Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Genomics and Inheritance What is DNA? What is DNA Day? What is DNA Day? April 1953 Drs. James Watson and Francis Crick determined the structure of DNA (double helix) What is DNA Day? April 1953 April 2003 Drs. James Watson and Francis Crick determined the structure of DNA (double helix) Human Genome Project determined the entire DNA sequence of a human (3 billion letters) A Genome is an entire set of an organism’s DNA • 23 pairs of chromosomes J Craig Venter Institute The Human Genome A Genome is an entire set of an organism’s DNA • 23 pairs of chromosomes Mother (Maternal) Father (Paternal) • One from your mother, one from your father J Craig Venter Institute The Human Genome Cell J Craig Venter Institute The Human Genome DNA holds instructions for the cell DeoxyriboNucleic Acid (DNA) contains all the information necessary to make a complete organism DNA is composed of a combination of 4 nucleotides DNA holds instructions for the cell DeoxyriboNucleic Acid (DNA) contains all the information necessary to make a complete organism DNA is composed of a combination of 4 nucleotides A T C G Adenine Thymine Cytosine Guanine DNA holds instructions for the cell DeoxyriboNucleic Acid (DNA) contains all the information necessary to make a complete organism Two DNA molecules DNA holds instructions for the cell DeoxyriboNucleic Acid (DNA) contains all the information necessary to make a complete organism Base Pair A pairs with T Adenine Thymine C pairs with G Cytosine Guanine Which is how DNA forms a double helix. Two DNA molecules “DNA sequence” is the order of nucleotides on a DNA molecule DNA double helix “DNA sequence” is the order of nucleotides on a DNA molecule DNA double helix If we unwind it and look at one strand… “DNA sequence” is the order of nucleotides on a DNA molecule DNA double helix If we unwind it and look at one strand… A C C A T C G T G C A T G T C T C we can see its sequence The entire human genome comprises over 3 billion base pairs. Here’s just the beginning. CGCAAATTTGCCGGATTTCCTTTGCTGTTCCTGCATGTAGTTTAAACGAGATTGCCA GCACCGGGTATCATTCACCATTTTTCTTTTCGTTAACTTGCCGTCAGCCTTTTCTTTGA CCTCTTCTTTCTGTTCATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTT CCACCGGGCCTTTGAGAGGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGT GTCTGACTTCCAGCAACTGCTGGCCTGTGCCAGGGTGCAAGCTGAGCACTGGAGTG GAGTTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGGATGGGCCATTGTTCATCTT CTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAGGGGAAAGAT TGGAGGAAAGATGAGTGAGAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTA GTGCTTGTGCTCATCTCCTTGGCTGTGATACGTGGCCGGCCCTCGCTCCAGCAGCTG GACCCCTACCTGCCGTCTGCTGCCATCGGAGCCCAAAGCCGGGCTGTGACTGCTCA AGCCAGCCGGCTGGAGGGAGGGGCTCAGCAGGTCTGGCTTTGGCCCTGGGAGAG CAGGTGGAAGATCAGGCAGGCCATCGCTGCCACAGAACCCAGTGGATTGGCCTAG GTGGGATCTCTGAGCTCAACAAGCCCTCTCTGGGTGGTAGGTGCAGAGACGGGAG GGGCAGAGCCGCAGGCACAGCCAAGAGGGCTGAAGAAATGGTAGAACGGAGCAG CTGGTGATGTGTGGGCCCACCGGCCCCAGGCTCCTGTCTCCCCCCAGGTGTGTGGT GGCTCTGGATGCCAGGCATGCCCTTCCCCAGCATCAGGTCTCCAGAGCTGCAGAAG ACGACGGCCGACTTGGATCACACTCTTGTGAGTGTCCCCAGTGTTGCAGAGGTGAG Gene – DNA instructions to make a protein Protein – a large molecule that does work for the cell rcsb.org Some sections of the genome are genes The genome is like a cookbook for the cell A T C G Nucleotides Letters The genome is like a cookbook for the cell A T C G Nucleotides Letters Gene Recipe A sequence of nucleotides composes a gene. The genome is like a cookbook for the cell A T C G Nucleotides Letters Gene Recipe A sequence of nucleotides composes a gene. Gene Genome Cookbook Cell Billions of nucleotides are packaged into chromosomes. Wikimedia commons Refresher: What are each of these? nia.nih.gov Refresher: What are each of these? Cell Genes Chromosome Genome Nucleotides DNA nia.nih.gov Please PAUSE to complete the DNA extraction activity DNA Isolation Method • Step 1: Add your saliva to the tube • Step 2: Add 1-2 drops of soap to tube and mix well • Step 3: Add a pinch of salt and mix well • Step 4: Add several droppers full of ethanol and mix well • Step 5: Spool your DNA with stick No two genomes are the same Individuals differ at about .1% of their nucleotides. Variant Variant - A position in the genome where individuals have different nucleotides Broad Institute No two genomes are the same Individuals differ at about .1% of their nucleotides. .1% Variant - A position in the genome where individuals have different nucleotides 3 million variants 3 billion nucleotides No two genomes are the same Individuals differ at about .1% of their nucleotides. Variant - A position in the genome where individuals have different nucleotides .1% 3 million variants 3 billion nucleotides A G C T A G C T 1 2 …………………………….. A G C T 3 million 4 choices at 3 million places 43million unique genomes Actually, some genomes are the same Identical twins have the same genome. Martin Schoeller for National Geographic Normal zygotes vs. identical twins Normal Zygote: A fertilized egg develops into one individual. A zygote multiplies and develops. A single individual is produced. Adapted from http://www.mun.ca/biology/desmid/brian/BIOL3530/ Normal zygotes vs. identical twins Identical Twins: A fertilized egg splits into two identical zygotes early on. A zygote splits into two independent zygotes. The zygotes develop into two individuals with identical genomes. Adapted from http://www.mun.ca/biology/desmid/brian/BIOL3530/ Clones also have the same genome How Dolly was cloned To clone an animal you need a body cell and an egg cell. Body cell Egg cell bbc.co.uk How Dolly was cloned Replace the genome of the egg cell with that of the cell to be cloned. Body cell Extract genome Replace egg cell’s genome Egg cell bbc.co.uk Remove genome How Dolly was cloned Place the dividing egg cell into the uterus of a foster mother. Body cell Place egg into foster mother Extract genome Replace egg cell’s genome Clone of sheep A Egg cell bbc.co.uk Remove genome Your list of variant nucleotides is your genotype Example chromosome Variants . G T T .