Download dna analysis - Van Buren Public Schools

C H A P T E R
11
D N A A N A LY S I S
“The capacity to blunder slightly is the real
marvel of DNA. Without this special
attribute, we would still be anaerobic
bacteria and there would be no music.”
—Lewis Thomas, physician, author
OBJECTIVES
After reading this chapter, you will understand:
• That DNA is a long-chain polymer found in nucleated cells,
which contain genetic information.
• That DNA can be used to identify or clear potential suspects
in crimes.
• How DNA is extracted and characterized.
• How to apply the concepts of RFLP, PCR, and STRs to
characterize DNA.
• The role that statistics plays in determining the probability
that two people would have the same sequence in a
fragment of DNA.
You will be able to:
• Explain that DNA is a long molecule, tightly packed in the
form of a chromosome with genetic material wrapped
around it.
• Isolate and extract DNA from cells.
• Describe the function and purpose of a restriction enzyme.
• Calculate probabilities of identity using STR.
• Use technology and mathematics to improve investigations
and communications.
• Identify questions and concepts that guide scientific
investigations.
• Communicate and defend a scientific argument.
243
KH00006_ch11.indd Sec1:243
10/17/05 9:31:38 AM
DNA
DNA “fingerprinting” is a common way to identify people by
their unique genetic code. It is currently being used to identify
the perpetrator in a crime, to identify fathers in paternity cases,
and to identify unknown remains in mass disasters and other
situations. DNA is in every nucleated cell of the human body
and can be extracted from blood, semen, urine, bone, hair
follicles, and saliva.
BIOLOGICAL ASPECTS OF DNA
chromosome: a long, threadlike group
of genes found in the nucleus of a cell
DNA: deoxyribonucleic acid, the
hereditary material of most organisms
A basic functional and structural element of all living things is
the cell. Sometimes the cell functions on its own, as in red blood
cells, or in groups, as in tissues or organs. In the nucleus of the
cell are chromosomes that are inherited from both parents.
Chromosomes are long-chain DNA molecules that are tightly
bound in a specific structure. If a single DNA strand were
stretched out, it would reach about 5 cm in length.
gene: a specific sequence of nucleotides
in the DNA usually found on a chromosome; the functional unit of inheritance
threaded around its 23 paired
chromosomes
proteins: fundamental components of
all living cells, including enzymes,
hormones, and antibodies. Proteins are
composed of amino acids linked
together with peptide bonds. Some of
the more familiar proteins are
hemoglobin and insulin
Chromosome 4
Chromosome 5
Chromosome 6
Chromosome 7
Chromosome 1
Chromosome 2
Chromosome 3
Chromosome 8
Chromosome 9
Chromosome 10 Chromosome 11 Chromosome 12 Chromosome 13 Chromosome 14
Chromosome 15 Chromosome 16 Chromosome 17 Chromosome 18 Chromosome 19 Chromosome 20 Chromosome 21
The Human Genome Project is a unified effort
to identify and determine the sequence of
all genes found on the human chromosome;
12,000 letters of DNA are decoded by the Human
Genome Project every second.
The human body has approximately 35,000 genes, which are
simply portions of the DNA that code the information required
to make specific proteins. These proteins then determine human
traits and functions. Each gene has a specific code for a specific
body function; they are the fundamental unit of heredity, determining traits from hair color, eye color, and facial features to
certain diseases or disorders. A particular gene can be carried by
more than one chromosome.
244 Chapter 11
KH00006_ch11.indd Sec1:244
10/17/05 9:31:40 AM
Nucleus
Gene
Cell
Chromosome
If all the DNA in the human body was put end
to end, it would reach to the sun and back more
than 600 times [100 trillion ⫻ 6 ft (1.8 m) divided
by 92 million miles (148,800,000 km) ⫽ 1,200].
DNA
The acronym “DNA” stands for deoxyribonucleic acid, a
long-chain molecule made of four bases that are paired and held
together with hydrogen bonds and a sugar-phosphate backbone.
The bases that pair are adenine (A) with thymine (T) and
guanine (G) with cytosine (C). The adenine and thymine are
connected with two hydrogen bonds, while the guanine and
cytosine are connected with three hydrogen bonds.
ATCGAGCTA
TAGCTCGAT
Each of these bases contains the element nitrogen; they are
sometimes referred to as nitrogenous bases.
Each nitrogenous base is connected to a sugar molecule and a
phosphate group. These together make up what is called a
nucleotide unit. The sugar in DNA is deoxyribose.
Paired base(A-T or G-C) ⫹ sugar ⫹ phosphate ⫽ nucleotide unit
The structure of DNA is important to its function. An unusual
property of DNA is its ability to replicate itself. It is arranged in a
right-handed double helix (a twisted ladderlike structure). The
sides of the helix are the sugar and phosphate groups; this is what
gives DNA its acidic properties. On the inside are the base pairs of
adenine-thymine or guanine-cytosine.
