reis, K.A.
Ward and R.C. Marshall), pp. 325-335. London: Chapman and
Hall.
Powell, B. C , Nesd, A. and Rogers, G. E. (1992). Regulation of
keratin gene expression in hair follicle differentiation. Ann. N. Y.
Acad. Sci. In press.
Powell, B. C. and Rogers, G. E. (1986). Hair keratin: Composition,
structure and biogenesis. In Biology of the Integument, Vol. 2
Vertebrates, (eds. J. Bereiter-Hahn, A.G. Matoltsy and K.S.
Richards), pp.696-721. Berlin: Springer-Verlag.
Powell, B. C. and Rogers, G. E. (1990a). Hard keratin IF and
associated proteins. In Cellular and Molecular Biology of
Intermediate Filaments, (eds. R. D. Goldman and P. M. Steinert),
pp. 267-300. New York: Plenum Press.
Powell, B. C. and Rogers, G. E. (1990b). Cyclic hair-loss and
regrowth in transgenic mice overexpressing an intermediate
filament gene. EMBO J. 9, 1485-1493.
RayChaudhury, A., Marchuk, D., Llndhurst, M. and Fuchs, E.
(1986). Three tightly linked genes encoding human type I keratins:
conservation of sequence in the 5'-untranslated leader and 5'upstream regions of coexpressed keratin genes. Molec. cell Biol. 6,
539-548.
Reed, K. and Mann, D. A. (1985). Rapid transfer of DNA from
agarose gels to nylon membranes. Nud. Acids Res. 13, 7207-7221.
Risse, G., Jooss, K., Neuberg, M., Bruller, H.-J. and Muller, R.
(1989). Asymmetrical recognition of the palindromic AP-1 binding
site (TRE) by Fos protein complexes. EMBO J. 8, 3825-3832.
Rogers, G. E. (1959). Electron microscope studies of hair and wool.
Ann. N.Y. Acad. Sci. 83, 378-399.
Romano, V., Bosco, P., Rocchi, M., Costa, G., Leube, R. E., Franke,
W. W. and Romeo, G. (1988). Chromosomal assignments of human
type I and type n cytokeratin genes to different chromosomes.
Cytogenet. Cell Genet. 48, 148-151.
Roop, D. R., Nakazawa, H., Mehrel, T., Cheng, C , Chung, S.,
Rothnagel, J. A., Steinert, P. M. and Yuspa, S. H. (1989).
Sequential changes in gene expression during epidermal
differentiation. In The Biology of Wool and Hair. (eds. G.E.
Rogers, P.J. Reis, K.A. Ward and R.C. Marshall), pp. 311-324.
London: Chapman and Hall.
Rosenberg, M., RayChaudhury, A., Shows, T. B., LeBeau, M. M.
and Fuchs, E. V. (1988). A group of type I keratin genes on human
chromosome 17: characterization and expression. Molec. cell. Biol.
8, 722-736.
Sanger, F., Coulson, A. R., Barrell, B. G., Smith, A. J. H. and Roe,
B. A. (1980). Cloning in single-stranded bacteriophage as an aid to
rapid DNA sequencing. J. Molec. Biol. 143, 161-178.
Snape, A. M., Jonas, E. A. and Sargent, T. D. (1990). KTF-1, a
transcriptional activator of Xenopus embryonic keratin expression.
Development 109, 157-165.
Sparrow, L. G., Robinson, C. P., McMahon, D. T. and Rubira, M. R.
(1989). The amino acid sequence of component 7c, a type II
intermediate-filament protein from wool. Biochem. J. 261, 10151022.
Steinert, P. M. and Roop, D. R. (1988). Molecular and cellular
biology of intermediate filaments. Ann. Rev. Biochem. 57,593-625.
Sun, T.-T., Eichner, R., Schermer, A., Cooper, D., Nelson, W. G.
and Weiss, R. A. (1984). Classification, expression and possible
mechanisms of evolution of mammalian epithelial keratins: a
unifying model. In The Cancer Cell, Volume 1. (eds. A. Levine, W.
Topp, G. Van de Woude and J. D.Watson), pp. 169-176. Cold
Spring Harbor: Cold Spring Harbor Laboratory.
Swift, J. A. (1977). The histology of keratin fibres. In Chemistry of
Natural Protein Fibres, (ed. R.A. Asquith), pp.81-146. New York:
Plenum Press.
Tyner, A. L., Elchman, M. J. and Fnchs, E. V. (1985). The sequence
of a type II keratin gene expressed in human skin: conservation of
structure among all intermediate filament genes. Proc. natn. Acad.
Sci. U. S. A. 82, 4683-4687.
Ward, K. A., Sleigh, M. J., Powell, B. C. and Rogers, G. E. (1982).
Expression of the hair type II keratin IF gene family
The isolation and analysis of the major wool keratin gene families.
In Proceedings of the 2nd World Congress of Genetics Applied to
Livestock Production, Volume 6. Editorial Garsi, Londres 17,
Madrid-28, Spain, pp. 146-156.
Wilson, B. W., Edwards, K. J., Sleigh, M. J., Byrne, C. R. and Ward,
K. A. (1988). Complete sequence of a type I-microfibrillar keratin
gene. Gene 73, 21-31.
433
Winter, G. and Fields, S. (1980). Cloning of influenza cDNA into
M13: the sequence of the RNA segment encoding the A/PR/8/34
matrix protein. Nucl. Acids Res. 8, 1965-1974.
(Accepted 22 October 1991)