Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Journal of General Virology (2015), 96, 1309–1319 DOI 10.1099/vir.0.000070 Full genomic analysis of new variant rabbit hemorrhagic disease virus revealed multiple recombination events Ana M. Lopes,1,2,3 Kevin P. Dalton,4 Maria J. Magalhães,1 Francisco Parra,4 Pedro J. Esteves,1,2,5 Edward C. Holmes6 and Joana Abrantes1 Correspondence Joana Abrantes [email protected] 1 CIBIO, InBIO - Research Network in Biodiversity and Evolutionary Biology, Universidade do Porto, Campus de Vairão, Rua Padre Armando Quintas, 4485-661 Vairão, Portugal 2 Departamento de Biologia, Faculdade de Ciências da Universidade do Porto, Porto, Portugal 3 INSERM, UMR892, Université de Nantes, Nantes, France 4 Instituto Universitario de Biotecnologı́a de Asturias, Departamento de Bioquı́mica y Biologı́a Molecular, Universidad de Oviedo, Oviedo, Spain 5 CITS, Centro de Investigação em Tecnologias da Saúde, IPSN, CESPU, Gandra, Portugal 6 Marie Bashir Institute for Infectious Diseases and Biosecurity, Charles Perkins Centre, School of Biological Sciences and Sydney Medical School, The University of Sydney, Sydney, NSW, Australia Received 13 November 2014 Accepted 22 January 2015 Rabbit hemorrhagic disease virus (RHDV), a Lagovirus of the family Caliciviridae, causes rabbit hemorrhagic disease (RHD) in the European rabbit (Oryctolagus cuniculus). The disease was first documented in 1984 in China and rapidly spread worldwide. In 2010, a new RHDV variant emerged, tentatively classified as ‘RHDVb’. RHDVb is characterized by affecting vaccinated rabbits and those ,2 months old, and is genetically distinct (~20 %) from older strains. To determine the evolution of RHDV, including the new variant, we generated 28 full-genome sequences from samples collected between 1994 and 2014. Phylogenetic analysis of the gene encoding the major capsid protein, VP60, indicated that all viruses sampled from 2012 to 2014 were RHDVb. Multiple recombination events were detected in the more recent RHDVb genomes, with a single major breakpoint located in the 59 region of VP60. This breakpoint divides the genome into two regions: one that encodes the non-structural proteins and another that encodes the major and minor structural proteins, VP60 and VP10, respectively. Additional phylogenetic analysis of each region revealed two types of recombinants with distinct genomic backgrounds. Recombinants always include the structural proteins of RHDVb, with non-structural proteins from non-pathogenic lagoviruses or from pathogenic genogroup 1 strains. Our results show that in contrast to the evolutionary history of older RHDV strains, recombination plays an important role in generating diversity in the newly emerged RHDVb. INTRODUCTION Rabbit hemorrhagic disease (RHD) is an acute fatal necrotizing hepatitis that affects wild and domestic European rabbits of both the Oryctolagus cuniculus cuniculus and Oryctolagus cuniculus algirus subspecies (Abrantes et al., The GenBank/EMBL/DDBJ accession numbers for the RHDV strains determined in this study are KF442964, KF442963, KP090974, KP090975, JF438967, KM115714, KM115715, KM115716, KF442961, KF442962, KP090976, KM115697, KM115698, KM115680, KM115681, KM115682, KM115711, KM115712, KM115713, KM115689, KM115683, KM979445, KM878681, KM979445, KP129395, KP129396, KP129397, KP129398, KP129399 and KP129400. 000070 G 2015 The Authors 2012b). The disease was first detected in 1984 in China following the importation of commercially bred Angora rabbits from Germany (Liu et al., 1984). RHD rapidly spread worldwide and is currently endemic in several countries including Portugal, Spain and France. The economic burden of RHD on rabbit farming and hunting industries and the negative ecological impact on the wild rabbit populations and in their dependent predators, particularly in the Mediterranean ecosystem, are well known and of major concern (Delibes-Mateos et al., 2009). In contrast, in Australia, RHD has been successfully exploited as a form of biocontrol to reduce rabbit numbers, although Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 06:11:47 Printed in Great Britain 1309 A. M. Lopes and others there is mounting evidence for host resistance (Elsworth et al., 2012; Kovaliski, 1998; Kovaliski et al., 2014). RHD is caused by rabbit hemorrhagic disease virus (RHDV), a Lagovirus of the family Caliciviridae. RHDV has a nonenveloped single-stranded (ss) RNA genome organized into two narrowly overlapping open reading frames (ORFs). ORF1 encompasses nucleotide residues 10–7044 and encodes a large polyprotein that is cleaved by a virusencoded protease to generate several non-structural (NS) proteins and the major capsid protein, VP60 or VP1 (for convenience, we use VP60). ORF2 comprises nucleotide residues 7025–7378 and produces VP10 (or VP2), a minor structural protein (Wirblich et al., 1996). At the 59 region, the RHDV genome presents a covalently linked protein, VPg, and is polyadenylated at the 39 region (Gregg et al., 1991; Morales et al., 2004). Viral particles also package an abundant subgenomic RNA (sgRNA) that contains the coding sequences of VP60 and VP10. As is the case for the RHDV genomic RNA, the sgRNA is VPg-linked and polyadenylated (Meyers et al., 1991; Morales et al., 2004; Ohlinger et al., 1990). Despite the importance of RHDV for animal health and ecosystem well-being, its origin and emergence as a pathogenic virus in the European rabbit is not well understood. On current data the most likely explanation is direct evolution from a non-pathogenic form of the virus (Kerr et al., 2009). Indeed, a number of non-pathogenic and a weakly pathogenic rabbit caliciviruses have been described in Europe, America and Australia (Bergin et al., 2009; Capucci et al., 1996; Le Gall-Reculé et al., 2011b; Strive et al., 2009), and there is evidence for the existence of RHDV as a non-pathogenic form before the first documented outbreak (reviewed by Abrantes et al., 2012b). To date, however, the mutations (or recombination events) responsible for the profound change in virulence are unknown. It is also theoretically possible that a crossspecies transmission event was central to the emergence of RHDV as a pathogenic form. Indeed, in the 1990s, RHDV affected a species other than the European