Identical twins come from one fertilized egg
that splits in two, resulting in same-sex twins
who share 100 percent of their DNA. Fraternal
twins result when two separate sperms fertilize
two separate eggs. These twins share only 50
percent of their DNA, just like regular siblings,
and can be same gender or a boy and a girl.
The first reported use of DNA identification was
in a noncriminal setting to prove a familial relationship. A Ghanaian boy was refused entry into
the United Kingdom for lack of proof that he was
the son of a woman living there. Immigration
authorities claimed that the boy could be the
nephew of the woman, not her son. DNA testing
showed a high probability of a mother-son relationship, and authorities admitted the boy.
Criminal Law Review (1987)
DNA Analysis
KH00006_ch11.indd Sec1:245
245
3/3/06 2:55:55 AM
amino acid: an organic compound
containing an amino group, NH2, and a
carboxylic acid. Amino acids linked
together make up proteins.
The average DNA molecule contains approximately 100 million of these nucleotide groups. In humans, the order of these
nucleotide bases is 99.9 percent the same. The unique sequence
of the other 0.1 percent makes each human one of a kind (except
for identical twins, who have the same DNA).
The sequence of these bases is a code for specific amino acids to
combine to make specific proteins. Genes can be as short as 1,000
base pairs or as long as several hundred thousand base pairs
wrapped around the chromosome. One gene gives the information
for one cell to produce one protein. A chromosome is a single DNA
molecule twisted and packed into the nucleus of the cell. The
sequence of the nucleotide bases is what determines the proteins
that will lead to specific growth, function, and reproduction.
FORENSIC USES OF DNA
DNA fingerprinting
Red blood cells
The first forensic use of DNA technology in
criminal cases was in 1986, when police asked
Dr. Alec J. Jeffreys (who coined the term “DNA
fingerprints”) of Leicester University in England
to verify a suspect’s confession that he was
responsible for two rape-murders in the English
Midlands. Tests proved that the suspect had
not committed the crimes. Police then began
obtaining blood samples from several thousand
male inhabitants in the area. The perpetrator
was identified and convicted of the crimes.
enzyme: a protein that causes a
chemical reaction to occur at a rate that
is sufficient to support life
Blood and bodily fluids are the most common evidence that
forensic investigators use for testing of DNA. Blood is made up
of red blood cells that carry oxygen throughout the body;
plasma, the fluid that carries the cells; platelets, which facilitate
clotting; and white blood cells, which defend the body against
infection. Red blood cells lack the nuclei that contain DNA, so it
is the white blood cells that interest forensic scientists. A single
drop of blood may contain anywhere from 7,000 to 25,000
white blood cells with the nuclei with the containing DNA
inside. A small sample with only a few white blood cells is
enough to extract DNA, and using the PCR (polymerase chain
reaction) method, billions of copies can be made for testing.
DNA fingerprinting or profiling can be useful for many purposes:
• To identify potential suspects whose DNA may match
evidence left at crime scenes
• To clear persons wrongly accused of crimes
• To identify crime and catastrophe victims
• To establish paternity and other family relationships
• To match organ donors with recipients in transplant
programs
Samples collected from a crime scene are examined to
determine whether the sample is appropriate for DNA analysis.
If a sample is to be analyzed, it must be properly prepared. First,
the DNA is removed from the object it is attached to (for
example, clothing, weapon, skin); then it is extracted from the
cell. To isolate the DNA, the cellular components, such as fats,
proteins, and carbohydrates, must be removed. Then enzymes
are used to release the DNA from the chromosomal packaging.
Once the DNA is extracted, it is ready for characterization.
246 Chapter 11
KH00006_ch11.indd Sec1:246
10/17/05 9:31:41 AM
L A B O R AT O R Y A C T I V I T Y
Extracting DNA from a Banana
You can readily see DNA with your naked eye when it is extracted from a
cell. The complex structure itself is not visible, but as it unravels itself when
coming out of the nucleus, the DNA makes such a large molecule that you
can see it. This gives you some idea of how well it must be packed to fit in
the nucleus.
Materials
banana
lysis buffer: 200 ml of Murphy’s
Oil Soap, 20 g of salt, and 1 L
of water
5-in. square of cheesecloth
cold ethanol
wooden toothpick or sticks to
spool the DNA
plastic fork
two 250 ml beakers
Procedure
1. Mash a small piece of banana with a plastic fork.
2. Place the mashed banana in a 250 ml beaker and add 25 ml of the lysis
solution. Stir.
3. The DNA is now out of the cell but is still attached to the water molecules, so it cannot be seen yet. Filter out the chunks of banana through
two layers of the cheesecloth, allowing the solution to run into another
250 ml beaker.
4. Put the cheesecloth and banana in the garbage.
5. Add 50 ml of the cold ethanol to the beaker by slowly pouring it down
the side of the beaker.
6. Observe the precipitate. This is the DNA. The water and ethanol stick
together better than water and DNA; therefore, the DNA is not attached
to the water anymore, and it comes out as a precipitate.
