Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
THE SCITECH JOURNAL ISSN 2347-7318 ISSN 2348-2311 Online SAMANTHI Research Article Phylogenetic Relationship Among Some Species of Bruchinae Based Upon 16S And 12S Ribosomal RNA Neha Goyal and Vijay Lakshmi Sharma Department of Zoology, Panjab University, Chandigarh - 160014 Abstract Bruchids (pulse beetles) are cosmopolitan and the most destructive pests of stored pulses. The genus Callosobruchus (Coleoptera:Chrysomelidae:Bruchinae) has its origin in Asia and Africa. In India, C. analis, C. maculatus and C. chinensis are the predominant pests of this group. They cause maximum damage to the stored grains in the months of February to August when all its developmental stages co-exist. In this study 12SrRNA and 16SrRNA gene fragments were used to analyze the phylogeneytic relationship of two of these species i.e. Callosobruchus analis and Callosobruchus maculatus with the other Bruchid species found worldwide. The sequences showed an A+T bias of >70% in conformation with the previous studies. The phylogenetic trees were drawn on the basis of maximum likelihood and neighbor joining methods using MEGA 6.06 algorithm. The species of the family Cerambycidae were included in the analysis to obtain rooted trees. Separate analysis of both the 12S and 16S genes strongly supported the monophyly of the Callosobruchus genus. Within the major cluster, C.analis formed a common clade with the African C.chinensis species while C.maculatus showed a closer relationship with African C.subinnotatus species. The clades were well supported by bootstrap values above 50. Key words: Callosobruchus analis, Callosobruchus maculatus, 12SrRNA, 16SrRNA, phylogeny, MEGA 6.06. Introduction Pulses are a high quality source of protein and in the Indian subcontinent where the population is predominantly vegetarian they constitute an integral part of the daily meal. India is the largest producer and consumer of pulses in the world. But the subcontinent's demand for pulses is rising every year as pulse production struggles to keep pace with the country's population growth which has doubled since 1961 whilst the pulse production has increased by just 30% . The problem is further aggravated by lack of proper storage practices which culminate into huge losses that arise from insect infestation, rodent infestation or microbial growth. About 8.5 % of annual pulse production is lost during post harvest and storage handling (Agrawal et al., 1988). As per the latest estimates, India achieved high pulses production record of 18.45 million tonnes (MT) in the year 2012 but still it had to import the pulses to meet the gap between domestic demand and supply (FAO 2012) As per reports, major damage to the pulse production is inflicted by the insect pests both in the field before harvest and in storage (Kusolwa, 2007). Over 200 species of insects infest various pulses in India (Anonymous, 2007). Among the storage pests, bruchids are of great importance. Over 1700 species of bruchids grouped under 62 genera are known all over the world (Romero et al., 2004). Of these 108 species belonging to 11 genera of 3 subfamilies have been reported from the Indian subcontinent (Thakur, 2012). And out of these, 17 species are known to infest different pulses (Arora, 1977). The edible legumes in India are attacked primarily by four species of pulse beetles i.e. Callosobruchus maculatus (Fabricius), C. analis (Fabricius), C. chinensis (Linn.) and Zabrotes subfasciatus (Boh.). C. maculatus, commonly known as cowpea weevil and C. analis as grahambean weevil, are cosmopolitan in distribution and are serious pests of legumes mainly Vigna radiata, Vigna unguiculta, Vigna mungo and Cicer arietinum causing heavy economic losses to the farmers. These insects spend their entire larval and pupal stages in individual legume seeds thereby rendering them unsuitable for human consumption and reducing their germination potential. In India as much as 30-40% of grain is lost because of infestations from these pests. However during severe periods of infestation the damage can even reach up to 100% (Pruthi and Singh, 1950). Extensive