rabbit (Lopes et al., 2014). More recently, a new variant of RHDV was detected in France (Le Gall-Reculé et al., 2011a). As a definitive RHDV nomenclature has not yet been agreed (various terms such as ‘new variant’, ‘RHDVb’ and ‘RHDV29 have been used), for simplicity we use the term ‘RHDVb’. RHDVb resulted in atypical RHD outbreaks in that it led to mortality in both vaccinated adult rabbits (Le Gall-Reculé et al., 2011a) and young rabbits (Dalton et al., 2014, 2012) that are typically resistant to RHDV. Phylogenetic relationships inferred from the VP60 gene showed that RHDVb formed a novel phylogenetic group that fell between the RCV-like viruses, i.e. European non-pathogenic viruses and the weakly pathogenic Michigan rabbit calicivirus (MRCV) and the Australian non-pathogenic rabbit caliciviruses (RCV-A1) (Le Gall-Reculé et al., 2011a). Further work demonstrated that RHDVb is antigenically different from 1310 other RHDVs (Dalton et al., 2012; Le Gall-Reculé et al., 2013), although its genesis is uncertain. Importantly, the recent detection of RHDVb in leporid species other than the European rabbit (Camarda et al., 2014; Puggioni et al., 2013) indicates that it might infect a wider range of host species. Both host-jumping and changes in virulence have been associated with the ability of RNA viruses to rapidly produce genetic diversity through mutation (Domingo & Holland, 1997; Holmes, 2010). However, it is also possible that the genotypes associated with successful emergence are generated by recombination (Simon-Loriere & Holmes, 2011). Because it requires template switching, (homologous) RNA recombination generally involves regions of high sequence similarity. Although homologous recombination has been detected in RHDV (Abrantes et al., 2008; Forrester et al., 2008), its impact on fitness and hence longterm importance remains uncertain. Notably, the RHDV strain isolated in 1984 in China had a recombinant origin (Forrester et al., 2008), which may have been in part responsible for the marked change in virulence observed in this virus. RHDV has been divided into six genogroups, denoted G1– G6 (Le Gall-Reculé et al., 2003). In the Iberian Peninsula, RHDV is characterized by a high degree of virus isolation with only G1 detected in wild rabbit populations (Abrantes et al., 2012a; Alda et al., 2010; Muller et al., 2009), which differs from the epidemiological pattern seen in other European countries (Le Gall-Reculé et al., 2003). However, in 2011 and 2012, RHDVb was detected in both Spain and Portugal (Abrantes et al., 2013; Dalton et al., 2012). To better understand the evolution of RHDV and particularly the occurrence and impact of recombination, we determined the complete coding sequences of Iberian RHDV strains collected between 1994 and 2014. RESULTS AND DISCUSSION We determined the complete coding sequence (excluding the 59 and 39 UTRs) of 28 RHDV strains from rabbits found dead in the Iberian Peninsula. Based on their position in the maximum-likelihood (ML) tree of the capsid gene (VP60) (Fig. 1), 24 strains were identified as RHDVb and four as genogroup 1 (G1). Considering the distribution of the European rabbit subspecies in the Iberian Peninsula (Carneiro et al., 2011; Ferrand, 2008), these results further confirm that both O. cuniculus algirus and O. cuniculus cuniculus are susceptible to this new virus (Abrantes et al., 2013). Interestingly, the co-circulation of RHDVb and other RHDV genogroups, particularly G1, was not detected. This supports the notion that G1 has been replaced by RHDVb (Lopes et al., 2015) and is compatible with the rapid spread of this new variant through the Iberian Peninsula (Dalton et al., 2014). The complete coding sequences of RHDVb exhibited some length variation due to deletions in the non-structural Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 06:11:47 Journal of General Virology 96 http://vir.sgmjournals.org 100 99 98 100 GQ166866/MRCV/USA/2001 AM268419/06-11/France/06-11-2006 EF558587/Ashington/UK/1998 G6/RHDVa CB154/Gaia/Portugal/1997 CB107/Coruche/Portugal/1994 CB110/Santarem/Portugal/1994 EF558578/Eisenhuttenstadt/1989 JF438967/CB156/Fornos/Portugal/1997 100 99* G2-G5 1311 Fig. 1. ML phylogenetic tree for 211 VP60 sequences of RHDV. Major genetic groups (genogroups) are indicated. For clarity of presentation, the sequences in genogroups G2–G5 and G6 (RHDVa) have been collapsed and have the following GenBank accession numbers: AB300693, AF231353, AF258618, AJ006019, AJ302016, AJ303106, AJ495856, AJ535092, AJ535094, AJ969628, AM085133, AY925210, AY926883, AY928268, AY928269, DQ069280–DQ069282, DQ189077, DQ189078, DQ205345, DQ841708, EF363035, EF558572, EF558574, EF558575, EF558577, EF558581–EF558584, EU003578–EU003582, EU250330, EU650679, EU650680, FJ212322, FJ212323, FJ794179, FJ794180, FN552800, FR823354, FR823355, GU339228, GU373617, GU373618, GU564448, HE963222, HM623309, HQ917923, JF412629, JN165233–JN165236, JN851729–JN851735, JQ815391, JQ995154, JX393309–JX393312, KC345614, KC595270, KF270630, KF494906–KF494952, KF537692, KF537693, KF594474–KF594476, KF677011, KJ579156–KJ579160, KJ606958, KJ606959, KJ683893, KJ683900, KJ683902, KJ683905–KJ683908, KJ814617–KJ814622, M67473, RHU49726, RHU54983, X87607, Y15424 and Y15427. The accession numbers are indicated for the remaining sequences. Viruses sequenced here (in bold) fall into two distinct clusters, G1 and RHDVb. All horizontal branch lengths are drawn to a scale of nucleotide substitutions per site and the tree is mid-point rooted. Bootstrap values greater than 75 % are shown for key nodes. *The main group of sequences in genogroups G2–G5 clustered together with 99 % bootstrap support. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 06:11:47 Recombination in rabbit hemorrhagic disease virus Z29514/SD/France/1989 L48547/MC/Spain/1989 Z24757/AST89/Spain/1989 Z49271/AST89/Spain/1989 0.05 subs/site Bar01-11/Spain/01-2011 CB194/Chaves/Portugal/2007 C147/Castro_Marim/Portugal/2004 KJ683894/14266/PT06 KJ683903/23212/08 KJ683904/14393/PT06 G1 100 100 RHDVb 100 94 EU871528/RCV-A1/Australia/2007 KC345611/Ss11 KC345612/Vs11-1 KC345613/Vs11-2 JX106023/Vs11 HE819400/10-08/France/2010 HE800531/10-28/France/2010 FR819781/10-05/France/2010 JQ929052/Ud11/Italy/2011 JX106022/Tn12 KC907712/Tn12-1 HE800532/10-32/France/2010 HE800530/10-07/France/2010 HE800529/10-01/France/2010 Tar06-12/Spain/06-2012 Zar06-12/Spain/06-2012 N11/Spain/10-2011 CBAnd1/Spain/04-2012 Zar11-11/Spain/11-2011 97 Rij06-12/Spain/06-2012 CBVal16/Portugal/11-2012 Seg08-12/Spain/08-2012 91 CBCoruche14-2/Portugal/02-2014 CBCoruche14-1/Portugal Barrancos7-13/Portugal/01-2013 Barrancos10A-13/Portugal/01-2013 CBLavra10-13-1/Portugal/10-2013 CBEstoi13-7/Portugal/12-2013 CBAlgarve3/Portugal/01-2013 CBAlgarve1/Portugal/01-2013 CBMontemor14-1/Portugal/02-2014 CBEstremoz14-3/Portugal CBMora14-1/Portugal CBEstremoz14-1/Portugal/01-2014 CBMertola14-2/Portugal/01-2014 CBAlgarve14-3/Portugal 100 CBMertola14-1/Portugal/01-2014 CBAlgarve14-1/Portugal CBAlgarve14-4/Portugal X96868/RCV/Italy/1996 A. M. Lopes and others proteins p16/NS1 and p37/NS3: a deletion of codon 68 (p16) in CBAnd1/Spain/04-2012 and deletions of codons 134–135 (p16/NS1) and of codon 714 (p37/NS3) in several strains. While the biological role of p16/NS1 is unknown, a recent study of RHDV in Australia revealed a relatively high number of mutations in this protein, which were tentatively associated with increased virulence (Elsworth et al., 2014). Protein p37 has an ATPase activity and may be a member of the helicase superfamily III (Marı́n et al., 2000). Although helicase activity is crucial for replication (Kadaré & Haenni, 1997), this deletion is located some distance from the Walker motifs A (amino acid positions 522–529 in RHDV) and B (amino acid positions 566–567 in RHDV) which are typical of NTP-binding proteins, and from an additional conserved C motif (amino acid positions 600–614 in RHDV), which is also involved in ATP hydrolysis (Marı́n et al., 2000). This indicates that the main biological functions of p37 are not compromised by the deletion. Additionally, the deletion is present in MRCV, RCV-A1 and in European brown hare syndrome virus (the other member of the genus Lagovirus), further suggesting that the replication activity of p37 is maintained. A mutation in the initiation codon (T to C in codon ATG, nucleotide positions 7025–7027) of ORF2 was observed in one strain, but expression of VP10 is not expected to be affected as translation of ORF2 relies on the presence of a sequence element at the 39 end of ORF1 and not on a particular initiation codon (Meyers, 2003). Additionally, another ATG in this region (nucleotide positions 7037– 7039) may act as the start site for translation of ORF2. The most striking result of our study was the occurrence of recombination in a number of recent RHDVb viruses with strong statistical support (P values ,0.001, Table 1). In these recombinant viruses, there was consistent evidence for a single recombination breakpoint located in a region close to the VP60 initiation codon (although two recombination breakpoints were detected they fall in very similar and overlapping locations, which is strongly suggestive of a single recombination event; Table 1). This was further confirmed with the SimPlot analysis (Fig. 2). Notably, this recombination breakpoint is located within a region of high sequence similarity (data not shown) and divides the genome into two regions that include different protein subsets: one that includes the non-structural proteins and another that comprises the structural proteins VP60 and VP10. To confirm this recombinant history, ML phylogenetic trees were inferred for the different genome fragments on either side of the recombination breakpoint identified above. For simplicity, we based this phylogenetic analysis on the recombinant breakpoint at nucleotide position 5305. For the phylogenetic tree of the genes encoding the structural proteins (VP60 and VP10 genes; Fig. 3a), all viruses previously identified as RHDVb (Fig. 1) clustered together in a single strongly supported monophyletic group (identified as RHDVb and shaded light grey). This cluster fell deep in the VP60 and VP10 phylogeny, close to the position of the mid-point root of the tree and between the non-pathogenic Australian strain (RCV-A1) and the 1312 weakly pathogenic MRCV. Hence, RHDVb is phylogenetically distinct from the pathogenic RHDV sequences that form a separate highly supported cluster. In contrast, in the phylogeny inferred for the non-structural proteins (Fig. 3b), the RHDVb sequences fall into three distinct clusters: (i) one comprising likely non-recombinant RHDVb sequences (shaded light grey) that share a common ancestor with pathogenic RHDV strains, (ii) another composed of likely recombinant RHDVb sequences that cluster with MRCV and RCV-A1 (medium grey) and (iii) a group of RHDVb recombinant sequences that cluster closely with recently sampled pathogenic G1 viruses (dark grey). The occurrence of multiple recombination events, i.e. RHDVb clusters (i) and (ii) mentioned above, makes it difficult to clearly distinguish recombinants from parents, but it is clearly necessary to invoke at least two independent recombination events involving RHDVb to explain these phylogenetic data. Moreover, the divergent position of the CBAnd1/Spain/ 04-2012 sequence within the RHDVb cluster (ii) may be indicative of an additional recombination event. It is also evident that one of the recombination events involved the combination of the RHDVb VP60 and VP10 coding sequences with a backbone composed of the coding sequences of the non-structural proteins of a G1-like strain, while in the other the RHDVb VP60 and VP10 coding sequences became linked with the coding sequences of the non-structural proteins of non-pathogenic lagoviruses (Fig. 3b). Since some of the recombinant viruses possess nonstructural genes that are closely related to the Australian non-pathogenic virus (as supported by the clustering of such recombinant viruses with RCV-A1 with 98 % bootstrap support), this evolutionary history implies that lineages related to the Australian viruses must circulate in the Iberian Peninsula but have not yet been detected [indeed, it is clear that RCV-A1 was imported into Australia (Jahnke et al., 2010)]. In addition, recombinant sequences were retrieved from animals found dead in the field with lesions compatible with RHD, and thus these strains are likely pathogenic despite their genome deriving mostly from nonpathogenic viruses. Although circulation of ‘true’ G1 viruses has not