7. The DNA forms at the boundary of the water and ethanol. Slowly spool
out some of the DNA around a toothpick or a pencil.
8. Record all of your observations.
In 1994 a mother of five on Prince Edward Island,
Canada, disappeared, leaving only one clue:
Her car was found near a bag that contained
a blood-soaked jacket and a few white hairs.
Detectives hoped the hairs belonged to the
murderer—but, in fact, the hair was a cat’s.
This was not altogether bad news. A certain
feline named Snowball lived with the woman’s
estranged husband, but none of the forensic
labs police called were willing to test Snowball’s
DNA. Eventually a team led by Stephen J.
O’Brien, an NIH expert on genes and cats,
examined blood samples. Snowball’s DNA was
a near-perfect match to the cat hairs in the bag.
The defendant was sentenced to 18 years for
second-degree murder.
from Scientific American, July 1997
DNA Analysis 247
KH00006_ch11.indd Sec1:247
10/17/05 9:31:43 AM
Questions
1. Why use a banana for studying DNA? What other types of materials
could you have used?
2. Why mash the banana? What does this do to the cells?
3. The lysis buffer is made with soap and a bit of salt. Why do you add this
solution to the mashed banana?
4. Were you able to see the double helix structure of the DNA? Explain.
R F L P A N A LY S I S F O R D N A
FINGERPRINTING
R – restriction enzymes are used to cut the
DNA into
F – fragment(s) that are many different
L – lengths and
P – polymorphism, which is a Greek term
meaning many shapes. The length of
the fragments will vary greatly among
individuals.
restriction enzyme: enzymes that are
used to cut DNA into smaller fragments
At this time, a whole DNA molecule is too complex for scientists
to characterize completely, and therefore, it cannot be used as
individual evidence. The best that forensic scientists can do is to
characterize pieces or fragments of DNA and use statistics to
determine the likelihood of another individual having the same
fragments.
Forensic scientists use DNA fingerprinting to match the
unknown samples of DNA found at a crime scene to known
samples of DNA in the blood, semen, or other cells of a suspect.
DNA fingerprinting can also be used in paternity cases to
determine who the father of a child may be. Testing in questions
of paternity is made easier because the field tends to be narrower
than in a crime, where there are often many suspects.
To characterize DNA, the scientist must cut it into smaller
pieces. This is done using restriction enzymes. A restriction
enzyme will recognize a specific sequence of bases and cut the
DNA molecule at a specific point. For example, a restriction
enzyme called EcoRi will cut DNA whenever it finds the
sequence GAATTC. It will cut between the G and A, as in:
GAATTC
CTTAAG
248 Chapter 11
KH00006_ch11.indd Sec1:248
10/17/05 9:31:43 AM
Other restriction enzymes cut at different sites:
Table 1: Restriction Enzymes
Enzyme
Bam HI
Hae III
Pst I
Bgl II
Cutting Site
GGATCC between the G and G
GGCC between the G and C
CTGCAG between the A and G
AGATCT between the C and T
Once the DNA is cut into different-sized fragments, these
fragments are separated through electrophoresis, using a gel and
a voltage source. This procedure separates the fragments
according to their sizes.
The fragments are very close together, and there are so many
of them that it is difficult to make them visible. A probe is added
that will adhere to specific fragments. By using a development
technique, the scientist can observe the new pattern, analyze an
unknown sample from a crime scene, and compare it to the
DNA of a suspect to see if it runs through the electrophoresis in
the same manner.
There are four main procedures involved in DNA fingerprinting: isolation of the DNA to separate the DNA from the cell;
cutting with a restriction enzyme to make shorter base strands;
sorting the segments by size, using an electrophoresis procedure;
and analyzing the resulting print by identifying specific alleles.
electrophoresis: a procedure that
separates DNA fragments according
to size
probe: a portion of a DNA molecule
with a known sequence of bases that is
used to find its complementary strand
ACTIVIT Y
Simulation of RFLP
Purpose
In this activity you will take a long strand of simulated DNA and use
simulated restriction enzymes to cut the strand and make a DNA
fingerprint. Using a comparison of fragment lengths, you will then analyze
the DNA fingerprints to determine the perpetrator of a crime.
DNA Analysis 249
KH00006_ch11.indd Sec1:249
10/17/05 9:31:43 AM
Materials
1.5 meter strip of adding
machine paper
scissors
meter stick
poster board for a simulated
gel box
graph paper
Procedure: Part 1
1. On the 1.5 meter strip of adding machine tape, use a meter stick or
ruler to mark off every 2.5 cm. Make these marks on the entire length
of the strip.
2. In every 2.5 cm block, write four letters representing the four base
pairs (A, T, G, C). Write the bases in any combination you wish, even
repeating some. Continue writing the four letters the entire length of
the strip.
3. After you have constructed your base sequence, make the
complementary strand below the original. The strip now represents a
piece of double-stranded DNA.
4. Now cut your DNA with a simulated restriction enzyme called TWI.
This restriction enzyme cuts DNA anywhere there is an AT sequence.