studies have been carried out by many workers on insectplant co-evolution in the family chrysomelidae (Kergoat et al., 2005; Funk et al., 1995) but very few phylogenetic studies have been made for this family (Slobodchikoff and Johnson, 1973). Jei et al. studied the genetic differentiation amongst the geographic populations of the Callosobruchus maculatus (Fabricius) based upon the mitochondrial COI and cytb genes. In the present study, a comparison of the mitochondrial 12S and 16SrRNA gene sequences of two species of Callosobruchus i.e. Callosobruchus analis and Callosobruchus maculatus with the members of Bruchinae has been carried out to understand their phylogenetic relationship. Material and Methods Sample culture: Sedentary individuals of the two species of Bruchids i.e. Callosobruchus analis (Fabricus) and Callosobruchus maculatus (Fabricus) constituted the material for the present investigation. Both these species are serious pests of the legumes of the family fabeaccae. Small populations of the species were reared Received:December 2014 Accepted: December 2014 *Corresponding Author Email: [email protected] 16 THE SCITECH JOURNAL VOLUME 02 ISSUE 01 JANUARY 2015 THE SCITECH JOURNAL ISSN 2347-7318 ISSN 2348-2311 Online SAMANTHI Research Article under laboratory conditions on Vigna radiata seeds in glass jars inside a growth chamber at 30 ± 2°C and 70% relative humidity. Muslin cloth was used to close the mouth of the jars. The specimens were identified on the basis of the color pattern on elytra and the color and distribution of pubescence on the pygidium. (Fig.1). DNA isolation: The voucher specimens were preserved in absolute ethanol mixed with a few drops of glycerol and maintained at Department of Zoology, Panjab University, Chandigarh (UT), India, till the extraction of genomic DNA. DNA was extracted from whole insect using modified phenol:chloroform method (Sambrook et al., 1989). Isolated DNA was suspended in 100µl of TE buffer and stored at 20°C. The integrity of the genomic DNA was checked on 0.8% agarose gel by horizontal gel electrophoresis. Quantification of DNA was done by nanodrop-spectrophotometer. PCR amplification and sequencing: Partial fragments of 12S rRNA and 16S rRNA gene sequences given by Simon et al., 1994 were used for the amplification of both gene fragments: 12S-f 5'tactatgttacgacttat3'; 12S-r 5'aaactaggattagataccc3'; 16S-f 5'ccggtttgaactcagatcatgt-3' & 16S-r 5'cgcctgtttaacaaaaacat3'. PCR amplifications were carried out in 25 µl reaction mixture containing 2/2.5 µl of 10 × Taq DNA polymerase buffer, 2-2.5 mM MgCl2, 0.1 mM dNTPs, 5 pM each primer and 0.5 U Taq DNA polymerase. Amplifications were carried out in a thermal cycler (Biometra, Germany) and the cycling profile was as follows: Initial denaturion at 95°C for 5 min, 30 cycles of 30s denaturion at 95°C, 45s annealing at 49°C (12SrRNA)/ 52 °C (16SrRNA), 1 min extension at 72°C, followed by a final extension of 7 min at 72°C. The length of the amplified products was checked by horizontal gel electrophoresis by running on 2% agarose gel (stained with ethidium bromide) with 100bp DNA ladder. The amplified products of 12SrRNA and 16SrRNA gene were got sequenced from Chromous Biotech Pvt. Ltd. (Bangalore, India). The data was retrieved in the form of chromatograms. Data Analysis The sequences were first edited manually for discarding the ambiguous and skipped bases and files were converted into FASTA format. The edited sequences were compared with related sequences from the nucleotide database of the National Centre for Biotechnology Information (NCBI) using Basic Local Alignment Search Tool (blastn) algorithm (Altschul et al., 1997). The accession numbers of the sequences selected for the present analysis are shown in Table 1 (12SrRNA) and Table 2 (16SrRNA). Consensus sequences were aligned using the Clustal omega software (Sievers et al., 2011). The sequence ambiguities were corrected manually. The sequence data was then imported into the MEGA 6.06 software package and analysed to generate neighbor-joining and maximum likelihood trees using Kimura 2-Parameter (K2P) method (Kimura, 1980) Analysis of nucleotide