been detected in this study from 2011 onwards, the cocirculation of G1-like and RHDVb strains within the same geographical region and time-frame must have occurred for recombination to take place. Interestingly, the two different types of recombinants were detected from the same geographical area only one year apart (e.g. CBAlgarve14-1/ Portugal, detected in January 2014, and CBAlgarve1/ Portugal/01-2013, detected in January 2013). These observations indicate that there is a relatively high diversity of RHDV strains circulating in this region, which clearly merits additional surveillance. In addition, the same type of recombinant was observed in several and distantly located populations and in different years, confirming its viability and capacity to spread at the epidemiological scale. Two mechanisms of RNA recombination are possible for RNA viruses: replicative and non-replicative. The (copy-choice) Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 06:11:47 Journal of General Virology 96 http://vir.sgmjournals.org Table 1. Results of the recombination analysis Recombinant strains Most likely ‘parental’ strain NS* Genogroup VP60 and VP10 NS* VP60 and VP10 BreakpointD Average P value RDP GENECONV BootScan EU871528/RCV-A1/ Australia/2007 Seg08-12/Spain/ 08-2012 NPd RHDVb 5305 4.2726102125 2.8986102132 2.9716102137 (5267–5326) CBMertola14-2/Portugal/01-2014 CBMertola14-1/ Portugal/01-2014 CBAlgarve14-1/Portugal CBAlgarve14-3/Portugal CBAlgarve14-4/Portugal JX886001/CB194/Chaves/ Portugal/2006 Seg08-12/Spain/ 08-2012 G1 RHDVb 5336 6.2836102109 3.6106102106 6.3166102109 (5264–5343) *Non-structural proteins. D99 % confidence interval is indicated. dNon-pathogenic strain. 1313 Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 06:11:47 Recombination in rabbit hemorrhagic disease virus CBAnd1/Spain/04-2012 CBMontemor14-1/Portugal/02-2014 CBEstoi13-7/Portugal/12-2013 CBMora14-1/Portugal CBEstremoz14-1/Portugal/01-2014 CBEstremoz143/Portugal CBLavra10-13-1/Portugal/10-2013 CBAlgarve1/ Portugal/01-2013 CBAlgarve3/Portugal/01-2013 Barrancos7-13/Portugal/01-2013 Barrancos10A-13/Portugal/01-2013 CBCoruche141/Portugal CBCoruche14-2/Portugal/02-2014 A. M. Lopes and others (a) p16 ▼ p23 ▼ p37 ▼ p29 ▼VPg▼ pro ▼ RdRp VP60 VP10 1.0 0.9 0.8 0.7 0.5 101 341 581 821 1061 1301 1541 1781 2021 2261 2501 2741 2981 3221 3461 3701 3941 4181 4421 4661 4901 5141 5381 5621 5861 6101 6341 6581 6821 7061 0.6 EU871528/RCV-A1/Australia/2007 (b) p16 ▼ p23 ▼ p37 ▼ p29 Seg08-12/Spain/08-2012 ▼VPg▼ pro ▼ RdRp VP60 VP10 1.0 0.9 0.8 0.7 0.5 101 341 581 821 1061 1301 1541 1781 2021 2261 2501 2741 2981 3221 3461 3701 3941 4181 4421 4661 4901 5141 5381 5621 5861 6101 6341 6581 6821 7061 0.6 CB194/Chaves/Portugal/2007 Seg08-12/Spain/08-2012 Fig. 2. Similarity plot for two types of RHDVb recombinants: (a) CBAlgarve1/Portugal/01-2013 (non-pathogenic lagovirus/ RHDVb) and (b) CBAlgarve14-1/Portugal (G1/RHDVb). The vertical axis represents the percentage of sequence identity of each putative parental strain (grey and black lines) with the recombinant. The horizontal axis indicates the nucleotide positions. A window size of 200 bp with a step size of 20 bp was used. The site where the parental strains are identical in sequence to the recombinant is the predicted recombination breakpoint. A scheme of the genomic organization is shown above each plot with the encoded proteins indicated (pro, protease); arrowheads indicate cleavage sites. replicative mechanism involves template switching by the viral polymerase during RNA synthesis. In other Caliciviridae genera, such as Sapovirus, Vesivirus and Norovirus (NoV), a recombination hotspot is similarly observed between the non-structural proteins and the capsid junction (Bull & White, 2010). In the case of NoV, a template switching mechanism has been proposed that reflects a combination of the copy-choice and the internal initiation model (Bull et al., 2005). Accordingly, recombination occurs in the second round of replication when the polymerase starts the synthesis of a positive-sense RNA strand from a full-length negative strand. Due to the presence of complex secondary structures, 1314 such as stem–loops, at the ORF1/ORF2 overlap that coincides with the RNA promoter sequence, the polymerase loses processivity and switches to a negative strand of sgRNA synthesized by a co-infecting virus, thereby creating a hybrid virus (Bull et al., 2005). Alternatively, the polymerase switches from a genomic RNA to another in regions with high sequence homology, such as the one found where ORF1 and ORF2 overlap (Bull et al., 2005). Although the genomic organization of NoV differs from RHDV with the nonstructural proteins and the capsid protein encoded by separate ORFs, the synthesis of the sgRNA by an internal initiation mechanism and the presence of a subgenomic Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 06:11:47 Journal of General Virology 96 Recombination in rabbit hemorrhagic disease virus 0.05 subs/site G6/RHDVa G1 G2-G5 100 EU871528/RCV-A1/Australia/2007 Tar06-12/Spain/06-2012 Zar06-12/Spain/06-2012 100 CBAnd1/Spain/04-2012 Zar11-11/Spain/11-2011 Rij06-12/Spain/06-2012 96 CBVal16/Portugal/11-2012 Seg08-12/Spain/08-2012 100 CBMertola14-1/Portugal/01-2014 CBAlgarve14-3/Portugal CBMertola14-2/Portugal/01-2014 CBAlgarve14-1/Portugal CBAlgarve14-4/Portugal CBCoruche14-2/Portugal/02-2014 CBCoruche14-1/Portugal Barrancos10A-13/Portugal/01-2013 98 Barrancos7-13/Portugal/01-2013 CBEstremoz14-3/Portugal CBEstremoz14-1/Portugal/01-2014 CBMora14-1/Portugal CBMontemor14-1/Portugal/02-2014 CBLavra10-13-1/Portugal/10-2013 CBEstoi13-7/Portugal/12-2013 CBAlgarve1/Portugal/01-2013 CBAlgarve3/Portugal/01-2013 GQ166866/MRCV/USA/2001 EF558586/Hartmannsdorf/1989 EU003582/UT-01/2001 99 EF558583/Triptis/1996 EF558584/Rossi/2002 99 DQ205345/JX/CHA/97/1997 AB300693/Hokkaido/JPN/2002 EU003581/NY-01/2001 99 AF258618/Iowa2000/2000 EF558582/Dachswald/2000 JF412629/HYD/China/2005 DQ280493/ChinaWHNRH HM623309/NJ-2009/China/2009 EF558581/Erfurt/2000 AY523410/CD/China 100 EU003578/IN-05/2005 CB110/Santarem/Portugal/1994 CB154/Gaia/Portugal/1997 Z49271/RHDV-AST89/1989 EF558578/Eisenhuttenstadt/1989 96 Z29514/SD/France/1989 CB156/Fornos/Portugal/1997 JX886002/CB137/Alpiarca/Portugal/1995 Bar01-11/Spain/01-2011 JX886001/CB194/Chaves/Portugal/2006 