Cut between the A and T on the top strand, starting from the left and
moving to the right. You should also cut between the A and T of the
complementary strand on the bottom; however, on that strand, you
will be moving from the right to the left.
5. Continue locating A and T sequences and cutting until you reach the
end of your strip.
6. Measure each of the fragments with your ruler; write the length on
the back.
250 Chapter 11
KH00006_ch11.indd Sec1:250
10/17/05 9:31:44 AM
7. Take the DNA fragments to the poster board “gel box” and arrange
the pieces in the box as follows:
group 1 group 2 group 3 group 4 group 5
14–20 cm
10–13 cm
6–9 cm
4–5 cm
2–3 cm
0–2 cm
8. After you and your lab partners have placed the pieces of DNA in the
gel box, get a piece of graph paper and draw a gel box on the graph
paper.
9. For every piece of paper in one of the squares on the poster board,
shade an area equal to one square on the graph paper. Do this for
all of your pieces in “lane 1,” labeled group 1. In lanes 2 through 5,
draw the “fingerprints” of the other members in your group. (If you
have four pieces of paper in a box on the poster board, shade in four
squares on your graph paper.)
10. When you are finished, you will have a graph that looks like a DNA
fingerprint.
Procedure: Part 2
Someone in the class has been stealing glassware. A broken flask was
found on the floor with some drops of blood nearby. The DNA has been
extracted, and your teacher has a copy of the sequence. It is up to you to
cut the DNA with a restriction enzyme and run it through the gel to catch
the thief. Add a sixth lane to your graph “gel box” and draw the DNA fingerprint of the glass thief. Compare the DNA fingerprint with your classmates to determine who the thief is.
DNA Analysis
KH00006_ch11.indd Sec1:251
251
10/17/05 9:31:44 AM
Questions
1. Why are restriction enzymes used for DNA fingerprinting?
2. Show how the following DNA sequence would be cut by the restriction
enzyme Hae III. Count the number of base pairs in each fragment and
label at the top of each fragment.
TTTAATTTGGCCATGTGTTACGGCCACGAATGGCCTTATCA
AAATTAAACCGGTACACAATGCCGGTGCTTACCGGAATAGT
3. Is cutting between the A and G on the top sequence the same as cutting between the G and A on the bottom sequence?
4. Describe the steps a scientist would use to make a DNA fingerprint
from cells found underneath a murder victim’s fingernails.
L A B O R AT O R Y A C T I V I T Y
Electrophoresis
Electrophoresis uses the fact that DNA is polar, or electrically charged, to
separate the fragments. The DNA molecule is negatively charged. The size
and shape of the fragments will determine how far the molecules will
travel. The negative end of the DNA molecule will migrate to the positive
end of the electrode. The smaller fragments will travel through the gel
more easily than the larger fragments and, therefore, travel a greater
distance. When a DNA fingerprint is viewed, the smaller pieces will be
deposited farther away from the wells where the samples were loaded.
Your task today is to make and view a simulated DNA fingerprint.
252 Chapter 11
KH00006_ch11.indd Sec1:252
10/17/05 9:31:44 AM
Materials
0.4 g agarose
5 ml of concentrated buffer
solution
250 ml of distilled water
150 ml and 250 ml beakers
hot plate
thermometer
dyes simulating DNA samples
electrophoresis container
micropipet
DC power supply
SAFET Y ALERT! CHEMICALS USED
Procedure
1. Measure 0.4 grams of agarose, and put it into a 150 ml beaker.
2. Measure 1 ml of buffer solution using a graduated cylinder. Add this to
the beaker.
3. Add 50 ml of distilled water to the beaker. Heat the mixture until the
solution is clear.
4. Stand the comb in the middle of the small tray. Tape the open edges closed.
5. Let the solution cool to 55°C; then pour it into the small tray.
6. After the gel has solidified, gently remove the comb and tape.
7. Place the tray into the electrophoresis container. Make sure the plastic
tray is touching the sides of the container.
8. Using a 250 ml beaker, make a diluted buffer solution by adding 4 ml
of concentrated buffer to 196 ml of distilled water.
9. Cover the gel completely with the buffer solution.
10. Load each “DNA” sample into one of the wells. Each sample should be
about 35 to 38 µl, or four to five drops using a micropipet.
11. Connect the electrophoresis container to the power supply. Make sure the
current is flowing; you should see bubbles forming on the electrodes.
12. Cover the container with a lid, and allow it to run for 45 minutes to
2 hours. Stop the power before the color bands run off the end.
DNA Analysis
KH00006_ch11.indd Sec1:253
253
10/17/05 9:31:44 AM
Questions
1. On what basis does agarose gel electrophoresis separate molecules?
Name three.
2. Explain migration according to charge.
3. Diagram what your DNA fingerprint looks like. Be sure to label all
samples.
S TAT I S T I C A L A N A LY S I S I N D N A
FINGERPRINTING
There are 3 billion (3,000,000,000) letters in the
DNA code in every cell in your body.
