Download Cutting out Genes - IISME Community Site

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

DNA polymerase wikipedia , lookup

Replisome wikipedia , lookup

Zinc finger nuclease wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

Microsatellite wikipedia , lookup

Helitron (biology) wikipedia , lookup

Transcript
Name: __________________________________________ Date: _________________
CUTTING OUT GENES
REVIEW & COMPREHENSION
Yesterday you translated some genes from jellyfish, coral and bacteria, then highlighted the
section of the DNA that coded for the trait.
1. What trait(s) did your DNA code for? ______________________________________
2. Is all of the DNA necessary for the trait? Explain. ____________________________
___________________________________________________________________
___________________________________________________________________
You have learned about restriction enzymes. Answer these questions to review the function
of restriction enzymes.
3. What do restriction enzymes do? _________________________________________
___________________________________________________________________
4. In what way are restriction enzymes “specific”? _____________________________
___________________________________________________________________
5. In both pictures and words, explain the difference between “sticky” cuts and
“blunt” cuts: _____________________________
_______________________________________
_______________________________________
SIMULATION
6. Your goal in this simulation is to take the _________________ genes for making
proteins that __________________ in different colors (i.e. pink or green), and to
insert them into _____________________.
7. How was the bacteria DNA structurally different from the jellyfish and coral DNA?
___________________________________________________________________
8. What will your vector be? _____________________________________ What does
this mean? __________________________________________________________
___________________________________________________________________
9. Describe the jellyfish/coral genes that we are working with in this simulation. What
do they code for and how are they used? __________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
ACTIVITY DIRECTIONS
The genes you received for this simulated
lab were specifically designed with
“polylinker” sites. This means that there
are multiple restriction enzyme cut sites on
either side of the genes you are interested
in. Listed at right are several available
restriction enzymes, with an illustration of
their cut sites.
1. Follow the teacher’s directions to
make sure you are working with
both a bacterial plasmid and a
jellyfish or coral gene.
2. Decide which of the restriction
enzyme(s) you will use to cut out
your jellyfish/coral gene and open
your bacterial plasmid. (Tip: trace
cut sites in pencil.)
Plan: Which restriction enzyme(s)
did you choose and why?
___________________________________________________________________
___________________________________________________________________
3. Using scissors, actually cut the DNA (both bacterial and jellyfish/coral!) in the
appropriate pattern for the restriction enzyme(s) you selected. If a cut site
appears more than once in a given strand of DNA, cut them all.
REFLECTION
4. How many pieces did you cut the jellyfish/coral DNA into? ___________________
5. How many pieces did you cut the bacterial DNA into? ________________________
6. Did you have to adjust your plan? ____________ If so, explain what happened:
___________________________________________________________________
___________________________________________________________________
___________________________________________________________________
7. Compare your results with those of others in the class. Did everyone use the same
restriction enzymes? Explain some of the different decisions that people made and
why. _______________________________________________________________
___________________________________________________________________
___________________________________________________________________
8. What is a “polylinker”? ________________________________________________
___________________________________________________________________
9. Does your bacterial plasmid have a polylinker? Describe/explain: _____________
___________________________________________________________________
Store your DNA segments as directed by your teacher.
You will need them again tomorrow.
Teacher Notes




There is a HindIII cut site before each jellyfish/coral gene, as well as in the plasmid,
and not in the middle of any gene. So it is an effective choice, but only if combined
with BamHI.
There is a BamHI cut site after each jellyfish/coral gene, as well as in the plasmid
before the HindIII cut site (after the gene). So it is an effective choice, but only if
combined with HindIII.
EcoRI has cut sites before and after each jellyfish/coral gene, as well as in the
plasmid, and not in the middle of any gene. Therefore, it is an effective choice on its
own.
There are ways to ligate sequences that have blunt cuts, but it is more difficult
than for sticky cuts. For the sake of this activity, students should choose sticky
cuts only, so that they can use the complementarity to ‘glue’ pieces back together.
That said, they may find the following blunt sites, and will hopefully discover that
they are less effective:
o The AluI cut site is embedded in the HindIII cut site, so all 3 genes have one
instance of it.
o The HaeIII cut site occurs before the Coral DNA gene, and after the Jellyfish
DNA gene (as well as in the plasmid).
o Direction matters… There are reverse cut sites for HaeIII (underlined in the
key below), but students should not cut these, since they do not match the
5’3’ orientation of the restriction enzyme.
Key:


bold areas are the translated gene (“ORF”)
colored areas correspond to the colored descriptions under “Teacher Notes”
Coral DNA:
5’TGAATTCCCGGATAAGCTTCATTTGGCCAATACGGTTAATTGTTTATTTGGATCCGAATTC3’
3’ACTTAAGGGCCTATTCGAAGTAAACCGGTTATGCCAATTAACAAATAAACCTAGGCTTAAG5’
Jellyfish DNA:
5’TAAAAGCTTGAATTCTACCCCGCCCTCCTTTTGATTTTTTTTTGAATTCTGGCCCGGATCC3’
3’ATTTTCGAACTTAAGATGGGGCGGGAGGAAAACTAAAAAAAAACTTAAGACCGGGCCTAGG5’
Bacterial DNA (circular):
5’TTACTCCCTTAGGTAAAGGTGTCGGTACGGGTAAACATAAGAAGAATAATTAATTGGATCCAAGCTTGAATTCGGCC3’
3’AATGAGGGAATCCATTTCCACAGCCATGCCCATTTGTATTCTTCTTATTAATTAACCTAGGTTCGAACTTAAGCCGG5’