DQ189078/Saudi Arabia AF295785/Mexico89/1989 EU003580/Korea90/1990 M67473/FRG/1989 RHU54983/RHDV-V351/1987 EU003579/Italy90/1990 EF558579/NZ54/2003 78 EF558580/NZ61/2003 EF558585/Hagenow/1990 EF558575/Ascot/UK/1992 X87607/BS89/1989 EF558574/Wika/Germany/1996 EF558572/Frankfurt12/1996 EF558573/Frankfurt5 EF558577/Meiningen/Germany/1993 EF363035/clonepJG-RHDV-DD06/1999 DQ189077/Bahrain/2001 EF558576/Jena/Germany RHDVb (a) Fig. 3. ML phylogenetic trees for the genome regions defined by the recombination analysis. Major genetic groups (genogroups) are indicated and strains sequenced here are shown in bold. Accession numbers of the sequences retrieved from GenBank are indicated. All horizontal branch lengths are drawn to a scale of nucleotide substitutions per site and the tree is mid-point rooted. Bootstrap values greater than 75 % are shown for key nodes. (a) ML tree based on the sequence fragment including VP60 and VP10 (nucleotide positions 5305–7378). RHDVb sequences are shaded light grey. (b) ML tree based on non-structural proteins sequences (nucleotide positions 10–5304). RHDVb strains fall in to three distinct clusters corresponding to: (i) non-recombinant RHDVb sequences (shaded light grey), (ii) non-pathogenic lagovirus/RHDVb recombinants (medium grey) and (iii) G1/RHDVb recombinants (dark grey). promoter upstream of the sgRNA starting site in RHDV (Morales et al., 2004) suggests that a similar recombination mechanism may occur. In addition, the presence of a region of high sequence homology upstream of the initiation codon of VP60 in RHDV (Simmonds et al., 2008), which is compatible with the location of the sgRNA promoter (Boga et al., 1992; Miller & Koev, 2000; Morales et al., 2004; Sibilia et al., 1995), as well as the presence of a stem–loop (Simmonds http://vir.sgmjournals.org et al., 2008), tentatively suggest that the recombination events observed could have been due to the template switching mechanism. However, it is also possible that the recombinant RHDV genomes observed might have been generated by a nonreplicative recombination mechanism. Such a mechanism, demonstrated for other positive-sense ssRNA viruses such as polioviruses and pestiviruses (Gallei et al., 2004; Gmyl Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 06:11:47 1315 100 97 0.05 subs/site et al., 1999), involves the cleavage of the recombining RNAs that are then ligated to form the recombinant molecule. In contrast to the template switching mechanism of recombination that is promoted by sequence conservation, the non-replicative recombination seems to be largely mediated by the presence of a RNA secondary structure (Chetverin et al., 1997) such as the stem–loop predicted for RHDV in the sgRNA promoter region (Simmonds et al., 2008). While the impact of recombination on the fitness of RHDVb remains to be assessed, this process has clearly created substantial changes in the viral genome, although whether this has led to differences in virulence is unclear. Indeed, the recombination events described involve the combination of structural and non-structural protein subsets with different ancestries: protein coding sequences are combined as ‘modules’ with non-structural proteins originating either from non-pathogenic forms or G1 viruses and structural proteins originating from RHDVb. A similar model of modular viral evolution has been 1316 G6/RHDVa 84 G2-G5 98 GQ166866/MRCV/USA/2001 EU871528/RCV-A1/Australia/2007 CBAnd1/Spain/04-2012 CBMontemor14-1/Portugal/02-2014 CBEstoi13-7/Portugal/12-2013 CBMora14-1/Portugal CBEstremoz14-1/Portugal/01-2014 100 CBEstremoz14-3/Portugal CBLavra10-13-1/Portugal/10-2013 CBAlgarve1/Portugal/01-2013 CBAlgarve3/Portugal/01-2013 Barrancos10A-13/Portugal/01-2013 Barrancos7-13/Portuga/01-2013 CBCoruche14-1/Portugal CBCoruche14-2/Portugal/02-2014 Zar06-12/Spain/06-2012 Tar06-12/Spain/06-2012 Zar11-11/Spain/11-2011 100 Seg08-12/Spain/08-2012 CBVal16/Portugal/11-2012 Rij06-12/Spain/06-2012 EF558586/Hartmannsdorf/1989 EU003582/UT-01/2001 EF558584/Rossi/2002 100 EF558583/Triptis/1996 AF258618/Iowa2000/2000 EF558582/Dachswald/2000 DQ205345/JX/CHA/97/1997 AB300693/Hokkaido/JPN/2002 EU003581/NY-01/2001 EF558585/Hagenow/1990 JF412629/HYD/China/2005 DQ280493/ChinaWHNRH HM623309/NJ-2009/China/2009 EF558581/Erfurt/2000 AY523410/CD/China EU003578/IN-05/2005 EU003580/Korea90/1990 100 DQ189078/Saudi Arabia AF295785/Mexico89/1989 EU003579/Italy90/1990 M67473/FRG/1989 RHU54983/RHDV-V351/1987 EF558579/NZ54/2003 EF558580/NZ61/2003 EF558577/Meiningen/Germany/1993 100 100 EF363035/clonepJG-RHDV-DD06/1999 DQ189077/Bahrain/2001 EF558576/Jena/Germany EF558575/Ascot/UK/1992 X87607/BS89/1989 EF558572/Frankfurt12/1996 100 EF558574/Wika/Germany/1996 EF558573/Frankfurt5 CB110/Santarem/Portugal/1994 CB154/Gaia/Portugal/1997 EF558578/Eisenhuttenstadt/1989 100 Z29514/SD/France/1989 Z49271/RHDV-AST89/1989 CB156/Fornos/Portugal/1997 JX886002/CB137/Alpiarca/Portugal/1995 Bar01-11/Spain/01-2011 100 JX886001/CB194/Chaves/Portugal/2006 CBAlgarve14-1/Portugal 100 CBMertola14-2/Portugal/01-2014 100 CBMertola14-1/Portugal/01-2014 CBAlgarve14-4/Portugal CBAlgarve14-3/Portugal G1 (b) RHDVb A. M. Lopes and others described for enteroviruses (family Picornaviridae), in which the structural and non-structural regions of the genome evolve semi-independently (Lukashev, 2005; Lukashev et al., 2005; Oberste et al., 2004), giving rise to new virus variants. RNA signals and sequence similarity are among the factors that might impose such a recombination pattern (Runckel et al., 2013), although other constraints exist at several stages of viral infection and replication in the host. These constraints most likely reflect functional protein ‘blocks’ that work together for protein compatibility. Interestingly, previous studies revealed recombination breakpoints throughout the RHDV genome (Abrantes et al., 2008; Forrester et al., 2008), although most of these recombination events occurred between closely related RHDV strains. Hence, it is likely that the sequence similarity between the recombining strains allows the functional integrity to be maintained. As there is prior evidence that recombination may have been central to the emergence of RHDV as a pathogenic form (Forrester et al., 2008), we contend that more effort should Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 06:11:47 Journal of General Virology 96 Recombination in rabbit hemorrhagic disease virus Table 2. List of primers and PCR conditions used in the amplification of the RHDV genome Forward primer (5§–3§) GTGAAAGTTATGGCGGCTATGTCG AGGTGCACCCTGCCATCATACAA CAACATCTTTGGCGCATGGT GCAAACCACCTTGTCAACCT GTTGGCGTTGACATGACATC GTGTATGCCATGACTCCGAT TGCTGAGCCAGATGTACGCT CACCTGTGGGTAAGAACACA Reverse primer (5§–3§) TTCCCAAGGACCATGGTGTGT ATGAGCGTGGTCTGTGAGTGGAA TACGCCAGCACGTCAATCTT ATGGCGTCAAGTATGGTCATGG CTAGTAGTGGCCACAACACC GCGTCGATGACAACATGAG AGTCCAATTGTCACTGGCAG ATAGCTTACTTTAAACTATAAACCCAA be directed toward revealing the frequency and fitness consequences of recombination in lagoviruses. METHODS Virus samples and genome amplification. Liver samples were collected from wild rabbits found dead in the field in different regions of Portugal and from domestic rabbits from Spanish rabbitries, and were kept frozen at 220 uC. No live animals were shot, trapped or handled to obtain tissues, as such, no animal ethics permit was required. Each frozen liver was thawed and up to 30 mg of the liver was collected. The tissue was homogenized in a rotor-stator homogenizer (Mixer Mill MM400; Retsch) at 30 Hz for 7 min. Total RNA was extracted using the RNeasy Mini kit (Qiagen) according to the protocol provided by the manufacturer. Reverse transcription was performed using oligo(dT) as primers and SuperScript III Reverse Transcriptase (Invitrogen) according to the provided protocol. The complete genome of each RHDV strain was obtained by the amplification of several overlapping fragments ranging from ~700 to 1700 bp using 1 ml cDNA reaction mix, 2 pmol of each oligonucleotide, 5 ml Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific) and water to a final volume of 10 ml. The primers and PCR conditions used are summarized in Table 2. For recombinant sequences, each PCR was performed at least twice independently. After purification, PCR products were sequenced on an automatic sequencer ABI PRISM 310 Genetic Analyzer (Applied Biosystems). Sequences were determined using the amplification primers and are available in GenBank. No incongruences were detected between the overlapping fragments that could indicate preferential amplification of templates in each PCR. While it is highly unlikely that the Phusion DNA Polymerase generates crossovers at the same position repeatedly, a long range PCR was also performed to obtain complete genomic sequences and exclude the possibility of PCR-mediated artefacts in generating the recombinant sequences. This PCR was conducted with the following conditions: 0.25 ml of Takara LA Taq (Clontech), 2.5 ml buffer, 2.5 mM MgCl2, 2.5 mM of each dNTP, 0.4 mM of each primer, 1 ml of template and water to a final volume of 25 ml. Cycle conditions consisted of 2 min at 94 uC, 35 cycles of 30 s at 94 uC, 30 s at 63 uC and 8 min 30 s at 68 uC and a final extension of 15 min at 68 uC. The amplicons were sequenced as described above using amplification primers listed in Table 2 (primer 59-GTGTATGCCATGACTCCGAT39 covers the regions located both upstream and downstream of the recombination breakpoint). Recombination analysis. The complete genome sequences obtained (excluding the 59 and 39 UTRs) were aligned using the BioEdit software, version 7.0.9.0 (Hall, 1999). Full-length RHDV genome sequences available in public databases were retrieved and included in http://vir.sgmjournals.org Annealing temperature (6C) 55 53 51 48 52 48 52 50 Extension time 1 min 30 1 min 15 1 min 1 min 30 1 min 15 1 min 30 1 min 15 45 s s s s s s s the alignment. This produced a final dataset of 68 sequences of 7369 nt, including representatives from all major groups of RHDV. This sequence alignment was screened for recombination using the RDP, GENECONV and BootScan methods implemented in the RDP software (version 4.26) (Martin et al., 2010) under the following parameters: sequences were set to linear, Bonferroni correction, highest acceptable P value 0.05 and 100 permutations. Only recombination events detected by all three methods were considered as viable and hence merited additional analysis (see Phylogenetic analysis section). Strains detected as recombinants were further analysed using the SimPlot software (version 3.5.1) (Lole et al., 1999) with the default parameters (window size, 200 bp; step, 20 bp; Ts/Tv ratio, 2 : 0). Phylogenetic analysis. An initial reconstructed phylogenetic tree was inferred for the VP60 gene to provide a provisional picture of the evolutionary relationships of RHDVb to the remaining pathogenic and non-pathogenic lagoviruses. For this analysis, all available VP60 sequences were retrieved from public databases, producing a final dataset of 211 sequences of 1740 nt. A phylogenetic tree was then estimated using the ML method available in PhyML program (Guindon et al., 2010) utilizing the GTR+I+C model of nucleotide substitution and employing a combination of nearest-neighbour interchange (NNI) and subtree pruning and regrafting branchswapping. The support for each node was determined from 1000 bootstrap replicate ML trees, employing the same substitution model and parameter values as above, and with NNI branch-swapping. For the complete genome sequences, the dataset was partitioned at the putative recombination breakpoint(s) detected in the recombination analysis described in the Results and Discussion section and then subjected to phylogenetic analysis. This partitioning was as follows: (i) ORF1 except VP60 (nucleotide residue positions 10–5304) and (ii) VP60 and VP10 (nucleotide residue positions 5305–7378). Phylogenetic trees were then estimated for both partitions using the same phylogenetic procedure as described above (i.e. ML trees in PhyML). ACKNOWLEDGEMENTS We acknowledge all the collaborators who provided samples: Dr Paulo Célio Alves (CIBIO/InBIO-UP), Vı́tor Palmilha, José Manuel Maia and Jacinto Amaro. We thank INTERCUN and Spanish Ministerio de Economı́a y Competitividad (grant AGL2013-48550C2-1-R co-financed by FEDER) for the logistical and financial support provided to the laboratory of F. P. This work was funded by National Funds through the FCT-Foundation for Science and Technology under the project ref. FCT-ANR/BIA-BIC/0043/2012. This work was also supported by ‘Genomics Applied to Genetic Resources’, co-financed by North Portugal Regional Operational Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 06:11:47 1317 A. M. Lopes and others Programme 2007/2013 (ON.2 - O Novo Norte), under the National Strategic Reference Framework (NSRF), through the European Regional Development Fund (ERDF). FCT supported the doctoral fellowship of A. M. L. (ref. SFRH/BD/78738/2011) and the FCT Investigator grant of J. A. (ref. IF/01396/2013). E. C. H. is supported by an NHMRC Australia Fellowship (AF30) and by the ARC (grant no. DP140103362). hemorrhagic disease virus in young rabbits, Spain. Emerg Infect Dis 18, 2009–2012. Dalton, K. P., Nicieza, I., Abrantes, J., Esteves, P. J. & Parra, F. (2014). Spread of new variant RHDV in domestic rabbits on the Iberian Peninsula. Vet Microbiol 169, 67–73. Delibes-Mateos, M., Farfán, M. A., Olivero, J., Márquez, A. L. & Vargas, J. M. (2009). Long-term changes in game species over a long period of transformation in the Iberian Mediterranean landscape. Environ Manage 43, 1256–1268. REFERENCES Domingo, E. & Holland, J. J. (1997). RNA virus mutations and fitness for survival. Annu Rev Microbiol 51, 151–178. Abrantes, J., Esteves, P. J. & van der Loo, W. (2008). Evidence for recombination in the major capsid gene VP60 of the rabbit haemorrhagic disease virus (RHDV). Arch Virol 153, 329–335. Elsworth, P. G., Kovaliski, J. & Cooke, B. D. (2012). Rabbit Abrantes, J., Lopes, A. M. & Esteves, P. J. (2012a). Complete haemorrhagic disease: are Australian rabbits (Oryctolagus cuniculus) evolving resistance to infection with Czech CAPM 351 RHDV? Epidemiol Infect 140, 1972–1981. genomic sequences of rabbit hemorrhagic disease virus G1 strains isolated in the European rabbit original range. J Virol 86, 13886. Elsworth, P., Cooke, B. D., Kovaliski, J., Sinclair, R., Holmes, E. C. & Strive, T. (2014). Increased virulence of rabbit haemorrhagic disease Abrantes, J., van der Loo, W., Le Pendu, J. & Esteves, P. J. (2012b). virus associated with genetic resistance in wild Australian rabbits (Oryctolagus cuniculus). Virology 464-465, 415–423. Rabbit haemorrhagic disease (RHD) and rabbit haemorrhagic disease virus (RHDV): a review. Vet Res 43, 12. Ferrand, N. (2008). Inferring the evolutionary history of the variant of rabbit hemorrhagic disease virus, Portugal, 2012-2013. Emerg Infect Dis 19, 1900–1902. European rabbit (Oryctolagus cuniculus) from molecular markers. In Lagomorph Biology: Evolution, Ecology and Conservation, pp. 47–63. Edited by P. C. Alves, N. Ferrand & K. Hackländer. Berlin, Heidelberg, New York: Springer. Alda, F., Gaitero, T., Suárez, M., Merchán, T., Rocha, G. & Doadrio, I. (2010). Evolutionary history and molecular epidemiology of rabbit Forrester, N. L., Moss, S. R., Turner, S. L., Schirrmeier, H. & Gould, E. A. (2008). Recombination in rabbit haemorrhagic disease virus: haemorrhagic disease virus in the Iberian Peninsula and Western Europe. BMC Evol Biol 10, 347. possible impact on evolution and epidemiology. Virology 376, 390–396. Bergin, I. L., Wise, A. G., Bolin, S. R., Mullaney, T. P., Kiupel, M. & Maes, R. K. (2009). Novel calicivirus identified in rabbits, Michigan, recombination in vivo in the absence of viral replication. J Virol 78, 6271–6281. USA. Emerg Infect Dis 15, 1955–1962. Gmyl, A. P., Belousov, E. V., Maslova, S. V., Khitrina, E. V., Chetverin, A. B. & Agol, V. I. (1999). Nonreplicative RNA recombination in Abrantes, J., Lopes, A. M., Dalton, K. P., Melo, P., Correia, J. J., Ramada, M., Alves, P. C., Parra, F. & Esteves, P. J. (2013). New Boga, J. A., Marı́n, M. S., Casais, R., Prieto, M. & Parra, F. (1992). In vitro translation of a subgenomic mRNA from purified virions of the Spanish field isolate AST/89 of rabbit hemorrhagic disease virus (RHDV). Virus Res 26, 33–40. Bull, R. & White, P. A. (2010). Genome organization and recombination. In Caliciviruses: Molecular and Cellular Virology, pp. 45–63. Edited by G. S. Hansman, X. J. Jiang & K. Y. Green. Norfolk, UK: Caister Academic Press. Bull, R. A., Hansman, G. S., Clancy, L. E., Tanaka, M. M., Rawlinson, W. D. & White, P. A. (2005). Norovirus recombination in ORF1/ORF2 overlap. Emerg Infect Dis 11, 1079–1085. Camarda, A., Pugliese, N., Cavadini, P., Circella, E., Capucci, L., Caroli, A., Legretto, M., Mallia, E. & Lavazza, A. (2014). Detection of the new emerging rabbit haemorrhagic disease type 2 virus (RHDV2) in Sicily from rabbit (Oryctolagus cuniculus) and Italian hare (Lepus corsicanus). Res Vet Sci 97, 642–645. Capucci, L., Fusi, P., Lavazza, A., Pacciarini, M. L. & Rossi, C. (1996). Detection and preliminary characterization of a new rabbit calicivirus related to rabbit hemorrhagic disease virus but nonpathogenic. J Virol 70, 8614–8623. Carneiro, M., Afonso, S., Geraldes, A., Garreau, H., Bolet, G., Boucher, S., Tircazes, A., Queney, G., Nachman, M. W. & Ferrand, N. (2011). The genetic structure of domestic rabbits. Mol Biol Evol 28, 1801–1816. Gallei, A., Pankraz, A., Thiel, H. J. & Becher, P. (2004). RNA poliovirus. J Virol 73, 8958–8965. Gregg, D. A., House, C., Meyer, R. & Berninger, M. (1991). Viral haemorrhagic disease of rabbits in Mexico: epidemiology and viral characterization. Rev Sci Tech 10, 435–451. Guindon, S., Dufayard, J. F., Lefort, V., Anisimova, M., Hordijk, W. & Gascuel, O. (2010). New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol 59, 307–321. Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41, 95–98. Holmes, E. C. (2010). Evolution in health and medicine Sackler colloquium: The comparative genomics of viral emergence. Proc Natl Acad Sci U S A 107 (Suppl 1), 1742–1746. Jahnke, M., Holmes, E. C., Kerr, P. J., Wright, J. D. & Strive, T. (2010). Evolution and phylogeography of the nonpathogenic calicivirus RCVA1 in wild rabbits in Australia. J Virol 84, 12397–12404. Kadaré, G. & Haenni, A. L. (1997). Virus-encoded RNA helicases. J Virol 71, 2583–2590. Kerr, P. J., Kitchen, A. & Holmes, E. C. (2009). Origin and phylodynamics of rabbit hemorrhagic disease virus. J Virol 83, 12129–12138. Kovaliski, J. (1998). Monitoring the spread of rabbit hemorrhagic Chetverin, A. B., Chetverina, H. V., Demidenko, A. A. & Ugarov, V. I. (1997). Nonhomologous RNA recombination in a cell-free system: disease virus as a new biological agent for control of wild European rabbits in Australia. J Wildl Dis 34, 421–428. evidence for a transesterification mechanism guided by secondary structure. Cell 88, 503–513. Kovaliski, J., Sinclair, R., Mutze, G., Peacock, D., Strive, T., Abrantes, J., Esteves, P. J. & Holmes, E. C. (2014). Molecular epidemiology of Dalton, K. P., Nicieza, I., Balseiro, A., Muguerza, M. A., Rosell, J. M., Casais, R., Álvarez, A. L. & Parra, F. (2012). Variant rabbit Rabbit Haemorrhagic Disease Virus in Australia: when one became many. Mol Ecol 23, 408–420. 