The DNA molecule is hundreds of thousands of base pairs long.
If you look at only a fragment of the DNA, what are the chances
of someone else having the same size fragment? We are not
asking if the sequence of bases in the fragments is the same, only
that the fragments are of the same length.
Is it possible to determine the probability that two people
with the same size fragment will be chosen at random? Can you
estimate this probability based on a limited sample size? You can
simulate this problem by answering the question: Can you
estimate the quantity of macaroni in a box by only observing
and counting a handful?
254 Chapter 11
KH00006_ch11.indd Sec1:254
10/17/05 9:31:45 AM
ACTIVIT Y
Statistical Sampling Lab
Materials
package of elbow macaroni
Purpose
To estimate the number of macaroni pieces in a package by actually
counting only a small amount.
Procedure
1. Have someone in your group take a sample, a small handful, from the
package of macaroni. Count the number of pieces removed and mark
them with a marker. Let this number be NMP.
2. Put the NMPs back into the package. Mix thoroughly.
NMP: number of marked pieces
NSS: number in second sample
NMPSS: number of marked pieces in second
sample
3. Take a second sample. Count the number of macaroni in the second
sample. Let this number be NSS.
4. Count the number of marked pieces that are in the second sample.
Let this number be NMPSS.
5. Let the total number of macaroni in the bag be N. Set up the
proportion and solve:
NMP
NMPSS
N
NSS
6. Use your algebra skills to rearrange the equation and solve for N.
N
NSS(NMP)
NMPSS
7. Check for accuracy. Divide the contents of the package among your
group and count the total number of pieces. How does this number
compare to your estimate of N?
DNA Analysis 255
KH00006_ch11.indd Sec1:255
10/17/05 9:31:45 AM
Questions
1. What are the limitations to the method used in the preceding activity?
2. How can the accuracy be increased?
3. If time permits, use the method you suggest for question 2 to see if the
accuracy increases.
4. How does this activity relate to using statistical analysis in DNA fingerprinting?
P C R : P O LY M E R A S E C H A I N
REACTION AND DNA
FINGERPRINTING
polymerase chain reaction (PCR):
a lab technique used to make multiple
copies of DNA for further testing or
characterization
In many forensic cases, there is very little evidence to work with.
A technique called polymerase chain reaction, PCR, offers the
possibility for increased sensitivity in DNA fingerprinting. It can
take a very small sample of DNA and make millions of copies by
a relatively simple, quick method. PCR requires about 50 times
less DNA than what is required for RFLP.
Using the fact that the base pairs in DNA are connected
together with hydrogen bonds, which are rather weak, the strand
is divided lengthwise, and new base pairs attach to the new
strands. Done repeatedly, this method can make millions of copies
in a short time. In forensic applications, PCR has been able to
identify perpetrators from as small a sample as saliva residue left
on a cigarette butt, a stamp, or the adhesive on an envelope.
DNA is taken out of a small amount of blood, semen, or
saliva in the same way as discussed earlier, by breaking down the
cell wall and unwrapping the chromosome.
The next step in PCR is to break down the DNA strands by
heating. The heat separates the weak hydrogen bonds holding
the base pairs together, leaving each DNA strand as two
half-strands.
The next step is to cool the mixture and add a primer, which is a
short sequence of base pairs that will add to its complementary
sequence on the DNA strand. The function of the primer is to begin
the replication process.
256 Chapter 11
KH00006_ch11.indd Sec1:256
10/17/05 9:31:45 AM
An enzyme called DNA polymerase is added along with a
mixture of free nucleotide bases (A, T, G, and C), which then
combine to their complementary bases on the free strand. This
reaction works best at around 75°C, so the mixture is heated
again. Once the primer is in place, the polymerase can take over
making the rest of the new chain.
The two half-strands have now become four complete strands
of DNA. After another cycle, there will be eight full strands
of DNA.
The three steps in PCR (separation, adding primer, and
synthesis of the new chain) take only about two minutes, mostly
because of the heating and cooling. At the end of the cycle, every
strand of DNA has been duplicated. It takes about three hours
to make 1 million copies that can then be further characterized.
If the cycle were repeated 30 times, more than a billion copies
could be produced.
When the DNA is so greatly amplified, its typing or
characterization can be simplified by methods that are not as
complex as RFLP. One method is to add the DNA to a nylon
strip that contains genetic markers, or alleles, that will bind to
specific sequences of the DNA. These sequences can then be
visualized and characterized. When several markers are used on
several strips, the frequency of occurrence can be greatly
reduced.
A type of polymerase called Taq polymerase has
the following sequence:
GTAAGAGTTCCGTAACAG
allele: a site where two genes that
influence a particular trait are found on
a chromosome pair
ACTIVIT Y
Simulation of DNA Replication Using PCR
The enzyme that you will be using today in this simulation is Hae III, which
slices the DNA between the C and G in the sequence CCGG. This allows the
DNA strand to be observed in smaller portions instead of the extremely
long strand.