composition, overall transition: transversion ratio (ts:tv), and pairwise nucleotide distances were calculated using MEGA 6 (Tamura et al., 2013). Bootstrap analysis using 1000 pseudoreplications (Felsenstein, 1985) was included to test the reliability of inferred trees and all codon positions (1st, 2nd & 3rd) were included to verify the robustness of the internal nodes. Figure 1. Photographs pf the normal female forms of two species of Callosobruchus Figure 2. Amplification product of 12SrRNA gene Callosobruchus species under study Lane M: 100 bp DNAladder in Figure 3. Amplification product of 16SrRNA gene in Callosobruchus species under study Lane L1-L3: C. maculatus (2 populations) Lane L4-L5: C.analis(2 populations) 17 THE SCITECH JOURNAL VOLUME 02 ISSUE 01 JANUARY 2015 THE SCITECH JOURNAL ISSN 2347-7318 ISSN 2348-2311 Online SAMANTHI Research Article Results The amplified 12SrRNA and 16SrRNA gene fragments in the present study were 430 bp (Fig. 2) and 419 bp long (Fig. 3) respectively, for both the two species of Callosobruchus under study. However after final editing 404bp of 12SrRNA gene and 332bp of the 16SrRNA gene sequence were considered for sequence analysis. The sequences correspond to the positions 15342-15744 and 1425014576 respectively, of complete mitogenome of Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae); Accession No. KF658070 (Coates, 2014). 12S phylogeny The 12SrRNA gene fragment revealed the occurrence of 175 variable sites of which 122 were found to be parsimony informative. The average nucleotide composition across the populations of both the species was found to be T=38, A=39, C=15 and G=8. The transition:transvertion ratio (R) was 0.86. As shown in Table. 3 within the genus Callosobruchus the minimum interspecies distance of 0.005 was observed between two populations of Callosobruchus maculatus under study and the Callosobruchus chinensis showed maximum divergence of 0.098 - 0.106 from other species of the same genus. Overall the interspecific distance ranged from 0.089 - 0.274. Amongst the outgroup members of the family cerambicydae Psacothea hilaris revealed maximum sequence divergence from the members of Bruchinae (0.216-0.274). The 12S trees drawn on the basis of neighbor joining ( Fig. 4) and maximum likelihood (Fig. 5) methods revealed almost identical topologies with minor differences. However the neighbor joining tree exhibited a better bootstrap support for most of the nodes. The Callosobruchus genus formed a separate monophylectic group with a high bootstrap value of 81% in NJ tree and 74% in ML tree. Within the major cluster Callosobruchus analis formed a common clade with the Callosobruchus chinensis species (AY625319). The Callosobruchus maculatus species (AY625320) grouped closely with its counterparts collected from the Indian subcontinent. The Callosobruchus subinnotatus species (AY625322) showed a close relationship to C.maculatus and hence formed a common clade. All the nodes were well supported by bootstrap values above 50. In both the trees the outgroup genera occupied similar positions but with minor intrageneric configurational variations. Figure 4.12S Neighbor Joining tree 18 THE SCITECH JOURNAL VOLUME 02 ISSUE 01 JANUARY 2015 THE SCITECH JOURNAL ISSN 2347-7318 ISSN 2348-2311 Online SAMANTHI Research Article Figure 5. 12S Maximum likelihood tree Figure 6. 16S Neighbor Joining tree 19 THE SCITECH JOURNAL VOLUME 02 ISSUE 01 JANUARY 2015 THE SCITECH JOURNAL ISSN 2347-7318 ISSN 2348-2311 Online SAMANTHI Research Article Figure 7. 16S Maximum Likelihood tree Discussion gene and 73% in 16S gene sequences of our species is in confirmation with the previous studies reported on coleopterans (Liu and Beckenbach, 1992; Forgie et al., 2006). A probable hypothesis for the favourable selection of A+T nucleotides in insect mtDNAs, is that, during long term evolution the DNA became rich in AT and the transcription enzymes started functioning optimally with this composition and therefore less optimally with GC-rich DNA (Clary and Wolstenholme, 1985). As the sequences for both the genes of the Callosobruchus species were rarely available in GenBank so somewhat separate