1318 Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 06:11:47 Journal of General Virology 96 Recombination in rabbit hemorrhagic disease virus Le Gall-Reculé, G., Zwingelstein, F., Laurent, S., de Boisséson, C., Portejoie, Y. & Rasschaert, D. (2003). Phylogenetic analysis of rabbit haemorrhagic disease virus in France between 1993 and 2000, and the characterisation of RHDV antigenic variants. Arch Virol 148, 65–81. Le Gall-Reculé, G., Zwingelstein, F., Boucher, S., Le Normand, B., Plassiart, G., Portejoie, Y., Decors, A., Bertagnoli, S., Guérin, J. L. & Marchandeau, S. (2011a). Detection of a new variant of rabbit haemorrhagic disease virus in France. Vet Rec 168, 137–138. Le Gall-Reculé, G., Zwingelstein, F., Fages, M. P., Bertagnoli, S., Gelfi, J., Aubineau, J., Roobrouck, A., Botti, G., Lavazza, A. & Marchandeau, S. (2011b). Characterisation of a non-pathogenic and non-protective infectious rabbit lagovirus related to RHDV. Virology 410, 395–402. Le Gall-Reculé, G., Lavazza, A., Marchandeau, S., Bertagnoli, S., Zwingelstein, F., Cavadini, P., Martinelli, N., Lombardi, G., Guérin, J. L. & other authors (2013). Emergence of a new lagovirus related to Rabbit Haemorrhagic Disease Virus. Vet Res 44, 81. Liu, S. J., Xue, H. P., Pu, B. Q. & Qian, N. H. (1984). A new viral disease in rabbit. Anim Husb Vet Med 16, 253–255. Lole, K. S., Bollinger, R. C., Paranjape, R. S., Gadkari, D., Kulkarni, S. S., Novak, N. G., Ingersoll, R., Sheppard, H. W. & Ray, S. C. (1999). Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination. J Virol 73, 152–160. Lopes, A. M., Correia, J., Abrantes, J., Melo, P., Ramada, M., Magalhães, M. J., Alves, P. C. & Esteves, P. J. (2015). Is the new variant RHDV replacing genogroup 1 in Portuguese wild rabbit populations? Viruses 7, 27–36. Lopes, A. M., Marques, S., Silva, E., Magalhães, M. J., Pinheiro, A., Alves, P. C., Le Pendu, J., Esteves, P. J., Thompson, G. & Abrantes, J. (2014). Detection of RHDV strains in the Iberian hare (Lepus Meyers, G., Wirblich, C. & Thiel, H. J. (1991). Rabbit hemorrhagic disease virus–molecular cloning and nucleotide sequencing of a calicivirus genome. Virology 184, 664–676. Miller, W. A. & Koev, G. (2000). Synthesis of subgenomic RNAs by positive-strand RNA viruses. Virology 273, 1–8. Morales, M., Bárcena, J., Ramı́rez, M. A., Boga, J. A., Parra, F. & Torres, J. M. (2004). Synthesis in vitro of rabbit hemorrhagic disease virus subgenomic RNA by internal initiation on (-)sense genomic RNA: mapping of a subgenomic promoter. J Biol Chem 279, 17013– 17018. Muller, A., Freitas, J., Silva, E., Le Gall-Reculé, G., Zwingelstein, F., Abrantes, J., Esteves, P. J., Alves, P. C., van der Loo, W. & other authors (2009). Evolution of rabbit haemorrhagic disease virus (RHDV) in the European rabbit (Oryctolagus cuniculus) from the Iberian Peninsula. Vet Microbiol 135, 368–373. Oberste, M. S., Maher, K. & Pallansch, M. A. (2004). Evidence for frequent recombination within species human enterovirus B based on complete genomic sequences of all thirty-seven serotypes. J Virol 78, 855–867. Ohlinger, V. F., Haas, B., Meyers, G., Weiland, F. & Thiel, H. J. (1990). Identification and characterization of the virus causing rabbit hemorrhagic disease. J Virol 64, 3331–3336. Puggioni, G., Cavadini, P., Maestrale, C., Scivoli, R., Botti, G., Ligios, C., Le Gall-Reculé, G., Lavazza, A. & Capucci, L. (2013). The new French 2010 rabbit hemorrhagic disease virus causes an RHD-like disease in the Sardinian Cape hare (Lepus capensis mediterraneus). Vet Res 44, 96. Runckel, C., Westesson, O., Andino, R. & DeRisi, J. L. (2013). Identification and manipulation of the molecular determinants influencing poliovirus recombination. PLoS Pathog 9, e1003164. granatensis): earliest evidence of rabbit lagovirus cross-species infection. Vet Res 45, 94. Sibilia, M., Boniotti, M. B., Angoscini, P., Capucci, L. & Rossi, C. (1995). Two independent pathways of expression lead to self- Lukashev, A. N. (2005). Role of recombination in evolution of enteroviruses. Rev Med Virol 15, 157–167. assembly of the rabbit hemorrhagic disease virus capsid protein. J Virol 69, 5812–5815. Lukashev, A. N., Lashkevich, V. A., Ivanova, O. E., Koroleva, G. A., Hinkkanen, A. E. & Ilonen, J. (2005). Recombination in circulating Simmonds, P., Karakasiliotis, I., Bailey, D., Chaudhry, Y., Evans, D. J. & Goodfellow, I. G. (2008). Bioinformatic and functional analysis of Human enterovirus B: independent evolution of structural and nonstructural genome regions. J Gen Virol 86, 3281–3290. Marı́n, M. S., Casais, R., Alonso, J. M. & Parra, F. (2000). ATP binding RNA secondary structure elements among different genera of human and animal caliciviruses. Nucleic Acids Res 36, 2530– 2546. and ATPase activities associated with recombinant rabbit hemorrhagic disease virus 2C-like polypeptide. J Virol 74, 10846–10851. Simon-Loriere, E. & Holmes, E. C. (2011). Why do RNA viruses Martin, D. P., Lemey, P., Lott, M., Moulton, V., Posada, D. & Lefeuvre, P. (2010). RDP3: a flexible and fast computer program for analyzing Strive, T., Wright, J. D. & Robinson, A. J. (2009). Identification and recombine? Nat Rev Microbiol 9, 617–626. recombination. Bioinformatics 26, 2462–2463. partial characterisation of a new lagovirus in Australian wild rabbits. Virology 384, 97–105. Meyers, G. (2003). Translation of the minor capsid protein of a Wirblich, C., Thiel, H. J. & Meyers, G. (1996). Genetic map of the calicivirus is initiated by a novel termination-dependent reinitiation mechanism. J Biol Chem 278, 34051–34060. calicivirus rabbit hemorrhagic disease virus as deduced from in vitro translation studies. J Virol 70, 7974–7983. http://vir.sgmjournals.org Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Sat, 12 Aug 2017 06:11:47 1319