As a forensic investigator, you will look at DNA left at a crime scene and
determine if it matches any of the suspects. The victim’s blood has already
been ruled out as a possibility.
DNA Analysis 257
KH00006_ch11.indd Sec1:257
10/17/05 9:31:45 AM
Materials
scrap paper
six simulated DNA samples
from suspects
one simulated DNA sample
from the crime scene
glue
highlighter
Procedure
1. You have “DNA” samples from the six people who submitted blood
samples and who are suspected to be involved in a crime. You also
have the “DNA” from the crime scene.
2. Begin by making copies of the crime scene DNA using a PCR-like
technique.
3. Cut out the crime scene DNA and tape the ends together to make
one long strip.
4. Make the complementary strand by writing the appropriate base
below the original.
5. Simulate the denaturing or “unzipping” the DNA by cutting it into
two long pieces.
6. Add the primer, AT, to begin the process and continue adding
complementary base pairs until you have two new strands of DNA.
Write the complementary bases along both strips.
7. Repeat steps 4 and 5 until you have eight copies of the original crime
scene DNA.
8. Cut the strip of “DNA” for each person and tape the ends together
so that you have one long strip for each person.
9. Mark the position of the restriction enzyme recognition site with
your pencil for each suspect and the crime scene. Remember that
Hae III cuts between the C and G of the CCGG sequence only. Cut the
strands at this point.
10. Now it’s time to run your fingerprints. Make a column for each person
and the crime scene. Place each person’s “DNA” fragments in order
of size from top to bottom. The longest pieces should be the closest
to the top, and the shortest should be farthest away. Try to equally
space the fragments in six rows.
11. Glue or tape these fragments to the scrap paper.
258 Chapter 11
KH00006_ch11.indd Sec1:258
10/17/05 9:31:45 AM
12. In order to see the “DNA,” you must use a probe or marker to show
where it is; otherwise the DNA molecule will be invisible. The probe
that you are using is a GTA probe. Match the probe with its complementary strand on the “DNA” by coloring it with a highlighter.
13. Repeat this for each person and the crime scene “DNA.”
14. Make a chart for the DNA fingerprint. Use six rows (numbered
1 through 6) and seven columns (one per sample). Draw a line in
each of the rows where you find a marker.
15. Can you tell if one of the suspects left the blood at the scene of the
crime?
Questions
1. What are the four steps of DNA fingerprinting?
2. If everyone has A, T, G, and C as the base pairs for their DNA, then how is
it different in each person?
3. What is the complementary sequence for the GTAAG probe?
4. What is the function of the probe?
5. Can you tell if one of the suspects left the blood at the scene of the
crime? How?
6. After two cycles, how many copies of the original DNA do you have?
After four cycles? After 10 cycles? After 20 cycles?
DNA Analysis
KH00006_ch11.indd Sec1:259
259
10/17/05 9:31:46 AM
STR: SHORT TANDEM REPEATS
short tandem repeats: specific
sequences of DNA fragments that are
repeated at a particular site on a
chromosome
A new technology in the analysis of DNA is short tandem
repeats (STR). This method is becoming more common than
RFLP because it takes less time for the analysis, takes less of a
sample size, and is more exclusionary, which means that it can
eliminate more people as possible sources. STRs are locations on
the chromosome that repeat a specific sequence of two to five
base pairs. For the analysis, scientists identify multiple locations.
A variable number of tandem repeats (VNTR) is also used, identifying repeats of 9 to 80 base pairs. Hundreds of STR sites have
been identified. They are located on almost every chromosome in
the human genome. They can easily be amplified, using PCR,
and characterized based on the alleles. Alleles are generally
named by the number of repeats that they contain.
For example, D7S280 is an STR found on human chromosome 7 that repeats the sequence GATA. The DNA sequence of
the representative allele of this locus is shown below. Find the
repeat sequence GATA. How many repeats are shown on the
DNA sequence below? Different alleles of this locus may have
from 6 to 15 tandem repeats of GATA.
The Innocence Project at the Cardozo School of
Law began in 1992. Their mission is to exonerate
the wrongfully convicted through postconviction DNA testing and to develop and implement
reforms to prevent wrongful convictions.
Eddie Joe Lloyd was convicted in 1985 for
the brutal rape and murder of a 16-year-old
Michigan girl. During his imprisonment, Lloyd
tried to appeal his sentence but was unsuccessful. He then contacted the Innocence Project and
asked for help in having his DNA tested against
samples remaining from the original crime
scene. After thorough analysis, the truth was
revealed. The DNA proved that Lloyd was not
responsible for the girl’s death.
In August 2002 after more than 17 years in
prison, Lloyd was pardoned and released. His
exoneration was the 110th case of exoneration
in U.S. history that was based primarily on DNA
evidence.