species of the related genera were used to draw the phylogeny based upon on the 12S and 16S genes. We consider our study to be a robust estimate of the phylogeny of these sequences because the trees drawn on the basis of maximum likelihood and neighbor joining methods revealed similar configuration with minor alterations and the nodes were well supported by high bootstrap. The trees in both the cases showed two major groupings - the species of the family Cerambicydae occupying the basal position and the species of the family Chrysomelidae forming one large cluster. The family Cerambycidae commonly known as long horned beetles is a diverse group of phytophagous insects. Owing to their immense importance in the ecosystem as pests, decomposers and pollinators it is one of the most extensively studied group of the order coleoptera (Marvaldi et al., 2009). To analyze the phylogeny of the Indian Callosobruchus species sequences of the species of the same genus from other regions of the world and of the outgroup species of the related genera were obtained from GenBank, to draw a better picture. The species of the family cerambicydae were included in the final analysis to obtain rooted trees. The predictably high A+T content of 77% in sequences of 12S The genus Callosobruchus of the tribe bruchini occupied a central position in all the trees. In the 16S tree the genera Bruchidius and Callosobruchus formed sister grouping in conformation with the fact that both belong to the subtribe Bruchidina. In case of the 12S gene phylogeny the Callosobruchus species shows up as a sister group of the acanthoscelides in the maximum likelihood tree. However, the 16S phylogeny Of the 332 bp included in the final analysis of the 16SrRNA amplicon 209bp were found to be conserved while 119bp were variable with 96 parsimony informative sites. The sequences of both the species revealed an average A:T:G:C ratio of 34:39:18:9. The ts:tv ratio came out to be 0.38. The interspecies distance between Callosobruchus species under study ranged from 0.003 to 0.010. The species Monochamus alternatus showed maximum divergence from Callosobruchus maculatus with an intraspecific distance of 0.257. Similarly the species of the genus Bruchidius showed less divergence from the Callosobruchus species under study with the intraspecific distance ranging from 0.131- 0.175 (Table 4). The phylogenetic trees drawn on the basis of neighbor joining and method maximum likelihood are shown in Fig. 6 and Fig. 7 respectively. Both the trees revealed similar topology with minor variations. The species grouped according to their respective genera. The outgroup species of the family Cerambicydae included in the present study formed an entirely separate group and occupied the bottom position of the tree. The 16SrRNA trees also support the monophyly of the Callosobruchus genus. The nodes were well supported by high bootstrap values. 20 THE SCITECH JOURNAL VOLUME 02 ISSUE 01 JANUARY 2015 THE SCITECH JOURNAL ISSN 2347-7318 ISSN 2348-2311 Online SAMANTHI Research Article Table1. List of the species whose 12S gene sequences were retrieved from GenBank public database and included in analysis Sl No Taxon Family Subfamily Reared on Locality Accession number 1 Callosobruchus maculatus Chrysomelidae Bruchinae Vigna radiata Kenya AY625320 2 Callosobruchus subinnotatus Chrysomelidae Bruchinae Vigna subterranea Senegal AY625322 3 Callosobruchus chinensis Chrysomelidae Bruchinae Cajanus cajan Egypt AY625319 4 Bruchidius murinus Chrysomelidae Bruchinae Trifolium subterraneum Greece HQ178008 5 Bruchidius tibialis Chrysomelidae Bruchinae Medicago polymorpha Greece HQ178011 6 Bruchidius dispar Chrysomelidae Bruchinae Trifolium medium France AY390643 7 Bruchidius fulvicornis Chrysomelidae Bruchinae Trifolium vesiculosum France AY390644 8 Bruchidius pusillus Chrysomelidae Bruchinae Hippocrepis emerus France AY390650 9 Bruchidius seminarius Chrysomelidae Bruchinae Tetragonobolus maritimus France AY390652 10 Bruchus brachialis Chrysomelidae Bruchinae Vicia villosa France AY390660 11 Bruchus luteicornis Chrysomelidae Bruchinae Vicia sativa France AY390662 12 Bruchus atomarius