….. … A C A Maternal Your list of variant nucleotides is your genotype Example chromosome Variants . G T T .….. … A C Genotype G T T A C A A Maternal M T T C A A G Your list of variant nucleotides is your genotype Example chromosome Variants T T C . . G T T A G … .….. A A … .….. A C Maternal Variants Paternal Genotype G T T A C A M T T C A A G P Your list of variant nucleotides is your genotype Example chromosome Variants T T C . . G T T A G … .….. A A … .….. A C Maternal Variants Paternal Genotype G T T A C A M T T C A A G P Genotype – The variant nucleotides on both maternal and paternal chromosomes. Your full genotype is unique. Genomic variants result in unique individuals Big genomic variations allow for many different forms of life Morten Koldby Leila Jeffreys Jennifer Cottom A.R. Valentien Insects.org Joel Sartore Reo Kometani & Shinji Matsui Variations in the DNA of different individuals can cause changes in physical appearance or can even cause disease. Variants can result in big changes University of Michigan The A variant at position 5,248,232 on chromosome 11 causes Sickle Cell Anemia. Normal red blood cell Sickle-shaped diseased red blood cell Variants can result in big changes University of Michigan The A variant at position 5,248,232 on chromosome 11 causes Sickle Cell Anemia. …CTC… Normal red blood cell Sickle-shaped diseased red blood cell Variants can result in big changes University of Michigan The A variant at position 5,248,232 on chromosome 11 causes Sickle Cell Anemia. …CTC… …CAC… Variant Normal Normal red blood cell Disease Sickle-shaped diseased red blood cell Different genotypes result in different outcomes Genotypes observed T T A T A A Different genotypes result in different outcomes Genotypes observed T T A T A A Normal Mostly Normal Sickle Cell Anemia micro-scopic.tumblr.com microscopyu.com http://legacy.owensboro.kctcs.edu/ The variant is correlated to the disease Sickle Cell count T T micro-scopic.tumblr.com A T A A microscopyu.com Genotype http://legacy.owensboro.kctcs.edu/ The variant is correlated to the disease Sickle Cell count T T A T A A Genotype The variant is correlated to the disease Sickle Cell count steep slope = correlation T T A T A A Genotype Other variants show no disease correlation The Sickle Cell A/T variant is the only variant correlated to the disease. Any other variant will not be correlated. For example: C/A variant Chr11:119,553,795 Other variants show no disease correlation The Sickle Cell A/T variant is the only variant correlated to the disease. Any other variant will not be correlated. For example: C/A variant Chr11:119,553,795 Sickle Cell count C C C A A A Genotype Other variants show no disease correlation The Sickle Cell A/T variant is the only variant correlated to the disease. Any other variant will not be correlated. For example: C/A variant Chr11:119,553,795 Sickle Cell count no slope = no correlation C C C A A A Genotype Plot genotype vs. disease state to find how correlated a variant is to the disease Disease Correlated TT AT AA Genotype Disease Not Correlated CC CA AA Genotype Genome Wide Association Studies find variants correlated to a disease or trait 1. Pick a disease or trait to test 2. Find individuals with and without the disease/trait Disease No Disease Genome Wide Association Studies find variants correlated to a disease or trait 3. Get genotypes of the individuals TT AT AT AA CA CC CA AA 4. Test variants for their correlation to disease/trait Disease Disease or AA AT TT Genotype CC CA AA Genotype Sturm, R.A. Hum Mol Gen Most traits are controlled by more than one variant Skin color is determined by 12 different variants. 531,441 different combinations of these variants! Please PAUSE to complete the activity Every cell in your body has the same genome, except… If some cells in your body carry a different genome, you are a mosaic or a chimera. Nature Review Genetics Every cell in your body has the same genome, except… If some cells in your body carry a different genome, you are a mosaic or a chimera. One zygote Mutation Mosaic Two zygotes Fusion or exchange of cells Chimera © Garland Science Every cell in your body has the same genome, except… If some cells in your body carry a different genome, you are a mosaic or a chimera. One zygote Mutation Mosaic Two zygotes Fusion or exchange of cells Chimera © Garland Science Ben Moore, wikipedia.org The first human genome was sequenced in 2001 The 1000 Genomes Project medschool.wustl.edu Genomics tells us about our ancestry Thousands of years before present Klyosov and Rozhanskii, 2012 Genomics created the field of “personalized medicine” Medical treatments may one day be customized to your genome.