1 AATTTTTGTA TTTTTTTTAG AGACGGGGTT
TCACCATGTT GGTCAGGTG ACTATGGAGT
61 TATTTTAAGG TTAATATATA TAAGGGTAT
GATAGAACAC TTGTCATAGT TTAGAACGAA
121 CTAACGATAG ATAGATAGAT AGATAGATAG
ATAGATAGAT AGATAGATAG ATAGACAGAT
181 TGATAGTTTT TTTTTATCTC ACTAATAGT
CTATAGTAAA CATTTAATTA CCAATATTTG
241 GTGCAATTCT GTCAATGAGG ATAAATGTGG
AATCGTTATA ATTCTTAAGA ATATATATTC
301 CCTCTGAGTT TTTGATACCT CAGATTTTAA GGCC1
To identify individuals, forensic scientists scan 13 DNA
regions that vary from person to person; they then use the data
to create a DNA profile of that individual. There is an extremely
small chance that another person has the same DNA profile for
a particular set of regions. D7S280 is one of the 13 core CODIS
STR genetic loci. The probabilities of the STRs used can be
multiplied together to narrow the field of suspects.
The 13 standard CODIS STRs that the FBI uses to maintain
their databank and their probability of identity are given in the
following chart.
The FBI Laboratory’s Combined DNA Index
System (CODIS) blends forensic science and
computer technology into an effective tool for
solving violent crimes. CODIS lets federal, state,
and local crime labs exchange and compare
DNA profiles electronically, thereby linking
crimes to each other and to previously convicted
offenders.
1
The sequence comes from the National Center for Biotechnology Information,
a public DNA database.
260 Chapter 11
KH00006_ch11.indd Sec1:260
10/17/05 9:31:46 AM
Table 2: CODIS STRs and Probabilities
STR
D3S1358
VWA
FGA
TH01
TPOX
CFS1PO
D5S818
D13S317
D7S820
D8S1179
D21S11
D18S51
D16S539
African American
0.097
0.074
0.036
0.114
0.091
0.079
0.121
0.139
0.087
0.080
0.042
0.032
0.076
American Caucasian
0.080
0.068
0.041
0.080
0.207
0.128
0.166
0.081
0.067
0.069
0.041
0.032
0.091
If only one STR, D3S1358, were used, the likelihood that two
African American individuals selected at random would be the
same would be 1 in 10.3. Using the above table, it is calculated
as follows:
1
X
0.097, with X as the number of individuals in a sample
To solve for X,
X
1
10.3
0.097
Is this an acceptable probability to be certain that the
individual being tested is guilty of a crime?
What if two STRs were used? Try D3S1358 and FGA. You
multiply the two probabilities together and get:
0.097 0.036 .0035
Solving for X,
X
1
285.7, or one in 285.7 people
.0035
The probability is getting better, but it’s still not good enough.
Forensic scientists will use several of the STR sites to continue to
narrow the possible field of suspects. If all 13 STRs are used to
profile an individual, multiplying all probabilities together can
narrow the field, or frequency of occurrences, to one in billions.
The FBI maintains a forensic index that has DNA profiles from
crime scene evidence and an offender index with DNA profiles of
DNA Analysis
KH00006_ch11.indd Sec1:261
261
10/17/05 9:31:46 AM
individuals convicted of sex offenses and other violent crimes. All
50 states have become users and contributors to the indexes.
Matches made among profiles in the forensic index can link
crime scenes together, possibly identifying repeat offenders.
Based on a match, police in different jurisdictions can coordinate
their investigations and share the leads they developed
independently. Matches made between the forensic and offender
indexes provide investigators with the identity of the
perpetrator(s). After CODIS identifies a potential match,
qualified DNA analysts in the laboratories contact each other to
validate or refute the match.
MITOCHONDRIAL DNA
Another structure in the cell that contains DNA is the mitochondria.
The mitochondria are considered the powerhouses of the cell, providing 90 percent of the energy a human needs to function.
Each cell contains thousands of mitochondria, each
containing several loops of DNA. Unlike nuclear DNA, which is
found on the chromosomes inherited from mother and father,
mitochondrial DNA (mDNA) is inherited only from the mother.
This makes any individual with the same maternal lineage
indistinguishable if mitochondrial DNA is used for analysis.
The techniques scientists use to characterize mitochondrial
DNA are significantly more sensitive than the techniques for
profiling nuclear DNA; however, analysis for mDNA is more
costly and takes considerably more time. An advantage of
mDNA testing is that it can be done with small and degraded
quantities of DNA. Currently, the FBI maintains one of the few
labs that will do mDNA testing, and they have strict limitations
as to what types of cases they will accept.
Microfilaments
Lysosome
Peroxisome
Mitochondria
Rough
endoplasmic
reticulum
Nucleus
Centrioles
Nuclear pores
Plasma
membrane
Nucleolus
Microtubules
Nuclear
envelope
Golgi
apparatus
Chromatin
Cilia
Smooth
endoplasmic
reticulum
Rough
endoplasmic
reticulum
Ribosomes
262 Chapter 11
KH00006_ch11.indd Sec1:262
10/17/05 9:31:46 AM
The Green River Killer Case
Q CASE
STUDY
The Green River Killer’s slaying spree began in 1982, when
women in the Seattle area, mainly runaways and prostitutes,
were reported missing. The first victims turned up near the
banks of the Green River south of Seattle, giving the killer his
nickname.