Chrysomelidae Bruchinae Lathyrus macrorhyzus France DQ307623 13 Tuberculobruchus babaulti Chrysomelidae Bruchinae Acacia amythethophylla Kenya AY625326 14 Tuberculobruchus natalensis Chrysomelidae Bruchinae Acacia sieberiana Senegal AY625327 15 Tuberculobruchus sinaitus Chrysomelidae Bruchinae Acacia tortilis Senegal AY625329 16 Acanthoscelides flavescens Chrysomelidae Bruchinae Rhynchosia minima Mexico AY945973 17 Acanthoscelides guazumae Chrysomelidae Bruchinae Guazuma tomentosa Mexico AY945974 18 Acanthoscelides sanfordi Chrysomelidae Bruchinae Pachyrhizus erosus Mexico Ay945987 19 Gaurotes tuberculicolis Cerambicydae Lepturinae - China KF737658 20 Monochamus alternatus Cerambicydae Lamiinae - China KJ809086 21 Moechotypa diphysis Cerambicydae Lamiinae - China KF737697 22 Lamiinae Cerambicydae Lamiinae - Korea FJ424074 21 THE SCITECH JOURNAL VOLUME 02 ISSUE 01 JANUARY 2015 THE SCITECH JOURNAL ISSN 2347-7318 ISSN 2348-2311 Online SAMANTHI Research Article Table 2. List of the species whose 16S gene sequences were retrieved from GenBank public database and included in analysis Sl No Taxon Family Subfamily Reared on Locality Accession 1 Bruchidius seminarius Chrysomelidae Bruchinae Tetragonobolus maritimus France Hq178231 2 Bruchidius cinerascens Chrysomelidae Bruchinae Eryngium campestre France HQ178221 3 Bruchidius villosus Chrysomelidae Bruchinae Laburnum anagyroides France HQ178236 4 Bruchidius murinus Chrysomelidae Bruchinae Trifolium subterraneum Greece HQ178227 5 Bruchidius tibialis Chrysomelidae Bruchinae Medicago polymorpha Greece HQ178233 6 Bruchidius varius Chrysomelidae Bruchinae Trifolium angustifolium France HQ178235 7 Bruchidius pygmaeus Chrysomelidae Bruchinae Trifolium angustifolium France HQ178230 8 Bruchidius bimaculatus Chrysomelidae Bruchinae Bruchinae France HQ178219 9 Mimosestes anomalus Chrysomelidae Bruchinae Acacia pennatula Mexico AB499927 10 Mimosestes cinerifer Chrysomelidae Bruchinae Acacia sphaerocephala Mexico AB499928 11 Mimosestes viduatus Chrysomelidae Bruchinae Acacia chiapensis Mexico AB499940 12 Mimosestes nubigens Chrysomelidae Bruchinae Acacia schaffneri Mexico AB499937 13 Mimosestes amicus Chrysomelidae Bruchinae Prosopis pallida Hawaii AB499925 14 Gaurotes tuberculicolis Cerambicydae Cerambicyd Lepturinae China KF737721 15 Monochamus alternatus Cerambicydae Cerambicyd Lamiinae China KF737765 16 .Pachyta bicuneata Cerambicydae Cerambicyd Pachyrhizus erosus China DQ861334 17 Psacothea hilaris Cerambicydae Cerambicyd Lepturinae Korea KF737766 22 THE SCITECH JOURNAL VOLUME 02 ISSUE 01 JANUARY 2015 THE SCITECH JOURNAL ISSN 2347-7318 ISSN 2348-2311 Online SAMANTHI Research Article Table 3. Percentage divergence matrix of 12S sequences 23 THE SCITECH JOURNAL VOLUME 02 ISSUE 01 JANUARY 2015 THE SCITECH JOURNAL ISSN 2347-7318 ISSN 2348-2311 Online SAMANTHI Research Article Table 4. Percentage Divergence matrix of 16S sequences 24 THE SCITECH JOURNAL VOLUME 02 ISSUE 01 JANUARY 2015 THE SCITECH JOURNAL ISSN 2347-7318 ISSN 2348-2311 Online SAMANTHI Research Article grouping is not supported by relevant internal bootstrap node value 29. In the neighbor joining tree, the genus Callosobruchus clearly appears as a monophyletic group with a bootstrap support of 81%. Similarly the gene sequence data also firmly supports the monophyly of this group with a bootstrap value of 100%. Conclusion The results clearly point towards the monophyly of one of the most destructive pulse pests of India. This study reveals the usefulness of the mitochondrial ribosomal genes as potent molecular markers for unravelling the deeper phylogenetic relationship of the family chrysomelidae. The sequence data generated will be helpful for further studies on phylogenetic origins and biogeographical evolution of the group. Acknowledgments We acknowledge the Department of Zoology, Panjab University, Chandigarh for providing all the necessary facilities for this work. We are thankful to the University Grants Commission (UGC), New Delhi for financial support under CAS programme. We are grateful to Chromous Biotech Pvt. Ltd., Bangalore, India, for providing the services of sequencing. References Agrawal, A., Lal, S. and Gupta, K.C. 1988. Natural products as protectants of pulses against pulse beetle. B Grain Technol 26: 154164. FAO 2012. www.faostat.org. Accessed on 28 June 2012. Kusolwa, P.M. 2007. Breeding for bruchid resistance in common bean (Phaseolus vulgaris L.): Interspecific introgression of lectinlike seed proteins from tepary bean (P. acutifolius A. Gray), genetic control and bruchid characterization. Ph.D. Thesis, Oregon State University, Corvallis, Oregon, USA. Anonymous. 