* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Cutting out Genes - IISME Community Site
Survey
Document related concepts
Transcript
Name: __________________________________________ Date: _________________ CUTTING OUT GENES REVIEW & COMPREHENSION Yesterday you translated some genes from jellyfish, coral and bacteria, then highlighted the section of the DNA that coded for the trait. 1. What trait(s) did your DNA code for? ______________________________________ 2. Is all of the DNA necessary for the trait? Explain. ____________________________ ___________________________________________________________________ ___________________________________________________________________ You have learned about restriction enzymes. Answer these questions to review the function of restriction enzymes. 3. What do restriction enzymes do? _________________________________________ ___________________________________________________________________ 4. In what way are restriction enzymes “specific”? _____________________________ ___________________________________________________________________ 5. In both pictures and words, explain the difference between “sticky” cuts and “blunt” cuts: _____________________________ _______________________________________ _______________________________________ SIMULATION 6. Your goal in this simulation is to take the _________________ genes for making proteins that __________________ in different colors (i.e. pink or green), and to insert them into _____________________. 7. How was the bacteria DNA structurally different from the jellyfish and coral DNA? ___________________________________________________________________ 8. What will your vector be? _____________________________________ What does this mean? __________________________________________________________ ___________________________________________________________________ 9. Describe the jellyfish/coral genes that we are working with in this simulation. What do they code for and how are they used? __________________________________ ___________________________________________________________________ ___________________________________________________________________ ___________________________________________________________________ ___________________________________________________________________ ACTIVITY DIRECTIONS The genes you received for this simulated lab were specifically designed with “polylinker” sites. This means that there are multiple restriction enzyme cut sites on either side of the genes you are interested in. Listed at right are several available restriction enzymes, with an illustration of their cut sites. 1. Follow the teacher’s directions to make sure you are working with both a bacterial plasmid and a jellyfish or coral gene. 2. Decide which of the restriction enzyme(s) you will use to cut out your jellyfish/coral gene and open your bacterial plasmid. (Tip: trace cut sites in pencil.) Plan: Which restriction enzyme(s) did you choose and why? ___________________________________________________________________ ___________________________________________________________________ 3. Using scissors, actually cut the DNA (both bacterial and jellyfish/coral!) in the appropriate pattern for the restriction enzyme(s) you selected. If a cut site appears more than once in a given strand of DNA, cut them all. REFLECTION 4. How many pieces did you cut the jellyfish/coral DNA into? ___________________ 5. How many pieces did you cut the bacterial DNA into? ________________________ 6. Did you have to adjust your plan? ____________ If so, explain what happened: ___________________________________________________________________ ___________________________________________________________________ ___________________________________________________________________ 7. Compare your results with those of others in the class. Did everyone use the same restriction enzymes? Explain some of the different decisions that people made and why. _______________________________________________________________ ___________________________________________________________________ ___________________________________________________________________ 8. What is a “polylinker”? ________________________________________________ ___________________________________________________________________ 9. Does your bacterial plasmid have a polylinker? Describe/explain: _____________ ___________________________________________________________________ Store your DNA segments as directed by your teacher. You will need them again tomorrow. Teacher Notes There is a HindIII cut site before each jellyfish/coral gene, as well as in the plasmid, and not in the middle of any gene. So it is an effective choice, but only if combined with BamHI. There is a BamHI cut site after each jellyfish/coral gene, as well as in the plasmid before the HindIII cut site (after the gene). So it is an effective choice, but only if combined with HindIII. EcoRI has cut sites before and after each jellyfish/coral gene, as well as in the plasmid, and not in the middle of any gene. Therefore, it is an effective choice on its own. There are ways to ligate sequences that have blunt cuts, but it is more difficult than for sticky cuts. For the sake of this activity, students should choose sticky cuts only, so that they can use the complementarity to ‘glue’ pieces back together. That said, they may find the following blunt sites, and will hopefully discover that they are less effective: o The AluI cut site is embedded in the HindIII cut site, so all 3 genes have one instance of it. o The HaeIII cut site occurs before the Coral DNA gene, and after the Jellyfish DNA gene (as well as in the plasmid). o Direction matters… There are reverse cut sites for HaeIII (underlined in the key below), but students should not cut these, since they do not match the 5’3’ orientation of the restriction enzyme. Key: bold areas are the translated gene (“ORF”) colored areas correspond to the colored descriptions under “Teacher Notes” Coral DNA: 5’TGAATTCCCGGATAAGCTTCATTTGGCCAATACGGTTAATTGTTTATTTGGATCCGAATTC3’ 3’ACTTAAGGGCCTATTCGAAGTAAACCGGTTATGCCAATTAACAAATAAACCTAGGCTTAAG5’ Jellyfish DNA: 5’TAAAAGCTTGAATTCTACCCCGCCCTCCTTTTGATTTTTTTTTGAATTCTGGCCCGGATCC3’ 3’ATTTTCGAACTTAAGATGGGGCGGGAGGAAAACTAAAAAAAAACTTAAGACCGGGCCTAGG5’ Bacterial DNA (circular): 5’TTACTCCCTTAGGTAAAGGTGTCGGTACGGGTAAACATAAGAAGAATAATTAATTGGATCCAAGCTTGAATTCGGCC3’ 3’AATGAGGGAATCCATTTCCACAGCCATGCCCATTTGTATTCTTCTTATTAATTAACCTAGGTTCGAACTTAAGCCGG5’