The remains of dozens of women turned up near Pacific
Northwest ravines, rivers, airports, and freeways in the 1980s.
Investigators officially listed 49 of them as probable victims
of the Green River Killer. Police investigators were baffled
and unable to identify any suspects in the case.
In April 2001, almost 20 years after the first known Green
River murder, Detective Dave Reichert of Seattle began
renewed investigations into a series of murders. He refused
to let go of the case and remained determined to find the
killer. This time the task force had technology on their side.
Reichert formed a new task force team, initially consisting
of six members, including DNA and forensic experts and
detectives. It wasn’t long before the force grew to more than
30 people. All the evidence from the murder investigation
was reexamined, and some of the old forensic samples were
sent to the labs.
The first samples to be sent to the lab were found with three
victims who were murdered between 1982 and 1983. The
samples consisted of semen supposedly left by the killer. The
semen samples underwent a newly developed DNA testing
method and were compared with samples taken from Gary
Ridgway in April 1987.
On September 10, 2001, Reichert received news from the labs
that there was a match found between the semen samples
taken from the victims and Ridgway. On November 30
Ridgway was stopped by investigators on his way home from
work and arrested on four counts of aggravated murder. He
eventually confessed to the murder of 48 women.
263
KH00006_ch11.indd Sec1:263
10/17/05 9:31:47 AM
ASSESSMENT
1
Where are chromosomes located?
2
Where are genes located?
3
What is the difference between a gene and a
chromosome?
4
What is the purpose of the Human Genome Project?
5
Where in the cell is DNA located?
6
Name the four bases that pair together in the DNA
molecule.
7
With all of the base pairs in DNA, why is deoxyribonucleic
acid not called deoxyribonucleic base?
8
What evidence at a crime scene can be used for DNA
fingerprinting?
9
What do the letters RFLP stand for in DNA fingerprinting?
10 What is the function of a restriction enzyme?
11 In RFLP, are the sequences of the base pairs the same in
fragments that are the same length?
12 What is the advantage in the use of PCR for DNA found at
a crime scene?
13 How is the DNA molecule divided in RFLP? In PCR?
14 What is used to divide the DNA molecule in RFLP? In PCR?
264 Chapter 11
KH00006_ch11.indd Sec1:264
10/17/05 9:31:47 AM
15 What is the function of a primer?
16 What is the function of a probe?
17 What is CODIS, and who uses it?
18 What is the difference between the forensic index and
the offender index?
19 What type of evidence is the source for mitochondrial
DNA?
20 From whom is nuclear DNA inherited? From whom is
mitochondrial DNA inherited?
DNA Analysis
KH00006_ch11.indd Sec1:265
265
10/17/05 9:31:47 AM
PROJECT: BOTH SIDES OF THE
ISSUE; ESTABLISHMENT OF A
DNA DATABANK
Write a paper analyzing the arguments for and against the establishment
of a DNA databank. To gain an understanding of both sides of the issue,
and to get experience in identifying and defending the side of the issue
you disagree with, structure your paper in the following way:
TITLE: Should the United States Government Establish a DNA Databank for
All Citizens?
AUTHOR: Your name
INTRODUCTION: Write one or two paragraphs briefly explaining what a
DNA databank is and the controversy surrounding the issue.
PRO SIDE: Write one sentence stating that the United States should establish a DNA databank for all citizens.
SUPPORT: Write a short statement of why there should be a DNA databank.
Write at least three paragraphs supporting the statement, using at least
three different sources.
CON SIDE: Write one sentence stating that the United States should not
establish a DNA databank for all citizens.
SUPPORT: Write a short statement of why there should not be a DNA
databank. Write at least three paragraphs supporting the statement, using
three different sources.
PERSONAL OPINION: Write your views and conclusions based on the
above arguments. You must support one side or the other.
WORKS CITED: List references for all the sources you have used.
266 Chapter 11
KH00006_ch11.indd Sec1:266
3/3/06 3:41:02 AM
References
Books and Articles
Mader, S. Biology (7th ed.). New York: McGraw-Hill, 2001.
BSCS Biology, An Ecological Approach (9th ed.). Dubuque,
IA: Kendall Hunt, 2002.
Saferstein, R. Criminalistics (7th ed.). Upper Saddle River,
NJ: Prentice-Hall, 2001.
Eckert, W. C. Introduction to Forensic Sciences (2nd ed.).
Boca Raton, FL: CRC Press, 1997.
Siegel, J., P. Egri, and C. Roux. Principles of Forensic
Science. Sydney, Australia: University of Technology,
1998.
Evaluation of Forensic DNA Evidence. Washington, D.C.:
National Academy Press, 1996.
267
KH00006_ch11.indd Sec1:267
10/17/05 9:31:48 AM