2007. Crop protection compendium walling ford, UK CAB International Rules for Seed Testing, Seed Science and Technology 2:1-335. Romero, N.J., Johnson, C.D. 2004. Checklist of the Bruchidae (Coleoptera) of Mexico. Coleopts. bull. 58(4): 613-635. Thakur, D.R. 2012. Taxonomy, distribution and pest status of Indian biotypes of Acanthoscelides obtectus (Coleoptera: Chrysomelidae: Bruchinae) - A New Record. Pak. J. Zool. 44(1): 189-195. Arora, G.L. 1977. Bruchidae of North-West India. Oriental Insects Supplement No. 7. The association for the study of Oriental Insects, New Delhi, PP.132. Pruthi, H.S. and Singh, M. 1950. Pests of storedgrain and their control. Indian Council for Agricultural Research Miscellaneous Bulletin No. 57. Kergoat, G.J., Delobel, A., Fediere, G., Le-Ru, B. and Silvain, J.-F. 2005. Both host-plant phylogeny and chemistry have shaped the African seed beetle radiation. Mol. Phylogenet. Evol. 35:602–611. Funk, D.J., Futuyma, D.J., Orti, G. and Meyer, A. 1995. A history of host assosciations and evolutionary diversification for ophraella (Coleoptera:Chrysomelidae): New Evidence from Mitochondrial DNA. Evolution 49(5): 1008-1017. Slobodchikoff, C.N. and Johnson, C.D. 1973. A phenetic and phylogenetic approach to the classification of a genus of seed-beetles (Coleoptera: Bruchidae). Syst. Zool. 22: 280-294. Jie, G., Ya-Qing, M., Wang, L., Jia-Jun, X., Zhang Y., et al., 2009. Genetic differentiation among different geographic populations of the cowpea weevil, Callosobruchus maculatus (Coleoptera: Bruchidae). Acta Entomol. Sin. 52(12): 1349-1355. Sambrook, J., Fritsh, E.F. and Maniatis, T. 1989. Molecular cloning: a laboratory manual , 2nd edition. Cold Spring Harbour Laboratory Press, New York. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., et al., 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87: 651–701. Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., et al., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl. Acids. Res. 25(17): 33893402. Sievers, F., Wilm, A., Dineen, D.G., Gibson, T.J., Karplus, K., et al., 2011. “Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega”. Mol. Syst. Biol. 7(7): 539. Kimura, M. 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16: 111-120. Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S. 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 30: 2725-2729. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39(4): 783-791. Coates, B.S. 2014. Assembly and annotation of full mitochondrial genomes for the corn rootworm species, Diabrotica virgifera virgifera and Diabroticabarberi (Insecta: Coleoptera: Chrysomelidae), using Next Generation Sequence data. Gene 542 (2): 190-197. Liu, H. and Beckenbach, A.T. 1992. Evolution of the mitochondrial cytochrome oxidase II gene among 10 orders of insect. Mol. Phylogenet. Evol. 1: 41-52. Forgie, S.A., Goodacre, S.L., Taylor, M.I. and Emerson, B.C. 2006. Characterization of microsatellite loci in Brachyderes rugatus, the Canary Islands pine weevil (Coleoptera: Curculionidae). Mol. Ecol. 6: 820–822. Clary, D.O. and Wolstenholme, D.R. 1985. The ribosomal RNA genes of Drosophila mitochondrial DNA. Nucl. Acids Res. 13: 40294045. Marvaldi, A.E., Duckett, C.N., Kjer, K. and Gillespie, J. 2009. Structural alignment of 18S and 28S rDNA sequences provides insights into phylogeny of Phytophaga (Coleoptera: Curculionoidea and Chrysomeloidea). Zool. Scripta. 38: 63-77. To cite this article: Neha Goyal and Vijay Lakshmi Sharma 2015 Phylogenetic Relationship among Some Species of Bruchinae Based Upon 16S and 12S Ribosomal RNA Gene Sequences. The Scitech Journal 02(01): 16-25 25 THE SCITECH JOURNAL VOLUME 02 ISSUE 01 JANUARY 2015